ID: 1196010404

View in Genome Browser
Species Human (GRCh38)
Location X:110880913-110880935
Sequence GGTGTCACAGCTCCAGTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196010404_1196010410 21 Left 1196010404 X:110880913-110880935 CCTGTGACTGGAGCTGTGACACC No data
Right 1196010410 X:110880957-110880979 TGTGTGCACACCCATGCCCTGGG No data
1196010404_1196010409 20 Left 1196010404 X:110880913-110880935 CCTGTGACTGGAGCTGTGACACC No data
Right 1196010409 X:110880956-110880978 CTGTGTGCACACCCATGCCCTGG No data
1196010404_1196010411 27 Left 1196010404 X:110880913-110880935 CCTGTGACTGGAGCTGTGACACC No data
Right 1196010411 X:110880963-110880985 CACACCCATGCCCTGGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196010404 Original CRISPR GGTGTCACAGCTCCAGTCAC AGG (reversed) Intergenic