ID: 1196018208

View in Genome Browser
Species Human (GRCh38)
Location X:110961904-110961926
Sequence CCTGAAAATCTGTTCTTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 344}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196018208 Original CRISPR CCTGAAAATCTGTTCTTTCA TGG Intronic
903623551 1:24715235-24715257 CCAGAGAATCTGATCTCTCATGG - Intergenic
904737034 1:32642533-32642555 CCGGCAAAGCTGTTCTTTCTGGG + Intronic
905259782 1:36709166-36709188 TCTGCAAATCTGCTCTTCCAAGG - Intergenic
905986007 1:42282901-42282923 CATGAAAGTTTCTTCTTTCAAGG - Intronic
906079385 1:43074269-43074291 CCTGAAGATGTGTACTTTAAAGG + Intergenic
906711719 1:47935111-47935133 CCTGTAAATCTCTTCTAGCATGG + Intronic
906821225 1:48932210-48932232 CTTGCAAAGCTTTTCTTTCAGGG - Intronic
906845074 1:49182855-49182877 ACTGAATATCTGTTATTTCTTGG - Intronic
906950054 1:50327273-50327295 CCTGAAGTACTGTTCATTCAGGG - Intergenic
907325428 1:53634966-53634988 CATGACAATCTCTGCTTTCAGGG + Intronic
907969522 1:59367344-59367366 CCTGAAACTCTTTTCTCTCTGGG + Intronic
907982506 1:59497966-59497988 CATGAGAATATGCTCTTTCAGGG - Intronic
908409145 1:63845277-63845299 CCTGAGTAGCTGTTCTTTCAGGG - Intronic
908574393 1:65443798-65443820 TCTGAAAAGCTGTTCTTTTGGGG + Intronic
909703435 1:78552978-78553000 CCTGGAAATCTGCTCTGGCAAGG - Intergenic
910238298 1:85058899-85058921 ATTGACCATCTGTTCTTTCATGG - Intronic
910289107 1:85582618-85582640 CCTGAAAGTAAGTTCCTTCAGGG + Exonic
910593212 1:88950379-88950401 CCTGGAAATCTGTGGTTTCCTGG + Intronic
911077688 1:93894377-93894399 CCTGAACATCTGGTCTTTTGAGG - Intronic
911167130 1:94734343-94734365 CCTGCAAAGCTGTTCTTTGTGGG + Intergenic
912085369 1:105995811-105995833 CCTGAAAATCTGATTTCTAAGGG + Intergenic
912620522 1:111151787-111151809 CCTGCAAAGCTGTTCTTTGTGGG - Intronic
913311364 1:117499289-117499311 CTTCATATTCTGTTCTTTCAGGG + Intronic
913989322 1:143595830-143595852 CCTCAAAAGCTGTACTTTCATGG - Intergenic
914585660 1:149059469-149059491 CTTCAAAAGCTGTACTTTCATGG - Intronic
915208650 1:154289598-154289620 CCTGCAAAGCTGTTCTTTGTGGG - Intergenic
917494703 1:175529713-175529735 CTAGAAAATCTCTTCTTCCATGG + Intronic
917501060 1:175585721-175585743 GCTGAAAATCTGTTCTCACATGG + Intronic
917587042 1:176437691-176437713 TCTGAGAATTTTTTCTTTCAAGG - Intergenic
918570516 1:185986321-185986343 CCTTAAAATCAGATTTTTCAAGG - Intronic
919486267 1:198151468-198151490 TGGGATAATCTGTTCTTTCAAGG - Intergenic
922537576 1:226392531-226392553 CCTGATATGCTGCTCTTTCAAGG - Intronic
923609805 1:235480415-235480437 CCTGAATATTTTTTCTTTCAAGG - Intronic
923811898 1:237327635-237327657 TCTTAAAATCGGTTCTTGCATGG - Intronic
1064174429 10:13061977-13061999 CCTGTAAAACTGTCCTTTCTGGG - Intronic
1064189168 10:13190381-13190403 CCTGAAAAACTGTTAGTTCTAGG + Intronic
1064624314 10:17246741-17246763 CATGAACATCTCTTGTTTCAGGG - Intergenic
1065358481 10:24866442-24866464 CCTGCACATCTGTGTTTTCATGG + Intronic
1066385828 10:34940445-34940467 CCAGAAAATGTTTTCTTTTAAGG + Intergenic
1066497381 10:35955355-35955377 CCTGGACATCTGTACTTTTAAGG - Intergenic
1069103143 10:64349026-64349048 ACTTAAAATGTGTTTTTTCAAGG - Intergenic
1070905388 10:80067835-80067857 CCTGCAAAGCTGTTCTTTGTGGG + Intergenic
1071250214 10:83810279-83810301 CCTGCAAATATATTCTTTGAAGG + Intergenic
1072803768 10:98411128-98411150 CTTGAAGATCTGGTGTTTCATGG - Intronic
1073980573 10:109149035-109149057 CCTGCAAAGCTGTTCTTTGTGGG - Intergenic
1075332867 10:121585943-121585965 ACTGAAAATCTGAACTTTAAGGG + Intronic
1075388937 10:122078309-122078331 CCTGAAAACCTGGTCGTGCAGGG + Intronic
1081592597 11:44435177-44435199 TATGTATATCTGTTCTTTCAGGG + Intergenic
1082890545 11:58134209-58134231 GATGAAATTCTCTTCTTTCAAGG - Intronic
1083084054 11:60124373-60124395 CCTGAAAAGCTGTCTTTTGAGGG + Intergenic
1084593451 11:70103813-70103835 CCTGAAACTCTGGGCTTTCATGG + Intronic
1085419351 11:76342234-76342256 CCTGAAATTCAGTTCTCCCATGG + Intergenic
1088505050 11:110519374-110519396 GCTGAAAACCTCTCCTTTCAGGG - Intergenic
1088684976 11:112277060-112277082 CCTCTTTATCTGTTCTTTCATGG - Intergenic
1089026821 11:115279369-115279391 CCTGAAACTTTGCTCTTACATGG - Intronic
1089806519 11:121095470-121095492 CCTGAAAATCAGCTCTCTCATGG - Intergenic
1089864171 11:121617273-121617295 CCTGAAAAGCTGTCCTTTGTGGG - Intronic
1089930450 11:122305180-122305202 CCTCCAAATCTGTTCTCCCAAGG + Intergenic
1090279418 11:125443249-125443271 CCTGAAAATCAGTTAATTCTTGG + Intergenic
1090505575 11:127309823-127309845 CCTGAAACTCTATTCTCACAAGG - Intergenic
1090992556 11:131832413-131832435 CCTGTATATTTGTTCTTTGATGG + Intronic
1092688766 12:11083270-11083292 GCTCAAAATCTGATGTTTCAAGG + Intronic
1093068962 12:14688501-14688523 TATGATAACCTGTTCTTTCATGG + Intronic
1093153923 12:15657241-15657263 TCTGGAATTCTCTTCTTTCAGGG + Intronic
1093251629 12:16812152-16812174 TCTGAAAATCTTTTTATTCATGG + Intergenic
1095155563 12:38849666-38849688 TCTGAAAATTTGTTCTTTTTGGG - Intronic
1095355388 12:41267045-41267067 CATGAAACTCTTTTTTTTCACGG + Intronic
1096116404 12:49058058-49058080 CCTGAAGAGCTGTTCACTCAAGG - Intronic
1096147396 12:49288646-49288668 CCTGACAATATGATCTTTGAGGG - Intergenic
1097106197 12:56627184-56627206 TCTGAAAATGTTATCTTTCAAGG + Intronic
1097220629 12:57448759-57448781 CCTGAAAATCTTTTCTCTCTTGG - Intronic
1097639711 12:62165585-62165607 GCTCAAAATCTTTACTTTCATGG + Intronic
1098183470 12:67872314-67872336 CCTGCAAAGCTGTTCTTTGTGGG - Intergenic
1098507564 12:71271795-71271817 CCTGAAATTCTTTTGTTTTAAGG + Intronic
1098719159 12:73873122-73873144 ACTGAAAGTCTGTTTTTTCCTGG - Intergenic
1098796081 12:74889620-74889642 CCTGAAAATCTCTTTTTGAAAGG - Intergenic
1100264698 12:92964367-92964389 CCTGCAAAGCTGTTCTTTGTGGG + Intergenic
1100412554 12:94335975-94335997 CCTGAAAAAGTGGCCTTTCATGG + Intronic
1102359842 12:112275846-112275868 CCTCCAAATCTCTTTTTTCATGG + Intronic
1103865950 12:124052331-124052353 CCTCAAAACCTGTCGTTTCATGG - Intronic
1104307260 12:127620930-127620952 GCTGAATATCTGATTTTTCAGGG + Intergenic
1106356502 13:28988368-28988390 TCTGAAAATCTGTTTGTTCCCGG + Intronic
1107654839 13:42581185-42581207 CTTGAAAATCTGCATTTTCATGG - Exonic
1108046963 13:46392274-46392296 CCTGCAAAGCTGTTCTTTGTGGG + Intronic
1108754521 13:53483904-53483926 TCTTAAAATCTGTGATTTCAAGG - Intergenic
1108886572 13:55192405-55192427 CCTGAAAACCTGAACTTTAATGG + Intergenic
1109337525 13:61011078-61011100 ACTGAAAATCTTTTGTTTCCTGG + Intergenic
1110091557 13:71454910-71454932 CCAGAACATCTTTTCTATCACGG - Intronic
1110495053 13:76158603-76158625 CCCATCAATCTGTTCTTTCAAGG + Intergenic
1110514476 13:76393647-76393669 CCTGAAAGTCTTTTCATTCCTGG + Intergenic
1111146727 13:84191530-84191552 CCTTAAACTCTCTTCTTTCCTGG + Intergenic
1112235736 13:97634622-97634644 TCTGAAAGTCTGTTCTCCCAAGG + Intergenic
1113086255 13:106572204-106572226 CATGCAATTCTCTTCTTTCAAGG - Intergenic
1113296252 13:108962083-108962105 CCTGACAATCTGTGGTTTTAAGG - Intronic
1114229419 14:20767087-20767109 CCTGCAAAGCTGTTCTTTGTGGG + Intergenic
1114615563 14:24066377-24066399 CCTGACCCACTGTTCTTTCAGGG + Exonic
1115869814 14:37786992-37787014 CGTGAAAGTCTGCTCTTTCACGG - Intronic
1115987635 14:39118753-39118775 CATGAAAATCTATACTTTCCAGG - Intronic
1116215764 14:42015223-42015245 CAAGAAAATCTGTTTTCTCAAGG - Intergenic
1116668204 14:47806137-47806159 CCTGAAAATATGTTCTATATTGG - Intergenic
1119784768 14:77304610-77304632 GCTGAAAATCAGTACATTCAAGG - Intronic
1120172200 14:81257368-81257390 TCTGAAAATCTCATCTTTAATGG - Intergenic
1120268870 14:82285222-82285244 CCTTAAAATCTAATCTTTAAGGG - Intergenic
1120394560 14:83952796-83952818 ACTGAAAATCTGTTTTATCTTGG + Intergenic
1120403379 14:84062839-84062861 ACAGAAAATCTTTTCTTTCAAGG - Intergenic
1120643458 14:87043724-87043746 GGTGATAATCTGTTGTTTCAAGG + Intergenic
1120654714 14:87176195-87176217 CCCCAAAATATGTTCTTTGAAGG - Intergenic
1121464302 14:94104552-94104574 CATGAAAAAATGTTCTTTCTGGG - Intergenic
1122480149 14:102041906-102041928 CCTGAGAAGATGTTCTTTCTGGG - Intronic
1123128023 14:105963501-105963523 CCTGCAAAGCTGTTCTTTGTGGG + Intergenic
1123408545 15:20039667-20039689 CCTGCAAAGCTGTTCTTTGTGGG + Intergenic
1123517876 15:21046377-21046399 CCTGCAAAGCTGTTCTTTGTGGG + Intergenic
1123694996 15:22872516-22872538 CCTGGAAGTCTGTGCTTTCTTGG - Intronic
1125216165 15:37277962-37277984 TCTGAAATTCTGTTATTTTAAGG - Intergenic
1125453699 15:39835791-39835813 CCTGAAACTCTGTTTTTAGATGG - Intronic
1127277708 15:57461786-57461808 GCTGGAAACCTCTTCTTTCAGGG - Exonic
1130807797 15:87344801-87344823 CCTGGAAAGCTGTTCTGCCATGG + Intergenic
1131558201 15:93417479-93417501 ACAGAAATTCTTTTCTTTCAAGG - Intergenic
1133068374 16:3227260-3227282 TCTGTCAATCTTTTCTTTCAAGG + Intronic
1135648725 16:24186907-24186929 CTTGAAAATATTTTCTTTGAGGG + Intronic
1137663455 16:50230821-50230843 TCTGAAAATGCTTTCTTTCAGGG + Exonic
1137929412 16:52572711-52572733 CCTCATAATCTCTTCTTTCCTGG + Intergenic
1137934423 16:52620834-52620856 CCAGAAAATCAGTTCTTGCCTGG + Intergenic
1139362353 16:66408025-66408047 CCAGAAAATCTGTTGTTAAAGGG + Intergenic
1141128323 16:81417038-81417060 CCTGGCAATCTGTGTTTTCAGGG + Intergenic
1144769896 17:17753650-17753672 CCTTAAAATCTGTGATTTGAGGG - Intronic
1146297326 17:31660043-31660065 CTAGAAAATCTGTTCATTCTGGG - Intergenic
1148584224 17:48765921-48765943 CATGATAAACTGCTCTTTCAGGG + Intronic
1148609206 17:48952863-48952885 CCAGACAATCAGTTCTATCATGG - Intergenic
1148628587 17:49089358-49089380 CCTGTCATTCTGTTTTTTCAAGG - Intergenic
1149937151 17:60819595-60819617 CCTGAAAATCTGTGCTGTTAGGG + Intronic
1150184628 17:63167400-63167422 CATGACAATCTGTTCATTAATGG + Intronic
1150319672 17:64202129-64202151 CCTGAAAATCTTTGGTTTCTGGG - Intronic
1150909208 17:69370682-69370704 CCTGCAAAGCTGTTCTTTGTAGG - Intergenic
1150916147 17:69439092-69439114 CCAGCAAATATGTTCTTTAAAGG - Intronic
1150956067 17:69862023-69862045 CCTGCAAAGCTGTTCTTTGTGGG + Intergenic
1153157129 18:2162409-2162431 CCTGCAAAGCTGTTCTTTGTGGG + Intergenic
1153178598 18:2406951-2406973 TCTGCAAATCAGTTATTTCATGG + Intergenic
1153650073 18:7231689-7231711 CAAGAAAATCAGTTCCTTCAGGG - Exonic
1155099179 18:22591780-22591802 CCATAAAATCTGTTTTGTCAAGG - Intergenic
1155441839 18:25870334-25870356 CCTGACAATCTGTTCTTCCCTGG + Intergenic
1156534101 18:37846506-37846528 TCTGAAAACCTTTTCTCTCATGG - Intergenic
1156821968 18:41383899-41383921 CTTGCAATTCTGTTCTTTGAAGG - Intergenic
1157378716 18:47191396-47191418 CCTGAAAACCTGTTATATTATGG + Intergenic
1158075248 18:53520509-53520531 TCTGCATCTCTGTTCTTTCATGG - Intronic
1159937991 18:74383842-74383864 CCTGCAAAGCTGTTCTTTGTGGG - Intergenic
1160218057 18:76951313-76951335 ACTGAAAATCTGTTGTTTAATGG + Intronic
1162047438 19:8009920-8009942 CCAGAAAGTCAGTTCTTTAATGG - Intronic
1164432773 19:28202220-28202242 CATGAAAATCTGCTCTTTGCTGG - Intergenic
1167219834 19:48191746-48191768 CCTCAAAATCTGTTCCTCCGTGG + Intronic
925176327 2:1786599-1786621 CCTGCAAAGCTGTTCTTTGTAGG + Intergenic
926359986 2:12077849-12077871 CTTAAAAATCTGTTCTTTTTAGG + Intergenic
927620280 2:24648750-24648772 CACTAAAATCTGTTCTTTAATGG - Intronic
927638138 2:24830825-24830847 CTTGAAATTCTGTTCCTTCTAGG - Exonic
929929004 2:46237809-46237831 CCTGCAGATCTGTTCTTGGATGG + Intergenic
930084692 2:47487531-47487553 CATGAAATACTGTTCTTCCAGGG - Intronic
930354911 2:50305877-50305899 TCTGAAAGTCTGTTCTCACATGG - Intronic
930677582 2:54220813-54220835 CCACAAGATCTTTTCTTTCAGGG + Intronic
931892604 2:66690494-66690516 ACTGAATATCTGTTTTTTTATGG + Intergenic
933127747 2:78632132-78632154 TATGGAAATTTGTTCTTTCAAGG + Intergenic
934852387 2:97709718-97709740 CATGAAAATCTCTTCCCTCATGG - Intergenic
936871261 2:117136155-117136177 CCTGCAAAGCTGTTCTTTGTGGG - Intergenic
936949421 2:117963071-117963093 ATTGAAGCTCTGTTCTTTCAGGG - Intronic
939771921 2:146332079-146332101 CCTAGAAATATGTTCTTTCTTGG + Intergenic
940230661 2:151447839-151447861 CCTGGAATTCTGTTATTTTAAGG + Intronic
941036680 2:160576374-160576396 CTGGGAAATCTGTTCTTTCCTGG - Intergenic
941184588 2:162305742-162305764 CCTGAAAATAATTTCTTTTATGG - Intronic
941389110 2:164889827-164889849 GCTGGAAATCTGGTGTTTCATGG + Intergenic
941765993 2:169297095-169297117 CCTGAAAATCTGTTTCTGAATGG + Intronic
941807651 2:169724990-169725012 CATGAAAATCACTGCTTTCACGG + Intronic
942015273 2:171807147-171807169 GCTCTAAATCTCTTCTTTCAGGG - Intronic
942155382 2:173122232-173122254 CCTTAAAAGCTGTTCTTTGGGGG + Intronic
944014537 2:195019149-195019171 CCTGAAAATATGTTCTTCTTTGG + Intergenic
944959868 2:204859801-204859823 CCTGAAACTCTCTTCCTTTAAGG + Intronic
947427037 2:229993174-229993196 CCTGCAAAGCTGTTCTTTGTGGG + Intronic
1169310775 20:4537970-4537992 CATTTAAATTTGTTCTTTCATGG - Intergenic
1169711888 20:8573871-8573893 TCTGTAAGTCTGTTATTTCAGGG + Intronic
1169881925 20:10356275-10356297 CCAGAAATTCTGTTCTTGAATGG + Intergenic
1169909511 20:10636189-10636211 ACTGAAAATTTTTTCTTCCAGGG + Intronic
1170925584 20:20720239-20720261 ACTGAAAAAATGGTCTTTCAGGG + Intergenic
1172437116 20:34937137-34937159 AGGGAACATCTGTTCTTTCAGGG - Intronic
1174762504 20:53220180-53220202 GTTTAAAATCTGTTCCTTCATGG - Intronic
1175674860 20:60937847-60937869 TGTGGAAATCAGTTCTTTCAGGG + Intergenic
1176362273 21:6007745-6007767 CCTGCAAAGCTGTTCTTTGTGGG - Intergenic
1177670263 21:24215426-24215448 CTTGAATTTCTGTTCTTTGAAGG - Intergenic
1178208274 21:30495999-30496021 CCAGAATATCTTTACTTTCAGGG - Intergenic
1179761245 21:43530800-43530822 CCTGCAAAGCTGTTCTTTGTGGG + Intronic
1180657330 22:17433814-17433836 GCTGAAAATTGGTTCTTTTAGGG + Intronic
1180738403 22:18035810-18035832 CCTGAAAACCTGTGCTTTCTCGG - Intergenic
1181971099 22:26690779-26690801 CCTGGATATCTGCTCCTTCAGGG + Intergenic
1182740281 22:32562543-32562565 CCCCACAATCTGGTCTTTCACGG + Intronic
1182820564 22:33212130-33212152 CTTGAAAATCTGTTGTTTAGTGG - Intronic
1183906002 22:41040707-41040729 CCTTAAAATCTGTTATTTCTTGG + Intergenic
949091972 3:39391-39413 TCTGAAAAGATGTTTTTTCATGG - Intergenic
950352108 3:12365391-12365413 CCAGATAATCAGTTATTTCATGG + Intronic
951179603 3:19644037-19644059 CCTTGAAATCTGTGCTTTCCAGG + Intergenic
951455750 3:22890329-22890351 CATGAAAATTTGTGATTTCATGG + Intergenic
953082498 3:39633982-39634004 CCTGAAAATTTGAGCCTTCAAGG + Intergenic
953211827 3:40882412-40882434 CCTGAAAATCTGTTGTTCAGTGG + Intergenic
954907994 3:54079123-54079145 CCTGACAAACTGTTCTTCCTTGG + Intergenic
955607171 3:60717775-60717797 CCTGAGCATCTGTATTTTCAAGG + Intronic
956727224 3:72165910-72165932 CCAGAAATTCTGTTTTTTGATGG - Intergenic
956771941 3:72534432-72534454 TGGGAATATCTGTTCTTTCAGGG - Intergenic
957032288 3:75255617-75255639 TCTGAAAAGATGTTTTTTCATGG - Intergenic
957297628 3:78353268-78353290 CCTGCAAATCTGTTCTTGGTGGG + Intergenic
957544974 3:81625182-81625204 CCTGAAAATATCTTCTATCAAGG - Intronic
959363322 3:105423476-105423498 TTTTAACATCTGTTCTTTCAGGG + Intronic
960180093 3:114565893-114565915 CCTGAAAATTTGCTCTTACAGGG + Intronic
960739901 3:120821606-120821628 CCTGAAATACTTGTCTTTCAAGG + Intergenic
960810361 3:121622166-121622188 ACTGGAAATCTGTTCTTTCTCGG - Exonic
961164100 3:124751584-124751606 CCTGCAAAGCTGTTCTTTGTGGG + Intergenic
962076424 3:132086989-132087011 CCTGAAATCATCTTCTTTCAAGG - Intronic
962158822 3:132977765-132977787 CCTGGAAGTCTCTTCTTACATGG + Intergenic
963476511 3:145811988-145812010 CATTAAAATCTGTTCTTACCTGG - Intergenic
964612756 3:158631529-158631551 CCTGCAAAGCTGTTCTTTGTGGG - Intergenic
967406742 3:189124697-189124719 CATGAACATTTGTTATTTCATGG + Intronic
968558781 4:1265299-1265321 GCTGAAATTTTGTTCTTTGATGG + Intergenic
969079134 4:4604613-4604635 CCTGCAAAGCTGTTCTTTATGGG + Intergenic
970093200 4:12432533-12432555 CCTGCAAAGCTGTTCTTTGTGGG + Intergenic
970188637 4:13488582-13488604 CCTAAAATTCTGTTCTCCCATGG + Intergenic
970719399 4:18968777-18968799 CCCCAAAACCTGTTCCTTCACGG + Intergenic
970914465 4:21316541-21316563 AATGAAAATCTGTTATATCATGG - Intronic
971038535 4:22723392-22723414 GTTGAAACTCTGTTATTTCATGG + Intergenic
971916830 4:32881484-32881506 CCTGAAAATATGTTCACTTAAGG + Intergenic
972174580 4:36388011-36388033 ACTGAAAATCTGTGTTTTTAAGG - Intergenic
972535554 4:39996910-39996932 CCTGCAAAGCTGTTCTTTGTGGG + Intergenic
972566257 4:40271968-40271990 CCTGCAAAGCTGTTCTTTGTGGG + Intergenic
973245995 4:48012029-48012051 CCTGCAAAGCTGTTCTTTGTAGG - Intronic
974459126 4:62164904-62164926 CCTGGAAAGCTGTTCTTTGTTGG + Intergenic
974886474 4:67824454-67824476 CTTGAGAATTTGTTGTTTCAGGG + Intronic
975569084 4:75793807-75793829 CCTGAGCAACTGTTCTTTCTGGG - Exonic
976781554 4:88764535-88764557 TCTGAAAATCTGTAATTTCAGGG + Intronic
978122711 4:105099816-105099838 ACTGAAAATCTGTTGTTTAGTGG + Intergenic
978274565 4:106934748-106934770 TTTGAAAGACTGTTCTTTCATGG + Intronic
978337389 4:107684421-107684443 CCTGCAAAGCTGTTCTTTGTGGG + Intronic
979535369 4:121813578-121813600 CCTTAAAATCTGTTTTTTCCAGG - Intronic
979722744 4:123921100-123921122 CTTGAAAATTTTTTTTTTCATGG + Intergenic
979968187 4:127102594-127102616 GCTGAAGATGTGTTCTTTCTGGG + Intergenic
981173097 4:141647564-141647586 CCCGAATATCTCCTCTTTCAGGG - Intronic
984500138 4:180548075-180548097 TCTGTAAATCTATTCTTTCTGGG - Intergenic
984867343 4:184293119-184293141 CCTGAAAGTCTGTATTTTCCGGG + Intergenic
985053014 4:186011837-186011859 CATGAAAATGTGTTCTGTTATGG + Intergenic
986646883 5:9925457-9925479 CCTGCAAAGCTGTCCTTTCTGGG + Intergenic
987022251 5:13886691-13886713 ACTGACAGTCTGTTGTTTCATGG - Intronic
987239112 5:15975044-15975066 CCAGCAAAACTGTCCTTTCACGG + Intergenic
987356569 5:17068492-17068514 CCTGCAAAGCTGTTCTTTGTGGG + Intronic
987557517 5:19473459-19473481 CCTGAACATCTATGCTTTCCAGG + Exonic
987765738 5:22226856-22226878 CCTTAATCTCTGTGCTTTCACGG + Intronic
988388167 5:30593397-30593419 CCTAAATATCTGCTCTTTCCTGG - Intergenic
988568074 5:32336531-32336553 CCTGAAAAGCTGTCCTTTGTGGG - Intergenic
989747594 5:44848602-44848624 CCAGAAAATCTCTCCTTTCATGG + Intergenic
990307621 5:54508455-54508477 CCTGCAAAGCTGTTCTTTGTGGG - Intergenic
990375496 5:55166471-55166493 CCTGAATGTCCTTTCTTTCAAGG - Intronic
991007825 5:61847146-61847168 CTTGCCCATCTGTTCTTTCATGG - Intergenic
991197634 5:63955036-63955058 CCTGAAAGGCTGTTCTCTCTTGG + Intergenic
991349363 5:65704990-65705012 CCTGAAAATCAGTACTTTGCAGG - Intronic
992525333 5:77604435-77604457 TCTGAAAATATAGTCTTTCAAGG + Intronic
994700680 5:103130640-103130662 CCTGAAAATCTAGTTTTTCAGGG - Intronic
995401605 5:111748433-111748455 CATGACAATCTGTTATTTCTGGG - Intronic
995741267 5:115358304-115358326 CCTGCAAAGCTGTTCTTTGTGGG + Intergenic
996380703 5:122860125-122860147 CCTGCAAAGCTGTTCTTTGTGGG - Intronic
998190866 5:140023383-140023405 CCTCCAAATCTATTCATTCAAGG + Intronic
999907074 5:156153479-156153501 CCTGAAATCCTGCTCTTTAAGGG + Intronic
1000114400 5:158139636-158139658 CCTGAAAATCTAAGCTTACAAGG + Intergenic
1001673784 5:173495802-173495824 GATGAAAATCTCTCCTTTCATGG - Intergenic
1001815607 5:174666694-174666716 CCTGAAAATGTTTTCTTACATGG - Intergenic
1004604961 6:17185374-17185396 CCTGCAAAGCTGTTCTTTGTGGG - Intergenic
1004744174 6:18493326-18493348 CATGAAGGCCTGTTCTTTCATGG - Intergenic
1004880110 6:19999167-19999189 CATTAAAATCTATTCTGTCAAGG + Intergenic
1006107849 6:31727488-31727510 CCTGAAACTCTTTTCTCTGATGG + Intronic
1007869060 6:45011837-45011859 CCTTAAAAACTTTTCTTACATGG + Intronic
1009482678 6:64179664-64179686 TCTTAAATTCTATTCTTTCAGGG + Intronic
1009575509 6:65453091-65453113 TGTGAAAATTTGTTCTTTTAGGG - Intronic
1010796966 6:80128244-80128266 CCTGATAATCTGTAGTTTTAAGG + Intronic
1011121338 6:83956684-83956706 CCTGCAAATCTGTCCTTTGTGGG - Intronic
1011547458 6:88497089-88497111 CCTGAAAACCTGTTCTATTCTGG - Intergenic
1012634065 6:101513506-101513528 CCTGCAAAGCTGTTCTTTGTGGG - Intronic
1012695564 6:102377850-102377872 CTTGTATATTTGTTCTTTCATGG + Intergenic
1012802851 6:103855263-103855285 GTTGAATATCTGTTCTTTGAGGG + Intergenic
1014027429 6:116665404-116665426 CTTGACAATTTCTTCTTTCATGG - Intronic
1014138627 6:117916503-117916525 CCTGAAAATCTGTACCTATAAGG + Intronic
1014848791 6:126314004-126314026 CCTAAAAAGTTGTTCTTACAGGG + Intergenic
1014985552 6:128002776-128002798 CTTGTAAATTTGTTCTTTCGTGG + Intronic
1016359036 6:143248526-143248548 CCAGAAAAGCTGTTCTCTGAGGG - Intronic
1016933745 6:149433335-149433357 ACTGAAAATCTGTATCTTCATGG + Intergenic
1018075473 6:160208530-160208552 CCTGCAAAGCTGTTCTTTGTGGG + Intronic
1018233243 6:161696253-161696275 CCTGAATAAATGTCCTTTCAGGG + Intronic
1018322338 6:162624814-162624836 CTTGAAAATCTGTCCTTGCTGGG - Intronic
1018835823 6:167483109-167483131 CCTGCAAAGCTGTTCTTTGTGGG - Intergenic
1018992168 6:168682422-168682444 CCTGCAAAGCTGTTCTTTGTGGG + Intergenic
1019062972 6:169270139-169270161 CCTGCAAAGCTGTTCTTTGTGGG + Intergenic
1021537274 7:21720092-21720114 CCTGAACAGCATTTCTTTCAAGG + Intronic
1021548303 7:21841398-21841420 CATGAAAGTATGTTATTTCAGGG - Intronic
1023454797 7:40326776-40326798 CCTGAAAATCATTTTTGTCATGG - Intronic
1024144122 7:46494079-46494101 CATGAATATCTGATCTTGCAAGG + Intergenic
1025833351 7:65074152-65074174 CATTAAAATCTGCTTTTTCAAGG - Intergenic
1025903114 7:65763661-65763683 CATTAAAATCTGCTTTTTCAAGG - Intergenic
1026582783 7:71632144-71632166 CCTGAAAAGATGCTCTTACAAGG + Intronic
1027219718 7:76206258-76206280 CATCAAAAGCTGTTCTTGCATGG - Intronic
1027438703 7:78195196-78195218 ACATAAAATCTTTTCTTTCAAGG - Intronic
1027895923 7:84044763-84044785 CATGCAAAACTGTTCTCTCATGG - Intronic
1028602919 7:92621982-92622004 TATGAAAATCTGTTCTTTAGGGG + Intronic
1028704148 7:93818244-93818266 CTTGAACCTTTGTTCTTTCATGG - Intronic
1030129125 7:106182007-106182029 CCTGACAGTCTGTTTTTTAATGG + Intergenic
1030298171 7:107949494-107949516 GCTTAAAATCTGTTTTTTCCAGG - Intronic
1030748327 7:113196894-113196916 CCAGAAAATTTGTTTCTTCATGG - Intergenic
1031221875 7:118976780-118976802 CTTAAAACTCTGTTGTTTCAAGG - Intergenic
1032785373 7:135196094-135196116 CCTGAAAATCTGAGCTTCCCAGG + Intronic
1033122388 7:138677533-138677555 CCTGCAAAGCTGTTCTTTGTGGG + Intronic
1034786408 7:153929743-153929765 CAAGAAAAGCTTTTCTTTCAAGG - Intronic
1035426216 7:158776398-158776420 ACTGAAAATCTGTTGTTTAGTGG + Intronic
1036402871 8:8426047-8426069 CCTGAACATCTGTTCCCTCCAGG + Intergenic
1036983739 8:13501883-13501905 CCAGAAAATTTCTGCTTTCATGG + Intronic
1038701986 8:29857411-29857433 CCTCAAAAACTCTTCTTTAAAGG + Intergenic
1039814592 8:41081923-41081945 CCTGCAAAGCTGTTCTTTGGGGG - Intergenic
1039916659 8:41865247-41865269 CCTGAAAATGTGCTGCTTCAAGG - Intronic
1041053406 8:53958833-53958855 CCTGAATGTCTTTTCTTTGAGGG - Exonic
1043612343 8:82080320-82080342 CAAGAAAATCTGCTCTTTCTTGG - Intergenic
1043996028 8:86817620-86817642 CATGTAAATCTGTTTTTCCATGG - Intergenic
1044454089 8:92371705-92371727 TCTCAAAATTTCTTCTTTCAGGG + Intergenic
1044957635 8:97498158-97498180 CCTGCAAATCTCTTCTCTCTTGG + Intergenic
1046956589 8:120068765-120068787 CCAGAAAAGCCTTTCTTTCAAGG - Intronic
1046974861 8:120263049-120263071 CCTGAAATTCTGTTTGTTCATGG - Intronic
1047182176 8:122599475-122599497 CTTGAACTGCTGTTCTTTCATGG + Intergenic
1047263909 8:123287615-123287637 ACTGAAAATTTGTTCTTTCATGG + Intergenic
1048699360 8:137070627-137070649 CATGAACATATCTTCTTTCAAGG + Intergenic
1048754477 8:137721652-137721674 TCTGATAATCTTTTCATTCATGG + Intergenic
1048781359 8:138005812-138005834 TCTGGAAATATTTTCTTTCAAGG - Intergenic
1049314018 8:141949734-141949756 TCTGGAAATCTGTTTTCTCATGG - Intergenic
1050192078 9:3037298-3037320 CCTGGGAAGCTGTTCTTTCTGGG - Intergenic
1050692748 9:8246692-8246714 GCTGAAAATCTGTTCTGTATTGG - Intergenic
1050981869 9:12029281-12029303 CATGAATATTTGTTATTTCATGG + Intergenic
1050985963 9:12082930-12082952 ACTGAAAATCAGATCTTTCTTGG - Intergenic
1051516416 9:17935087-17935109 CCTCAGAAACTGTTTTTTCAAGG + Intergenic
1052360064 9:27544548-27544570 TCTGAAAATCTGATTTTTTAAGG + Intergenic
1052560282 9:30076570-30076592 CCTGCACATCTGTTCTTTGTGGG + Intergenic
1053175010 9:35916230-35916252 CCGGAAAACATGTTATTTCAAGG - Intergenic
1053317183 9:37061854-37061876 CCAGTAAGTCTATTCTTTCACGG + Intergenic
1054935577 9:70684159-70684181 CCTGATAATCTTGTATTTCAGGG - Intronic
1055269215 9:74537221-74537243 CATGAAAATCTGTTTTTGCTTGG + Intronic
1055352741 9:75406025-75406047 CCTGAAATTCTTTACCTTCAGGG - Intergenic
1057501341 9:95598934-95598956 CCTGGAACTCTGTTCTTTGGGGG - Intergenic
1057611740 9:96550364-96550386 CCTGACAAATTGTTATTTCATGG + Intronic
1058938812 9:109794277-109794299 CCAGAAAATCTGATCTCTTAGGG + Intronic
1059049916 9:110912922-110912944 GCTGAAAATCTGATCTTCCCAGG - Intronic
1059707057 9:116835373-116835395 CCTGCAAAGCTGTTCTTTGTAGG + Intronic
1060134566 9:121140192-121140214 CCTGAAAATATGTTAAATCAGGG - Intronic
1060925429 9:127452183-127452205 CCCGAAGATCAGTTCTTTCCAGG - Intronic
1061389151 9:130307586-130307608 TCTGGAAAGCTGTTCCTTCAGGG - Intronic
1061527195 9:131175797-131175819 TCTGAAAATCTTTGCTTTTAAGG + Intronic
1186586952 X:10885418-10885440 ACTGAGAATCTGTGGTTTCAAGG - Intergenic
1186750656 X:12618690-12618712 CCTCAAAATTTGGTCCTTCAAGG + Intronic
1187036129 X:15541960-15541982 TTTGAAAATCTGTTATTTCCAGG + Exonic
1187147184 X:16647598-16647620 GCTACAAATCTCTTCTTTCAAGG - Intronic
1188274490 X:28182925-28182947 CCCTAAAATCTGGCCTTTCATGG - Intergenic
1188450389 X:30302507-30302529 CCTGAGAGTCTGATCTATCAGGG - Intergenic
1188514847 X:30974175-30974197 GCTGAGAACCTGCTCTTTCATGG - Intronic
1192703979 X:73509100-73509122 CCTGCAAAGCTGTTCTTTGTAGG - Intergenic
1194317846 X:92403703-92403725 ACTGCAAATGTGTTTTTTCAAGG + Intronic
1194649182 X:96495470-96495492 CCTAAATATCTCTTCTTTCAAGG - Intergenic
1196018208 X:110961904-110961926 CCTGAAAATCTGTTCTTTCATGG + Intronic
1196376385 X:115037600-115037622 CCCTCAGATCTGTTCTTTCAAGG - Intergenic
1197656268 X:129119481-129119503 CCTGAAAATCTGTTTGTGAAAGG - Intergenic
1198140259 X:133795643-133795665 ACTCAAAATCTGTTTTTTAAAGG + Intronic
1199055434 X:143288396-143288418 CCTGAAAATGTGGTTTATCAGGG - Intergenic
1199272620 X:145902278-145902300 TCTGTCAATCTGTTTTTTCAGGG - Intergenic
1200579813 Y:4936843-4936865 CTTTAACATCTTTTCTTTCATGG + Intergenic
1200626021 Y:5516999-5517021 ACTGCAAATGTGTTTTTTCAAGG + Intronic
1200692728 Y:6323355-6323377 TCTGACAATTTGATCTTTCATGG - Intergenic
1201042545 Y:9851371-9851393 TCTGACAATTTGATCTTTCATGG + Intergenic