ID: 1196006842

View in Genome Browser
Species Human (GRCh38)
Location X:110845601-110845623
Sequence GTCAAAGATATGTAGATATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196006837_1196006842 29 Left 1196006837 X:110845549-110845571 CCTGTCCACTCTTAAAGATTCTT No data
Right 1196006842 X:110845601-110845623 GTCAAAGATATGTAGATATATGG No data
1196006841_1196006842 1 Left 1196006841 X:110845577-110845599 CCAGTGTATGTTTTTATCTACTT No data
Right 1196006842 X:110845601-110845623 GTCAAAGATATGTAGATATATGG No data
1196006839_1196006842 3 Left 1196006839 X:110845575-110845597 CCCCAGTGTATGTTTTTATCTAC No data
Right 1196006842 X:110845601-110845623 GTCAAAGATATGTAGATATATGG No data
1196006838_1196006842 24 Left 1196006838 X:110845554-110845576 CCACTCTTAAAGATTCTTTTGCC No data
Right 1196006842 X:110845601-110845623 GTCAAAGATATGTAGATATATGG No data
1196006840_1196006842 2 Left 1196006840 X:110845576-110845598 CCCAGTGTATGTTTTTATCTACT No data
Right 1196006842 X:110845601-110845623 GTCAAAGATATGTAGATATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196006842 Original CRISPR GTCAAAGATATGTAGATATA TGG Intergenic
No off target data available for this crispr