ID: 1196006540

View in Genome Browser
Species Human (GRCh38)
Location X:110843316-110843338
Sequence CAGAGGAAACAGTAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196006540_1196006552 28 Left 1196006540 X:110843316-110843338 CCCACTTCCTACTGTTTCCTCTG No data
Right 1196006552 X:110843367-110843389 GGTGCCCGTGCCAGACTACCTGG No data
1196006540_1196006545 7 Left 1196006540 X:110843316-110843338 CCCACTTCCTACTGTTTCCTCTG No data
Right 1196006545 X:110843346-110843368 TGCCCCCACTCAAGTCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196006540 Original CRISPR CAGAGGAAACAGTAGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr