ID: 1196010074

View in Genome Browser
Species Human (GRCh38)
Location X:110877399-110877421
Sequence CACCTGTGCCTATTTTCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196010074_1196010075 -7 Left 1196010074 X:110877399-110877421 CCTCTGGAAAATAGGCACAGGTG No data
Right 1196010075 X:110877415-110877437 ACAGGTGCTTTCCCAGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196010074 Original CRISPR CACCTGTGCCTATTTTCCAG AGG (reversed) Intergenic
No off target data available for this crispr