ID: 1196004627

View in Genome Browser
Species Human (GRCh38)
Location X:110822454-110822476
Sequence GCGCCGTTTTTTAAGCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196004623_1196004627 3 Left 1196004623 X:110822428-110822450 CCAGTTGCGGGATATAATCTCCT 0: 10
1: 432
2: 1665
3: 1879
4: 1703
Right 1196004627 X:110822454-110822476 GCGCCGTTTTTTAAGCTGGTTGG No data
1196004621_1196004627 11 Left 1196004621 X:110822420-110822442 CCTCCGAGCCAGTTGCGGGATAT 0: 5
1: 520
2: 1522
3: 1829
4: 1191
Right 1196004627 X:110822454-110822476 GCGCCGTTTTTTAAGCTGGTTGG No data
1196004617_1196004627 26 Left 1196004617 X:110822405-110822427 CCGTGGGCGTAGGACCCTCCGAG 0: 903
1: 1508
2: 1213
3: 891
4: 695
Right 1196004627 X:110822454-110822476 GCGCCGTTTTTTAAGCTGGTTGG No data
1196004622_1196004627 8 Left 1196004622 X:110822423-110822445 CCGAGCCAGTTGCGGGATATAAT 0: 9
1: 663
2: 1289
3: 1128
4: 632
Right 1196004627 X:110822454-110822476 GCGCCGTTTTTTAAGCTGGTTGG No data
1196004620_1196004627 12 Left 1196004620 X:110822419-110822441 CCCTCCGAGCCAGTTGCGGGATA 0: 4
1: 524
2: 1521
3: 1805
4: 1153
Right 1196004627 X:110822454-110822476 GCGCCGTTTTTTAAGCTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196004627 Original CRISPR GCGCCGTTTTTTAAGCTGGT TGG Intergenic
No off target data available for this crispr