ID: 1196011131

View in Genome Browser
Species Human (GRCh38)
Location X:110889107-110889129
Sequence GTGCCATGCCCTACTGGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196011131_1196011138 13 Left 1196011131 X:110889107-110889129 CCACTACCAGTAGGGCATGGCAC No data
Right 1196011138 X:110889143-110889165 AGAAACTTGGAAATGAAATGTGG No data
1196011131_1196011137 0 Left 1196011131 X:110889107-110889129 CCACTACCAGTAGGGCATGGCAC No data
Right 1196011137 X:110889130-110889152 CCATGATGAAGGGAGAAACTTGG No data
1196011131_1196011139 14 Left 1196011131 X:110889107-110889129 CCACTACCAGTAGGGCATGGCAC No data
Right 1196011139 X:110889144-110889166 GAAACTTGGAAATGAAATGTGGG No data
1196011131_1196011134 -10 Left 1196011131 X:110889107-110889129 CCACTACCAGTAGGGCATGGCAC No data
Right 1196011134 X:110889120-110889142 GGCATGGCACCCATGATGAAGGG No data
1196011131_1196011140 15 Left 1196011131 X:110889107-110889129 CCACTACCAGTAGGGCATGGCAC No data
Right 1196011140 X:110889145-110889167 AAACTTGGAAATGAAATGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196011131 Original CRISPR GTGCCATGCCCTACTGGTAG TGG (reversed) Intergenic