ID: 1196010403

View in Genome Browser
Species Human (GRCh38)
Location X:110880912-110880934
Sequence GTGTCACAGCTCCAGTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196010403_1196010409 21 Left 1196010403 X:110880912-110880934 CCCTGTGACTGGAGCTGTGACAC No data
Right 1196010409 X:110880956-110880978 CTGTGTGCACACCCATGCCCTGG No data
1196010403_1196010410 22 Left 1196010403 X:110880912-110880934 CCCTGTGACTGGAGCTGTGACAC No data
Right 1196010410 X:110880957-110880979 TGTGTGCACACCCATGCCCTGGG No data
1196010403_1196010411 28 Left 1196010403 X:110880912-110880934 CCCTGTGACTGGAGCTGTGACAC No data
Right 1196010411 X:110880963-110880985 CACACCCATGCCCTGGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196010403 Original CRISPR GTGTCACAGCTCCAGTCACA GGG (reversed) Intergenic