ID: 1196010075

View in Genome Browser
Species Human (GRCh38)
Location X:110877415-110877437
Sequence ACAGGTGCTTTCCCAGCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196010067_1196010075 23 Left 1196010067 X:110877369-110877391 CCAGCTCCAGTACACATGACTGG No data
Right 1196010075 X:110877415-110877437 ACAGGTGCTTTCCCAGCCTTTGG No data
1196010074_1196010075 -7 Left 1196010074 X:110877399-110877421 CCTCTGGAAAATAGGCACAGGTG No data
Right 1196010075 X:110877415-110877437 ACAGGTGCTTTCCCAGCCTTTGG No data
1196010072_1196010075 -1 Left 1196010072 X:110877393-110877415 CCAGCACCTCTGGAAAATAGGCA No data
Right 1196010075 X:110877415-110877437 ACAGGTGCTTTCCCAGCCTTTGG No data
1196010069_1196010075 17 Left 1196010069 X:110877375-110877397 CCAGTACACATGACTGGACCAGC No data
Right 1196010075 X:110877415-110877437 ACAGGTGCTTTCCCAGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196010075 Original CRISPR ACAGGTGCTTTCCCAGCCTT TGG Intergenic
No off target data available for this crispr