ID: 1196010409

View in Genome Browser
Species Human (GRCh38)
Location X:110880956-110880978
Sequence CTGTGTGCACACCCATGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196010406_1196010409 -7 Left 1196010406 X:110880940-110880962 CCCTGCTATAGCACCACTGTGTG No data
Right 1196010409 X:110880956-110880978 CTGTGTGCACACCCATGCCCTGG No data
1196010404_1196010409 20 Left 1196010404 X:110880913-110880935 CCTGTGACTGGAGCTGTGACACC No data
Right 1196010409 X:110880956-110880978 CTGTGTGCACACCCATGCCCTGG No data
1196010407_1196010409 -8 Left 1196010407 X:110880941-110880963 CCTGCTATAGCACCACTGTGTGC No data
Right 1196010409 X:110880956-110880978 CTGTGTGCACACCCATGCCCTGG No data
1196010403_1196010409 21 Left 1196010403 X:110880912-110880934 CCCTGTGACTGGAGCTGTGACAC No data
Right 1196010409 X:110880956-110880978 CTGTGTGCACACCCATGCCCTGG No data
1196010405_1196010409 -1 Left 1196010405 X:110880934-110880956 CCTTTTCCCTGCTATAGCACCAC No data
Right 1196010409 X:110880956-110880978 CTGTGTGCACACCCATGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196010409 Original CRISPR CTGTGTGCACACCCATGCCC TGG Intergenic
No off target data available for this crispr