ID: 1196014120

View in Genome Browser
Species Human (GRCh38)
Location X:110919358-110919380
Sequence GGTTCAAGAAAGCCACCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196014120_1196014128 25 Left 1196014120 X:110919358-110919380 CCCAGAGGTGGCTTTCTTGAACC No data
Right 1196014128 X:110919406-110919428 CATGTTGCCTGATAAAGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196014120 Original CRISPR GGTTCAAGAAAGCCACCTCT GGG (reversed) Intergenic
No off target data available for this crispr