ID: 1196005886

View in Genome Browser
Species Human (GRCh38)
Location X:110836761-110836783
Sequence ATGAAAAAGAGGAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196005879_1196005886 13 Left 1196005879 X:110836725-110836747 CCTATAATCCTAGAACTCCAGAT No data
Right 1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG No data
1196005882_1196005886 -4 Left 1196005882 X:110836742-110836764 CCAGATCAAATAAAGGTTGATGA No data
Right 1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG No data
1196005880_1196005886 5 Left 1196005880 X:110836733-110836755 CCTAGAACTCCAGATCAAATAAA No data
Right 1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196005886 Original CRISPR ATGAAAAAGAGGAATGAGGA GGG Intergenic
No off target data available for this crispr