ID: 1196010406

View in Genome Browser
Species Human (GRCh38)
Location X:110880940-110880962
Sequence CACACAGTGGTGCTATAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196010406_1196010409 -7 Left 1196010406 X:110880940-110880962 CCCTGCTATAGCACCACTGTGTG No data
Right 1196010409 X:110880956-110880978 CTGTGTGCACACCCATGCCCTGG No data
1196010406_1196010411 0 Left 1196010406 X:110880940-110880962 CCCTGCTATAGCACCACTGTGTG No data
Right 1196010411 X:110880963-110880985 CACACCCATGCCCTGGGCCATGG No data
1196010406_1196010410 -6 Left 1196010406 X:110880940-110880962 CCCTGCTATAGCACCACTGTGTG No data
Right 1196010410 X:110880957-110880979 TGTGTGCACACCCATGCCCTGGG No data
1196010406_1196010414 5 Left 1196010406 X:110880940-110880962 CCCTGCTATAGCACCACTGTGTG No data
Right 1196010414 X:110880968-110880990 CCATGCCCTGGGCCATGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196010406 Original CRISPR CACACAGTGGTGCTATAGCA GGG (reversed) Intergenic