ID: 1196010405

View in Genome Browser
Species Human (GRCh38)
Location X:110880934-110880956
Sequence GTGGTGCTATAGCAGGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196010405_1196010411 6 Left 1196010405 X:110880934-110880956 CCTTTTCCCTGCTATAGCACCAC No data
Right 1196010411 X:110880963-110880985 CACACCCATGCCCTGGGCCATGG No data
1196010405_1196010409 -1 Left 1196010405 X:110880934-110880956 CCTTTTCCCTGCTATAGCACCAC No data
Right 1196010409 X:110880956-110880978 CTGTGTGCACACCCATGCCCTGG No data
1196010405_1196010410 0 Left 1196010405 X:110880934-110880956 CCTTTTCCCTGCTATAGCACCAC No data
Right 1196010410 X:110880957-110880979 TGTGTGCACACCCATGCCCTGGG No data
1196010405_1196010414 11 Left 1196010405 X:110880934-110880956 CCTTTTCCCTGCTATAGCACCAC No data
Right 1196010414 X:110880968-110880990 CCATGCCCTGGGCCATGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196010405 Original CRISPR GTGGTGCTATAGCAGGGAAA AGG (reversed) Intergenic