ID: 1196005880

View in Genome Browser
Species Human (GRCh38)
Location X:110836733-110836755
Sequence TTTATTTGATCTGGAGTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196005880_1196005889 26 Left 1196005880 X:110836733-110836755 CCTAGAACTCCAGATCAAATAAA No data
Right 1196005889 X:110836782-110836804 GGGCCTGTGGAGAGCTCAAGAGG No data
1196005880_1196005888 13 Left 1196005880 X:110836733-110836755 CCTAGAACTCCAGATCAAATAAA No data
Right 1196005888 X:110836769-110836791 GAGGAATGAGGAGGGGCCTGTGG No data
1196005880_1196005884 1 Left 1196005880 X:110836733-110836755 CCTAGAACTCCAGATCAAATAAA No data
Right 1196005884 X:110836757-110836779 GTTGATGAAAAAGAGGAATGAGG No data
1196005880_1196005887 6 Left 1196005880 X:110836733-110836755 CCTAGAACTCCAGATCAAATAAA No data
Right 1196005887 X:110836762-110836784 TGAAAAAGAGGAATGAGGAGGGG No data
1196005880_1196005886 5 Left 1196005880 X:110836733-110836755 CCTAGAACTCCAGATCAAATAAA No data
Right 1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG No data
1196005880_1196005885 4 Left 1196005880 X:110836733-110836755 CCTAGAACTCCAGATCAAATAAA No data
Right 1196005885 X:110836760-110836782 GATGAAAAAGAGGAATGAGGAGG No data
1196005880_1196005883 -6 Left 1196005880 X:110836733-110836755 CCTAGAACTCCAGATCAAATAAA No data
Right 1196005883 X:110836750-110836772 AATAAAGGTTGATGAAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196005880 Original CRISPR TTTATTTGATCTGGAGTTCT AGG (reversed) Intergenic
No off target data available for this crispr