ID: 1196018467

View in Genome Browser
Species Human (GRCh38)
Location X:110964711-110964733
Sequence TTTCCCTCACAAATGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 432}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196018463_1196018467 15 Left 1196018463 X:110964673-110964695 CCTCTACCTGTGCCACGTCTGAA 0: 1
1: 0
2: 1
3: 10
4: 92
Right 1196018467 X:110964711-110964733 TTTCCCTCACAAATGAAAAATGG 0: 1
1: 0
2: 4
3: 39
4: 432
1196018464_1196018467 9 Left 1196018464 X:110964679-110964701 CCTGTGCCACGTCTGAAGAACAG 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1196018467 X:110964711-110964733 TTTCCCTCACAAATGAAAAATGG 0: 1
1: 0
2: 4
3: 39
4: 432
1196018466_1196018467 3 Left 1196018466 X:110964685-110964707 CCACGTCTGAAGAACAGGAAGTG 0: 1
1: 0
2: 1
3: 8
4: 147
Right 1196018467 X:110964711-110964733 TTTCCCTCACAAATGAAAAATGG 0: 1
1: 0
2: 4
3: 39
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196018467 Original CRISPR TTTCCCTCACAAATGAAAAA TGG Intronic
901603933 1:10444464-10444486 TTTCTCTCACAAACTAAAACAGG - Intronic
905216504 1:36412092-36412114 ACTGCCTCACAGATGAAAAATGG - Intergenic
906438429 1:45817557-45817579 TGTCCCACACAAATGCTAAAGGG + Intronic
906673554 1:47677331-47677353 TTTCCATCAGAAATGACAAATGG - Intergenic
906822913 1:48948124-48948146 TTTCACTTACAAATGTACAAAGG + Intronic
906909483 1:49932100-49932122 TTTCCCACACAATTCAAATAAGG + Intronic
907728244 1:57040547-57040569 TTCCCCTCACAAAGGAGATAAGG - Intronic
911260287 1:95677895-95677917 TTTACCTTACAATTGACAAATGG - Intergenic
911333329 1:96550919-96550941 TTTCCCTCCCAAATTATACATGG + Intergenic
912093432 1:106110741-106110763 TTTTCCTAAGAAATTAAAAATGG - Intergenic
912247299 1:107973185-107973207 TTGCACACACAAATGGAAAAAGG + Intergenic
912819836 1:112858249-112858271 TGTCCCTAAAAAATGAAAAAAGG + Intergenic
915104861 1:153527470-153527492 TGTCCCTCCAAGATGAAAAAGGG - Intergenic
917365051 1:174222190-174222212 TTTCCCTCACTACTAGAAAATGG - Intronic
917587985 1:176447155-176447177 TTTACCCCAGCAATGAAAAAAGG - Intergenic
917844930 1:179012817-179012839 CTGCCCTCTCATATGAAAAATGG + Intergenic
917872376 1:179253604-179253626 CTTCACTCACATAAGAAAAATGG + Intergenic
918692400 1:187497807-187497829 TTTCCTCCATAAATGAGAAAAGG - Intergenic
919297514 1:195721478-195721500 TTTCCCCAACAAAACAAAAAAGG - Intergenic
920317605 1:205089625-205089647 GTTCCTGCACAAATGAAAACTGG + Intronic
921245289 1:213232394-213232416 TTTCCCTCACAACTCAAAGTAGG - Intronic
921303540 1:213772901-213772923 GTTCTCTCACAAATGCAGAAAGG + Intergenic
921874451 1:220178198-220178220 TATTCCTTAGAAATGAAAAAGGG + Intronic
923282864 1:232461510-232461532 TTTACCTAATAAAGGAAAAACGG - Intronic
924004456 1:239592664-239592686 TTTACCACACAAATGAAATGTGG - Intronic
924149279 1:241111466-241111488 TTTCCCTCACAAATATCAAGCGG - Intronic
924815670 1:247439740-247439762 TATCCATGATAAATGAAAAAAGG - Intronic
1063021908 10:2137377-2137399 TTGCCCTCAGAAATGAACCAAGG - Intergenic
1063166459 10:3467696-3467718 TTTTCCTCTGAACTGAAAAAGGG - Intergenic
1063442263 10:6082339-6082361 ATTTCCACAAAAATGAAAAAAGG - Intergenic
1063643656 10:7856651-7856673 TTTCCCTCTAAAAGGAACAAGGG + Intronic
1065448747 10:25831820-25831842 TGTCCAGCACAAATGAAATACGG + Intergenic
1065477070 10:26150867-26150889 TTTACCTTAGAAATGAAAAAAGG - Intronic
1065885895 10:30076626-30076648 TTTCACTCACAATTATAAAAGGG - Intronic
1065983397 10:30925906-30925928 TTTCCCTAATACAAGAAAAATGG + Intronic
1067059682 10:43071626-43071648 TTTCACTCACAGAAGCAAAAAGG + Intergenic
1067835689 10:49639354-49639376 TATCCTTCAGAAATGAAGAAGGG - Intronic
1067992398 10:51229592-51229614 TTTCCCTAACACATAAAAATGGG + Intronic
1068695170 10:59959933-59959955 TTTTTCTCACTAATGACAAAAGG - Exonic
1068810602 10:61251598-61251620 CTTTCCTCACCAATGAAAGAGGG + Intergenic
1068916734 10:62440948-62440970 TTTCCCTCACAAAAGAGAAAAGG + Intronic
1069168142 10:65189893-65189915 TTTCCCACTAAAAGGAAAAAGGG - Intergenic
1069457576 10:68565067-68565089 TTTTTATCAGAAATGAAAAATGG + Intronic
1070867720 10:79717245-79717267 TATTCCTGACAAATGAATAATGG + Intergenic
1071139746 10:82494686-82494708 TTTCACTTACAGATGAAAAATGG - Intronic
1071144177 10:82548194-82548216 TTTCTCTCACAAAGCAAAATGGG - Intronic
1071634631 10:87239446-87239468 TATTCCTGACAAATGAATAATGG + Intergenic
1071660613 10:87498554-87498576 TATTCCTGACAAATGAATAATGG - Intergenic
1071808488 10:89151417-89151439 TTTCTTTCACAAATGTATAAAGG - Intergenic
1071808632 10:89153036-89153058 TTTCTTTCACAAATGTATAAAGG - Intergenic
1072233300 10:93431420-93431442 TCTCCCTGCTAAATGAAAAAGGG - Exonic
1072721678 10:97784802-97784824 TTTCCCTCTTAAAGGAAAATAGG + Intergenic
1073506511 10:103997523-103997545 TTTCCGTTAGAAATGTAAAATGG - Intronic
1074371211 10:112902049-112902071 CTCCCGTGACAAATGAAAAATGG + Intergenic
1074516234 10:114173396-114173418 TCTCCATCAGTAATGAAAAATGG - Intronic
1074803839 10:117028256-117028278 TTTCTCACACATATGAACAAAGG - Intronic
1075052234 10:119191296-119191318 TTTCCCTCCCAAACTGAAAAGGG - Intergenic
1076044536 10:127281061-127281083 TCTCCCTCACAAACCAAACAAGG - Intronic
1076651216 10:131989621-131989643 TTTGCCTTTCACATGAAAAAAGG + Intergenic
1076893102 10:133294620-133294642 TTTGTCTCAAAAATAAAAAAAGG - Intronic
1077718757 11:4606566-4606588 TTTACCTCACAAATGCTAAAAGG - Intronic
1077831395 11:5875234-5875256 TTTCTCTCAGATATGAATAATGG + Intronic
1078645152 11:13135280-13135302 TTTCCCTCTCAAACAAAGAAGGG - Intergenic
1078670810 11:13363580-13363602 TTTTCCTCAGCAATGCAAAATGG + Intronic
1078974226 11:16452696-16452718 TTTCCCTTAGAAAAGAAAAGAGG + Intronic
1080069031 11:28056880-28056902 TTTAGCTCACATAAGAAAAATGG + Intronic
1081385789 11:42471245-42471267 TTCCCTTAACAAATGATAAACGG + Intergenic
1082855968 11:57806896-57806918 TTCCCTACAAAAATGAAAAAGGG - Exonic
1083469811 11:62876168-62876190 TTTTCCTCAAACATGTAAAAAGG - Intronic
1085127706 11:74013150-74013172 TTTGCCTCACCACAGAAAAAAGG + Exonic
1085408082 11:76275978-76276000 TCTTCCTGACAAATGTAAAATGG + Intergenic
1085964593 11:81506542-81506564 TTTCCTTCTCATATGAGAAAGGG - Intergenic
1086303324 11:85453481-85453503 TTTCCTTCATCAATGAAAACAGG + Intronic
1087086483 11:94224188-94224210 TCACCATGACAAATGAAAAATGG - Intergenic
1087109065 11:94443519-94443541 GTTCCCTCACATATAAAACAGGG + Intronic
1087329372 11:96760573-96760595 TTTTCCTCACTTATGAAAAAGGG + Intergenic
1087592560 11:100209862-100209884 GTTTCCTCACTAATGAATAAGGG + Intronic
1087979034 11:104587694-104587716 TTTTCTTCAAAAATAAAAAAAGG + Intergenic
1088336379 11:108708887-108708909 TTTTTATCACAAATGAAAAAGGG - Intronic
1090322019 11:125854166-125854188 TTTATCTCACAAAAAAAAAAAGG + Intergenic
1092097717 12:5857421-5857443 GGTCCCTCAAAAACGAAAAATGG - Intronic
1092495883 12:8994555-8994577 TGTCCCTCACCATTGAAAACTGG - Intronic
1093317913 12:17674545-17674567 TTCATCTCACAAATTAAAAAAGG - Intergenic
1093343929 12:18016814-18016836 TATCCCACACAGATGAGAAAGGG + Intergenic
1095670432 12:44853522-44853544 TTTGCCTTTCAAATGAAAAGAGG - Intronic
1097831882 12:64233561-64233583 TTTCTCTCATGGATGAAAAAGGG - Intergenic
1097940174 12:65295553-65295575 TTTCCCTACCAAAAAAAAAAGGG - Intronic
1098564247 12:71913857-71913879 TTTCCATCACATATAAAAGAGGG - Exonic
1098611918 12:72469088-72469110 ATTCCCTCACCTATGAAATAAGG - Intronic
1098656248 12:73033760-73033782 TTTCCCTGAGAACTGAAACAAGG - Intergenic
1099407966 12:82285769-82285791 TTGCCCTCACATCTGAAAATGGG + Intronic
1099417069 12:82403516-82403538 ATTCCTTCAGATATGAAAAAAGG - Intronic
1100493361 12:95102012-95102034 TATCCCTCAAAAACGAAAAAAGG + Intronic
1101256594 12:102983785-102983807 TTTCATTCAGAAATGGAAAATGG - Intergenic
1101453550 12:104805783-104805805 TTTCCTTGACAAGTCAAAAATGG - Intronic
1102501708 12:113357975-113357997 TTTCCCACACACATGTAAAAAGG + Intronic
1105959057 13:25312264-25312286 TTTCCCTCTCAGCAGAAAAATGG - Intronic
1106282021 13:28283054-28283076 ATTCCCTCTCAAAAAAAAAAAGG - Intronic
1107242206 13:38249846-38249868 TTTCCCTATCAAATGAATAGAGG - Intergenic
1107830170 13:44368089-44368111 ATTCACTCACAACTGAAGAAAGG - Intergenic
1108252314 13:48579422-48579444 TTTCTCTCAAAAATAAGAAAGGG - Intergenic
1108462703 13:50683109-50683131 TGTTCCTCACAAATCTAAAAGGG - Intronic
1108466203 13:50718199-50718221 TTTATCTCAGAAATGAGAAATGG + Intronic
1108795010 13:54020258-54020280 TTTTCCTCACAAATTAAAAGGGG - Intergenic
1108946085 13:56026471-56026493 ATTCCCTCAGAGATGAAAATGGG + Intergenic
1109333919 13:60968676-60968698 TTTCGCTCAATAATAAAAAATGG - Intergenic
1109664267 13:65510159-65510181 TTTACATCAGAAATGTAAAAGGG + Intergenic
1109893035 13:68643695-68643717 TTTCCCTTAGAAATAAAACAAGG - Intergenic
1110469501 13:75843009-75843031 TATACCCCACAAATGACAAAGGG - Intronic
1111738064 13:92167027-92167049 TTTCCTTCTCAAATGAGTAATGG + Intronic
1112568008 13:100567920-100567942 CTTCCCTCACAAGACAAAAAAGG + Intronic
1112766206 13:102747134-102747156 TTTCCCTCATTAATGAAATATGG + Exonic
1113024694 13:105927893-105927915 CTTCTCTCAAATATGAAAAAGGG - Intergenic
1114697344 14:24639181-24639203 CCACCATCACAAATGAAAAAAGG + Intergenic
1115074299 14:29367104-29367126 TTTCTCTAAGAAATGATAAATGG + Intergenic
1115095023 14:29624254-29624276 TTTTCCTTTAAAATGAAAAAGGG + Exonic
1115250486 14:31341347-31341369 TTGCCTTCCCAAATCAAAAAAGG - Intronic
1115553964 14:34529576-34529598 TTTCCCTAAAAAGTTAAAAAAGG + Intronic
1117449424 14:55836600-55836622 TTTCCCTCACTAAGAAAACATGG - Intergenic
1117838921 14:59837000-59837022 TTTCCCACACAGAAGAATAAGGG + Intronic
1118754053 14:68825336-68825358 TCTAGTTCACAAATGAAAAAGGG + Intergenic
1119752147 14:77086976-77086998 TTTTCCTCAGGTATGAAAAAGGG - Intergenic
1120610208 14:86631786-86631808 TTGCCATCACTATTGAAAAAGGG - Intergenic
1123704600 15:22941878-22941900 TTTCCCTGACAAAGCCAAAACGG + Intronic
1123725825 15:23100611-23100633 TTTTCCTCCCAAATGAAAAGTGG - Intergenic
1125194835 15:37034244-37034266 TGTCCCTCTCATTTGAAAAATGG + Intronic
1125790641 15:42363095-42363117 TTTCCCTCTTAAAAGAAAACAGG + Intronic
1125829354 15:42702738-42702760 TTTCCCAGACAAATGAAAATTGG - Intronic
1126931171 15:53653126-53653148 TTTCTCTTACAATTCAAAAAAGG + Intronic
1127392455 15:58517622-58517644 TTTCCCACACAAATGTGAGAAGG + Intronic
1128319714 15:66684488-66684510 CTTCCCTCACAGTTGCAAAATGG - Intronic
1128802584 15:70506056-70506078 TTAACCTCACAAATGCATAATGG - Intergenic
1128933059 15:71722923-71722945 TTTCATTCACAAATGTATAATGG + Intronic
1131544823 15:93307405-93307427 TTTCCCTGAAAAACAAAAAAAGG - Intergenic
1132675458 16:1119521-1119543 TTTCCTTCACAAAAGAGGAAAGG + Intergenic
1132782726 16:1636983-1637005 TTTGCCTCCCAAATAAAACAGGG + Intronic
1133825763 16:9276910-9276932 TTTCTTTCACAACTGAGAAATGG - Intergenic
1133894564 16:9913895-9913917 TATCCCTCCCAAAGGAGAAATGG - Intronic
1134345874 16:13391376-13391398 GCTCCTTCACAACTGAAAAAAGG + Intergenic
1134765483 16:16753847-16753869 GTTCTCTCAAAAATGAATAATGG - Intergenic
1134980568 16:18605364-18605386 ATTCTCTCAAAAATGAATAATGG + Intergenic
1135053038 16:19207738-19207760 ACTCCCTCAAAAATGAAAATGGG + Intronic
1135655465 16:24244721-24244743 TTTTCCTCATAAATAAAATATGG - Intergenic
1136185632 16:28587231-28587253 TTTCACGCACAAATCATAAATGG - Intronic
1136413329 16:30089629-30089651 TGTCTCTGAAAAATGAAAAAGGG + Intronic
1137453867 16:48603211-48603233 TTTTTCTCACAAATTAAAAATGG + Intronic
1137550179 16:49432122-49432144 TTTCCCTCACAAATGGGTCACGG + Intergenic
1138042552 16:53689226-53689248 TTCCCAACACAAATGATAAATGG - Intronic
1138567728 16:57845828-57845850 TCTCCCTCACAGAGGAAAACAGG - Intronic
1138851320 16:60633104-60633126 TCTGCCCCACAGATGAAAAATGG - Intergenic
1139639869 16:68283567-68283589 TTTCTATTACGAATGAAAAAGGG + Intronic
1139698024 16:68689074-68689096 TTTCCCTGACAACAGAACAAGGG - Intronic
1139887510 16:70219835-70219857 TTTCTCTTACAAAAAAAAAAAGG + Intergenic
1141293800 16:82747853-82747875 TTTTCCCCACAAGTGACAAAAGG + Intronic
1141692823 16:85606260-85606282 TTTCTCTCAAATATGAAAAATGG + Intergenic
1142922543 17:3202177-3202199 TTTCCCAGACAAACAAAAAATGG + Intergenic
1143209056 17:5169792-5169814 TTTCTCTCACAGATGTACAATGG + Intronic
1143806591 17:9433608-9433630 TTTCCCCCACATACAAAAAATGG - Intronic
1149871077 17:60182408-60182430 ATTCTCTCACAAATGTACAATGG - Intronic
1149942803 17:60888266-60888288 TTAACCTCACAAATACAAAAGGG - Intronic
1150509387 17:65733717-65733739 GTTCCCTCATAAATCATAAAAGG - Intronic
1151632121 17:75318287-75318309 TTTTCCTCGCAGATGATAAAAGG - Exonic
1152881012 17:82815300-82815322 TGTCCCTCAAGAATGAAAACCGG - Intronic
1153200998 18:2647894-2647916 TTTTCCTTACATATGAAAAATGG - Intergenic
1153378250 18:4406249-4406271 TCTGCATCACAGATGAAAAATGG - Intronic
1153612260 18:6898462-6898484 TTTCCTTCCTAAATGGAAAATGG + Intronic
1153688897 18:7571263-7571285 TTTGCCTAACAAATTAGAAACGG - Intronic
1155278794 18:24216877-24216899 TTTCCCACTAAAATGAAATATGG + Intronic
1156736931 18:40271378-40271400 TCTACCTCTCATATGAAAAATGG - Intergenic
1156966720 18:43103274-43103296 ATTTCCTCAAAGATGAAAAAGGG + Intronic
1157401857 18:47395411-47395433 TTTCCCTCATCGTTGAAAAATGG + Intergenic
1157590613 18:48834370-48834392 TTTCCCCAACTACTGAAAAATGG + Intronic
1158181285 18:54717445-54717467 TTTCCCTTACACATTAAACATGG + Intergenic
1159415782 18:68147037-68147059 TTCCCCAAAGAAATGAAAAAGGG + Intergenic
1160080648 18:75724131-75724153 TTTCCTTCACAAATGAGCAGTGG - Intergenic
1160456058 18:79001510-79001532 TTTCCTTCTTAAATGAAAAAGGG - Intronic
1162522103 19:11187247-11187269 ATTCCATCTCAAAAGAAAAAAGG + Intronic
1162829081 19:13272968-13272990 TTTGTCTCAAAAATAAAAAAAGG - Intronic
1166437640 19:42782278-42782300 TTTCCTATACACATGAAAAAAGG - Intronic
1168220454 19:54956686-54956708 TCTCCCTCAAAAAAAAAAAAAGG + Intronic
925492962 2:4415636-4415658 TTTTCCTCACAGAAGAAATAGGG + Intergenic
925564981 2:5241634-5241656 TTTCCTTCAAAAATGGAAAAGGG - Intergenic
926394266 2:12425067-12425089 TTTCCCTTACAAATGGCTAAAGG + Intergenic
926612502 2:14960689-14960711 TTTTCCTCAAAACTGACAAAAGG - Intergenic
926710183 2:15873183-15873205 CTTCTATCAAAAATGAAAAAAGG - Intergenic
927344578 2:22023064-22023086 TTTCCCTCACATATTATAGAAGG + Intergenic
928376927 2:30782730-30782752 TTTACTTCTCAACTGAAAAATGG - Intronic
928454678 2:31408728-31408750 TTTCCCCCAAAAATTAAGAATGG + Intronic
929641620 2:43585763-43585785 TTTCACTCACAAAATAAAACAGG + Intronic
931485449 2:62686033-62686055 TCTCCCTCAGAAAAGAGAAATGG - Intronic
931581727 2:63782831-63782853 ATTCCCTCAGGAATGGAAAATGG + Intronic
931754922 2:65364435-65364457 TTTCCCTCAAAAGGGAAAGAAGG + Intronic
932072305 2:68633541-68633563 TAACTCTCATAAATGAAAAAAGG - Intergenic
932584462 2:73017859-73017881 TTTCCCTCTAAAAGGAAATAGGG + Intronic
933144360 2:78833271-78833293 TCTACCTCCAAAATGAAAAACGG + Intergenic
933161671 2:79030945-79030967 TTTCTCTGACAAACAAAAAAGGG + Intergenic
933618974 2:84515402-84515424 GTTCCCTTACAAATCAAATAGGG + Intergenic
934129062 2:88929223-88929245 TTTGCCAGACAAATGAAAAGTGG + Intergenic
934593365 2:95579297-95579319 CTTCCTTCTGAAATGAAAAACGG - Intergenic
937622075 2:124000160-124000182 TTTCCAACACAACTGAAAAAGGG + Intergenic
939611926 2:144321293-144321315 TTTCCCTCACAACAGAAACAGGG - Intronic
939709093 2:145492988-145493010 TTTGTTCCACAAATGAAAAAAGG + Intergenic
940569680 2:155415335-155415357 CTTCCCTCAAAAATAAAACATGG + Intergenic
941365369 2:164604547-164604569 TTTCCCTCACAGCAGGAAAAAGG + Intronic
942267281 2:174241427-174241449 TTTCCCTCAGCAATGGTAAATGG + Intronic
942748568 2:179264139-179264161 TTTCACCCAGAAATGAACAAGGG + Intronic
942962680 2:181851594-181851616 TTTCCGTCACTACTGAAAAAAGG + Intergenic
943123224 2:183763852-183763874 TTTGCCTCACATATGCTAAAGGG - Intergenic
943270899 2:185802218-185802240 TCTCCCTTACAAATGAATCAAGG - Exonic
945784417 2:214215210-214215232 TTTGCCTCAGAAATGACTAATGG + Intronic
947493737 2:230617830-230617852 TCTCCATCACAGCTGAAAAAGGG + Intergenic
948133216 2:235616456-235616478 TTTCCCACTAAAATGTAAAAGGG - Intronic
948442873 2:238007548-238007570 TTTTCCTCCCAAACCAAAAATGG + Intronic
1169008515 20:2230047-2230069 TTTTCCTCACCTATGAAATAGGG - Intergenic
1169261483 20:4141861-4141883 TTTCCCTGGCCAATGAAATAGGG - Intronic
1169681107 20:8214823-8214845 TTTCACTCTCAAATATAAAAAGG + Intronic
1170881720 20:20302714-20302736 TTTCCCTTTCAAATTAAGAATGG - Intronic
1171124727 20:22591552-22591574 CTTCCCACTCAAAAGAAAAAAGG + Intergenic
1171368904 20:24647711-24647733 TTTTTATCTCAAATGAAAAAGGG - Intronic
1173228388 20:41175385-41175407 TTTCCCTGAGGAATGAAAAAGGG + Exonic
1173877124 20:46380415-46380437 TTTTCCTCCCAAATGAAAAGTGG + Intronic
1173884950 20:46449318-46449340 GTTCCCTAACAAATAAAAAGCGG - Intergenic
1174229760 20:49036758-49036780 TGTCCCTCACCAATGAAAGGGGG + Intergenic
1174724066 20:52842914-52842936 TTTCCCTTGCAAAGGAAAGATGG - Intergenic
1174974982 20:55322642-55322664 TTAACCTCACAAATAAAATAAGG + Intergenic
1175081200 20:56421823-56421845 TTTCCTTAAAAAAAGAAAAAAGG + Intronic
1177242780 21:18481399-18481421 TTTCCCTAATAAATAAAAATGGG + Intronic
1177319530 21:19502357-19502379 TTTCCAACACAAATAAATAAAGG - Intergenic
1177342773 21:19826475-19826497 TTTCTCTAACAAAGGAATAAGGG - Intergenic
1177749780 21:25265907-25265929 TTTTCCTCAAAAATGAGAAATGG + Intergenic
1178392051 21:32206737-32206759 TTTCCCTGACTAATGAAAGCAGG + Intergenic
1178572833 21:33756535-33756557 TTTTACTCCCAAAAGAAAAAAGG + Intronic
1179053652 21:37912429-37912451 TTTCTCTAATAAATTAAAAAGGG - Intronic
1179927699 21:44546627-44546649 TATCCTTCAAAAATGAAAGAGGG - Intronic
1181470108 22:23133425-23133447 TTACCCTTACCAATGATAAATGG - Intronic
1182030869 22:27158441-27158463 TTTCCCTCATTAACGTAAAAGGG - Intergenic
1182208602 22:28654021-28654043 TTTTTCTCCCAAGTGAAAAAAGG - Intronic
1183270185 22:36857257-36857279 TTCCCCTCATAAATTATAAAGGG + Intergenic
1185416009 22:50710601-50710623 TTCTCATCACAAAAGAAAAAGGG - Intergenic
949304671 3:2626572-2626594 TTTCCCTCTTAAATGATATAAGG - Intronic
950100552 3:10353980-10354002 TTTCTCTCATAAATGCAACAGGG + Intronic
952283047 3:31941710-31941732 TTTCCCTTTCAAAGGAAAGATGG - Intronic
954911154 3:54111192-54111214 TTTCTCTGAGAAAGGAAAAAAGG + Intergenic
955801962 3:62696015-62696037 TTTCCCTGATAACTGACAAAAGG - Intronic
956371407 3:68566405-68566427 ATTCCCTCACTCCTGAAAAATGG - Intergenic
956484343 3:69705966-69705988 TTTTTTCCACAAATGAAAAAAGG - Intergenic
956500844 3:69883428-69883450 TTCCCCTCACTAGTGAAATATGG - Intronic
957582669 3:82094602-82094624 TTTTCCCAACAATTGAAAAATGG + Intergenic
957837436 3:85615603-85615625 TTTCCCTAATAAAAGAAATAAGG - Intronic
957945877 3:87062263-87062285 TTTGCCACACAAGTGAGAAATGG - Intergenic
958502700 3:94935345-94935367 TTTCCATTCCAATTGAAAAATGG + Intergenic
958842618 3:99226091-99226113 ATTCCCTCAGAAATGCACAAGGG + Intergenic
959616446 3:108353509-108353531 ATCCCCTCTCAAATGAAGAAGGG - Exonic
959882619 3:111462291-111462313 TTTCCCTCTTAATTGAAGAATGG - Intronic
960195976 3:114768763-114768785 CTTCCCTCGCTTATGAAAAAAGG - Intronic
960625945 3:119682367-119682389 TTTCCTACACAAAGGAACAAAGG + Intergenic
960728429 3:120695967-120695989 TTTCCCTCAGCCATGATAAATGG - Intronic
962359382 3:134724733-134724755 TTCCCTTCAAAAATGAAAAAAGG - Intronic
962790004 3:138802529-138802551 TTCCCCTCACAAATTAACAATGG - Intronic
963014870 3:140813092-140813114 TTCATATCACAAATGAAAAAGGG + Intergenic
963412604 3:144950298-144950320 TCTCACTGACAAATTAAAAAGGG - Intergenic
963756953 3:149244501-149244523 TTTCCCCCACAAAATAAAAGAGG + Intergenic
963902972 3:150749973-150749995 TTCACCTCCCAAAAGAAAAAGGG - Intronic
964197786 3:154084573-154084595 TGTTCATCACAAATGATAAAGGG - Intergenic
964660496 3:159115199-159115221 ATTCCTTCACAAATCCAAAACGG - Intronic
965792537 3:172405057-172405079 TTAGCCTTATAAATGAAAAATGG + Intergenic
965964807 3:174474359-174474381 TTTCATTCATAAATGAAAATTGG - Intronic
966374201 3:179278984-179279006 TTTCCCTGACAAGTAAAAAAAGG + Intergenic
967082571 3:186063827-186063849 TTTCCCTCCCATGTTAAAAATGG + Intronic
967779855 3:193425304-193425326 GTTCCCTTAAAAATTAAAAATGG + Intronic
967872260 3:194240723-194240745 TTAACATCAGAAATGAAAAAGGG + Intergenic
969639597 4:8388899-8388921 TTTCCCTCCCATAGGATAAAGGG - Intronic
969915405 4:10485921-10485943 TTTCCTTAAAAAATTAAAAATGG - Intergenic
970317489 4:14843465-14843487 TTTATCTCACAAATGAAAGAAGG + Intergenic
970431050 4:15989523-15989545 GTTCACACTCAAATGAAAAACGG + Intronic
970572112 4:17393327-17393349 TTTACCTCAAAAAAAAAAAAAGG + Intergenic
970682132 4:18521753-18521775 TTTTTTTCACAAATTAAAAATGG + Intergenic
970691639 4:18627469-18627491 TTGCCCTCAGAAATGAAAAAAGG - Intergenic
971717821 4:30203160-30203182 TGTCCTTCAGAAATGAAAATTGG - Intergenic
972149108 4:36066064-36066086 TATCTCTCACACTTGAAAAATGG + Exonic
972304133 4:37815682-37815704 TATCCCTTACAAAGGACAAAGGG + Intergenic
972688760 4:41375901-41375923 ATCCCCTCAAAAAAGAAAAAAGG - Intronic
973048125 4:45561585-45561607 TTTTTCTGACCAATGAAAAATGG - Intergenic
974168739 4:58238843-58238865 TTTCTCTAACAATAGAAAAACGG - Intergenic
974320464 4:60341694-60341716 TTTTCCTCACAGTTCAAAAAGGG + Intergenic
974414401 4:61586979-61587001 TTTTTCTTATAAATGAAAAAAGG - Intronic
974755408 4:66199837-66199859 TGACCCTCAAAAATGAAAAAAGG - Intergenic
975499780 4:75071899-75071921 TTTCCCACACAAATAAAAAAAGG + Intergenic
975595002 4:76042284-76042306 ATTGCCTGACAAAAGAAAAAAGG + Intronic
976401459 4:84611726-84611748 TTTTTCTCACAAAGGAAAAATGG + Intronic
976781666 4:88766104-88766126 TTTATCTCACAAAAGAAAACAGG + Intronic
977656633 4:99529323-99529345 TTTCCCTTCCAACTGATAAAGGG + Intronic
977716425 4:100189282-100189304 TTTCCTTCTCACATTAAAAATGG + Intronic
977967164 4:103166604-103166626 TTTCCTTTAAAAATGAAAAGAGG + Intronic
978539051 4:109796323-109796345 TTTCCCTAATAAATCAAAACAGG + Intronic
978694667 4:111563135-111563157 TTACCCTCAAAAATGCAAATAGG + Intergenic
978763650 4:112382045-112382067 TTTCCCTGTAAAATGAGAAAGGG - Intronic
978885019 4:113758938-113758960 CTTCCCTCTCAAAAGCAAAAGGG + Intronic
979230478 4:118343437-118343459 TTTCCTTCACATATGGAATATGG - Intronic
980295275 4:130906675-130906697 TTTGGCTGACAAAAGAAAAAAGG - Intergenic
980462516 4:133134837-133134859 TTTCACTTTGAAATGAAAAATGG - Intergenic
980742426 4:136970011-136970033 TTTTCCCAACAAAGGAAAAAGGG + Intergenic
983717442 4:170801695-170801717 TGTCCTTCAAATATGAAAAAAGG + Intergenic
983750255 4:171259476-171259498 TTTCACTCATAAGTGAACAATGG - Intergenic
983753707 4:171307233-171307255 TCTACCTCAAAAATTAAAAAAGG + Intergenic
984497842 4:180521011-180521033 TCTCCCTCAGAAAAAAAAAAGGG + Intergenic
984879113 4:184395096-184395118 TTTCCCAAACAGATGAATAAAGG + Intronic
985297834 4:188454724-188454746 TTTCCCTCCCTAATGCCAAAGGG + Intergenic
986225149 5:5805353-5805375 TTTCTACCACAGATGAAAAATGG - Intergenic
986951313 5:13088347-13088369 TTTGTCTCACAAATGAATACGGG - Intergenic
989361239 5:40603774-40603796 TTTCCATGACCTATGAAAAAAGG - Intergenic
989621258 5:43386767-43386789 TTTTCCTCAAAATTGAATAATGG + Intronic
990370783 5:55116010-55116032 TTTCCCTCACCTATAAAATAAGG - Intronic
990479057 5:56189870-56189892 GTTCCTTCAAAAATTAAAAATGG - Intronic
990859241 5:60308095-60308117 TTTCCATGACAATTTAAAAATGG + Intronic
991173268 5:63653765-63653787 ATTCTCACACAAAAGAAAAAGGG + Intergenic
991548593 5:67811640-67811662 TTTGCCTGGAAAATGAAAAAAGG - Intergenic
991569052 5:68035413-68035435 CTTCCCTCAGAAATCAAACAAGG - Intergenic
991602848 5:68370768-68370790 TTTCCCCAACAAATGCCAAAAGG + Intergenic
993812655 5:92501674-92501696 TTCCCTTCACAAATGGAAAAAGG - Intergenic
993874864 5:93294376-93294398 TTTGCCTCAGAAATTAAGAAAGG - Intergenic
994165683 5:96605999-96606021 TTTCCCTCAAATATCAAATATGG + Intronic
994929199 5:106159153-106159175 TTTCCTTTACAAATGACAATGGG - Intergenic
994940667 5:106319711-106319733 CTCACCTCACAAATGAAAATCGG + Intergenic
994991532 5:107002907-107002929 TATCCCTCAAAAAGGTAAAACGG - Intergenic
995047141 5:107664661-107664683 TATCCATCACAAATGATCAAAGG + Intronic
995431334 5:112081438-112081460 ATTGACTCACAAATGACAAAGGG - Intergenic
995530522 5:113087472-113087494 GGTCCCTCACAAACCAAAAATGG + Intronic
995612143 5:113922164-113922186 TTTCTCTCATAAATGTTAAATGG - Intergenic
996310395 5:122097928-122097950 TTTCCTTCACATATACAAAAGGG - Intergenic
996600685 5:125259526-125259548 TTTCCCTCAATATTGAATAATGG + Intergenic
996699502 5:126436141-126436163 TTTTCCTCAGAAATGAAATTGGG + Intronic
996903396 5:128570379-128570401 TTTCCCTTTCAAATGTAGAATGG + Intronic
997427602 5:133814610-133814632 TTGCCCTCACAAAAAAATAAGGG + Intergenic
998066176 5:139160820-139160842 ACTCCATCACAAATAAAAAAGGG + Intronic
998323198 5:141252421-141252443 TTTTCTTCACAAAAGAACAAAGG + Intergenic
998380252 5:141719387-141719409 ATTCCACCACTAATGAAAAAGGG + Intergenic
998577781 5:143335216-143335238 TTTCCCACATGAATGAAAAATGG - Intronic
1000200836 5:159009114-159009136 TCTCCTTCATAAATTAAAAAGGG - Intronic
1000203237 5:159032399-159032421 TTTCCCTCACCCATTCAAAATGG + Intronic
1000959613 5:167584499-167584521 CATGCCTCACAGATGAAAAATGG - Intronic
1001300314 5:170528774-170528796 CTTCCTTCCCAAATGAAAAATGG - Intronic
1001779408 5:174354930-174354952 TCTCCATCACAAATCAAAAGGGG + Intergenic
1002510703 5:179714815-179714837 TTTCTGTCTCAAATAAAAAAGGG - Intronic
1002827857 6:790097-790119 TTTCCCTCTCCAATTAAAATAGG - Intergenic
1003162636 6:3649477-3649499 TTTCTCTCACAAGCAAAAAAAGG - Intergenic
1003299475 6:4864451-4864473 CTTCCCTCCCAAATAATAAAAGG - Intronic
1003716613 6:8653358-8653380 TGTCCAGCAAAAATGAAAAAGGG - Intergenic
1005294191 6:24408198-24408220 TTTTCCTATCAAAGGAAAAAAGG + Intronic
1005514267 6:26538975-26538997 ATTCCATCACAAAGAAAAAATGG + Intronic
1007489932 6:42212331-42212353 GTTTCCTCACATATGAAAGAGGG + Intronic
1007586292 6:42992065-42992087 ATTCCATCTCAAAAGAAAAAGGG - Intronic
1008598064 6:53062940-53062962 TTCCTCTCCCAAATGGAAAAAGG + Intronic
1009832585 6:68957185-68957207 TTTCCTTTGCCAATGAAAAATGG - Intronic
1009896194 6:69753529-69753551 TTTCCTAAAAAAATGAAAAATGG + Intronic
1012263850 6:97117784-97117806 TTTCCCTCACACACAAAAAAAGG - Intronic
1012411565 6:98964361-98964383 TTTCTCTCAGAAATGGAGAATGG + Intergenic
1012689921 6:102297400-102297422 TTTTCCACACTACTGAAAAAGGG + Intergenic
1012711945 6:102617743-102617765 TCTGCATCACAAATGAAAAATGG + Intergenic
1013413775 6:109906059-109906081 TTTCTCTCACACATGAAAAACGG + Intergenic
1013547992 6:111178640-111178662 TTTCAGCCACAAAAGAAAAAAGG - Intronic
1013986154 6:116196849-116196871 TTTCCCTGTCTAATGAAGAACGG - Intronic
1014164447 6:118207822-118207844 TTTGCCTAACAATGGAAAAAAGG - Intronic
1014588066 6:123225957-123225979 GTTCACTAATAAATGAAAAAGGG + Intronic
1015619782 6:135118885-135118907 ATTCCCTCACCAGTGAAACAGGG + Intergenic
1015653086 6:135484916-135484938 TTTCCATAAGAAATTAAAAATGG - Intronic
1015681849 6:135817469-135817491 TCACACCCACAAATGAAAAATGG + Intergenic
1016280751 6:142415778-142415800 ATTTCCTAAAAAATGAAAAAAGG - Exonic
1017563131 6:155654237-155654259 TTTCTCTCACACTTTAAAAATGG + Intergenic
1018436082 6:163760247-163760269 TTTTCCACAGAAATGAAACATGG - Intergenic
1018597415 6:165497083-165497105 TTTTCATCAGAAATAAAAAATGG + Intronic
1020713955 7:11646550-11646572 TTTCACTCAAAAATGTGAAATGG + Intronic
1020909013 7:14104799-14104821 TATGCATCACAGATGAAAAATGG - Intergenic
1021173895 7:17427933-17427955 ACTGCCTTACAAATGAAAAATGG + Intergenic
1021178064 7:17473521-17473543 TTACCCTGACACATGCAAAAGGG - Intergenic
1021894097 7:25217677-25217699 TTTTCCTAAGAAATGAAGAATGG - Intergenic
1022003422 7:26246397-26246419 TTTCCCACACAAAGGCAAAGAGG - Intergenic
1022249618 7:28594132-28594154 TTCTCCTTACAAATGAAAACTGG + Intronic
1023291721 7:38675149-38675171 TTTCACTAACCAATGAAATAAGG - Intergenic
1023336117 7:39172624-39172646 TTTGCCTCAAAAAAAAAAAAAGG - Intronic
1023453817 7:40316585-40316607 TTTATCACACAAATGAAGAACGG - Intronic
1023551538 7:41375007-41375029 TTTTCCTCACAGAATAAAAAGGG + Intergenic
1024378386 7:48665300-48665322 CTTCCCCCCCATATGAAAAAAGG + Intergenic
1024449372 7:49521623-49521645 TTCTCCTCACAAGTGAACAATGG - Intergenic
1026619244 7:71935789-71935811 TTTCACTCACAGCTGAAAGATGG - Intronic
1027621169 7:80487309-80487331 TTTCCCTCTCATGTGTAAAAGGG - Intronic
1027838159 7:83273048-83273070 TTTCCTACCCAAAGGAAAAAAGG - Intergenic
1028448668 7:90954924-90954946 TTTCCCTCTAAAAAAAAAAAAGG - Intronic
1028618354 7:92796565-92796587 TTTCCCTTTCAATTGTAAAAGGG - Intronic
1028638667 7:93019073-93019095 TTTCCCTCACAAATTTTAATTGG + Intergenic
1028907107 7:96167233-96167255 TTTCACTGACATATGTAAAAGGG - Intronic
1028978605 7:96941663-96941685 TTTCCCAAACAAAGTAAAAAAGG - Intergenic
1029835159 7:103301627-103301649 TTTCCCTGAGGAATGCAAAATGG + Intronic
1030390683 7:108924257-108924279 TTTCCCAGACAAATGAAAGCTGG - Intergenic
1030489940 7:110219697-110219719 TTTCTCTCACAATTTAATAATGG - Intergenic
1030748467 7:113199086-113199108 TTTCAGTCTGAAATGAAAAAGGG + Intergenic
1031112076 7:117623172-117623194 TCTTCCCCACAAATGAAGAATGG + Intronic
1032110957 7:129075093-129075115 TTGCCCACATAAGTGAAAAATGG + Intergenic
1032145264 7:129373751-129373773 TTTCCCTCACTCAGGTAAAAAGG - Intronic
1032333677 7:131004507-131004529 TTTCCCACAGATATGGAAAAGGG - Intergenic
1032354399 7:131196411-131196433 TGTCACTCGCAAAGGAAAAAAGG + Intronic
1033832268 7:145268938-145268960 ATTCAATCACAATTGAAAAATGG + Intergenic
1033944561 7:146700026-146700048 TTTCCCTGATAAAAGAACAAGGG + Intronic
1034830012 7:154300774-154300796 CTTCCCTCATAAATGAAATGGGG + Intronic
1036397724 8:8383261-8383283 TTTCCCTCCAAAGTGAAAAATGG + Intronic
1036619423 8:10414767-10414789 TTTCCCTGAAAAGTGAAAAGTGG + Intronic
1036629963 8:10505318-10505340 TTTCATTCATAAATGAAAATTGG + Intergenic
1037848237 8:22303749-22303771 TTTCCCCCACCAAGGAAATAAGG + Intronic
1038119151 8:24592234-24592256 TTTCCCTAAACAATGATAAAGGG + Intergenic
1039915210 8:41855321-41855343 CTTCACTGACAAATGAAAAATGG - Intronic
1040000250 8:42569744-42569766 TTCCCCTCAAAAAGGAAGAAAGG + Intergenic
1041475156 8:58256860-58256882 TTTCCCACAACAAGGAAAAACGG - Intergenic
1041947387 8:63461311-63461333 TGTCCCTCACACATTAAAACAGG - Intergenic
1042458514 8:69034382-69034404 TTTCCCTCCCAAATTAAGAAAGG - Intergenic
1042617927 8:70670099-70670121 TTTTTGTTACAAATGAAAAACGG + Intronic
1043561902 8:81502807-81502829 TTTCTTTCACAGCTGAAAAATGG - Intergenic
1044233064 8:89801181-89801203 CTTCCCTCCCCTATGAAAAAGGG + Intergenic
1044495243 8:92870040-92870062 TGTCCCTGACAGATGATAAAAGG + Intergenic
1045174039 8:99700893-99700915 TTCCCCCCACAAATTAAAGAGGG - Intronic
1045666475 8:104492567-104492589 TTCCCCTCACAGAAGAAAGAAGG + Intronic
1047064781 8:121268948-121268970 TTTTCCTCTCAAAAGCAAAACGG - Intergenic
1047832568 8:128652081-128652103 TTTCTCTCACAAATGAATCTTGG - Intergenic
1048028685 8:130610807-130610829 TTCCCCATACAAATGATAAATGG + Intergenic
1048672541 8:136739089-136739111 TTTCCCTCAAATATAATAAAAGG + Intergenic
1049151744 8:141039530-141039552 TATCCCACAAAACTGAAAAAGGG - Intergenic
1050000635 9:1073774-1073796 TGTCTCTCAGAGATGAAAAATGG + Intergenic
1050027673 9:1352505-1352527 TTTCCCTATCAGATGAAATAAGG - Intergenic
1050406812 9:5317680-5317702 TTTCCCTCTCAATTTTAAAAAGG - Intergenic
1050501601 9:6304129-6304151 CCTACCTTACAAATGAAAAATGG - Intergenic
1051153869 9:14118128-14118150 TTTCCCTTTGAAAGGAAAAATGG - Intronic
1051190637 9:14508337-14508359 TTTCCGGCAGAAATGAAAGAGGG - Intergenic
1051949359 9:22612268-22612290 GTTCCCTCAAAAAAAAAAAAAGG + Intergenic
1052729027 9:32263861-32263883 TTCCCTTCACTTATGAAAAAGGG - Intergenic
1053210021 9:36219716-36219738 TTTCCCTAAGAAGTGAAAAGGGG + Intronic
1053298813 9:36934207-36934229 TCCCCCTTACAAATGAGAAAAGG - Intronic
1055036801 9:71826305-71826327 TCAACCTCATAAATGAAAAATGG + Intergenic
1055149165 9:72974521-72974543 TCTCCCTCAAAAGTGTAAAATGG + Intronic
1056059417 9:82869023-82869045 GTTCCATAAAAAATGAAAAAAGG + Intergenic
1056109326 9:83379423-83379445 TTTCCCTAAGAAAGGCAAAAAGG + Intronic
1056520479 9:87396715-87396737 TCTGTCTCAAAAATGAAAAAAGG - Intergenic
1056946338 9:91000602-91000624 TTTCCCTAACAAACAGAAAATGG - Intergenic
1057634671 9:96753073-96753095 TTTCACTCACTATTGAAAGAGGG + Intergenic
1057637798 9:96787149-96787171 ATTTCCTCAAAAATGAAAACAGG + Intergenic
1057775892 9:98009143-98009165 TTTCCCTTATGAATGAAAAACGG - Intronic
1058054784 9:100438507-100438529 TCTGATTCACAAATGAAAAAAGG - Intronic
1058283345 9:103145495-103145517 TTTCCTTTACAAATGGAGAATGG + Intergenic
1058372743 9:104288662-104288684 TTTCCCAGACAGAGGAAAAAAGG - Intergenic
1059014866 9:110504823-110504845 TTTCCCTAAAAAATTAACAAAGG - Intronic
1059246222 9:112851892-112851914 TTTAGCCCACAAATGTAAAAAGG - Intronic
1059414006 9:114152154-114152176 TTTCACTCACAAATGTGAATAGG - Intergenic
1059487800 9:114640494-114640516 TTTCACCCACCAAGGAAAAAGGG - Intronic
1059921599 9:119166669-119166691 TTTCCTCCAAAAAGGAAAAATGG + Exonic
1060046487 9:120345540-120345562 TTCCTCTCACCAAAGAAAAATGG - Intergenic
1060786018 9:126452111-126452133 TTTCCCTAGGAGATGAAAAAAGG + Intronic
1062437236 9:136551704-136551726 TTACCCTCAGAAAAGAAGAAAGG - Intergenic
1186657523 X:11631221-11631243 CTTCCCTCAAAAAGGTAAAATGG + Intronic
1187597605 X:20790955-20790977 CTTTTCTCACAAATGGAAAAGGG - Intergenic
1188138510 X:26519920-26519942 CTTCCCTCACATTTGAGAAAAGG + Intergenic
1188346441 X:29072339-29072361 CTTCACTCATAAATGAAGAAAGG + Intronic
1190521616 X:51284169-51284191 TTACCCACACAAAGGTAAAAAGG + Intergenic
1192069364 X:67920513-67920535 TTTATCTCAGCAATGAAAAATGG + Intergenic
1193232771 X:79067533-79067555 TTTCCCAGACAAATAAAAACTGG - Intergenic
1193462636 X:81809083-81809105 TTTCCCTTATAAAACAAAAAAGG - Intergenic
1193757748 X:85429204-85429226 TATCCCTCAGAAATGAAGGAGGG - Intergenic
1193915108 X:87354186-87354208 TTTCCCTCACAAATCTATACTGG + Intergenic
1194865829 X:99065225-99065247 TTTTCCTCACAGACAAAAAAAGG + Intergenic
1196018467 X:110964711-110964733 TTTCCCTCACAAATGAAAAATGG + Intronic
1196058583 X:111383532-111383554 CATCCCTTACAAATGAATAATGG + Intronic
1196961530 X:121008244-121008266 TTTACCTAACAAATCAAGAAAGG - Intergenic
1197062920 X:122202995-122203017 TTTCCTTCTGAAATGGAAAATGG + Intergenic
1197879068 X:131145741-131145763 TTGCCCTCAAATATGAAAATGGG + Intergenic
1198151328 X:133913232-133913254 TTTCCATCACAAAGGAGAGAAGG + Intronic
1198364343 X:135925590-135925612 TTTACCTCACAAAAGATAACAGG + Intergenic
1199044554 X:143153817-143153839 TTTCCCTCACAACTGAGGGAAGG - Intergenic
1199663719 X:150080267-150080289 TCTGCCTCACAAAAGACAAACGG - Intergenic
1201402992 Y:13623186-13623208 TTTACCTCTGAAAAGAAAAATGG - Intergenic