ID: 1196021378

View in Genome Browser
Species Human (GRCh38)
Location X:110994639-110994661
Sequence TGTACCTCCCAGAACAAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196021373_1196021378 6 Left 1196021373 X:110994610-110994632 CCTCCACAGGGTCTTCCTCCTTT 0: 1
1: 0
2: 3
3: 34
4: 322
Right 1196021378 X:110994639-110994661 TGTACCTCCCAGAACAAGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 112
1196021375_1196021378 -9 Left 1196021375 X:110994625-110994647 CCTCCTTTCACACGTGTACCTCC 0: 1
1: 0
2: 1
3: 5
4: 111
Right 1196021378 X:110994639-110994661 TGTACCTCCCAGAACAAGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 112
1196021374_1196021378 3 Left 1196021374 X:110994613-110994635 CCACAGGGTCTTCCTCCTTTCAC 0: 1
1: 0
2: 1
3: 31
4: 378
Right 1196021378 X:110994639-110994661 TGTACCTCCCAGAACAAGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 112
1196021372_1196021378 14 Left 1196021372 X:110994602-110994624 CCTTTATTCCTCCACAGGGTCTT 0: 1
1: 0
2: 1
3: 11
4: 198
Right 1196021378 X:110994639-110994661 TGTACCTCCCAGAACAAGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196021378 Original CRISPR TGTACCTCCCAGAACAAGGT AGG Intronic
900616102 1:3566380-3566402 TCTGCCTCCCTGAACAGGGTTGG + Intronic
905592350 1:39175283-39175305 TGTATATGCCAGAACAAAGTTGG + Intronic
905916056 1:41685128-41685150 TGTTCCTCCAAGAAGAAGGCTGG - Intronic
906165626 1:43684044-43684066 TGTACCTCCCAGGAAAAGAAAGG - Intronic
920399244 1:205666925-205666947 GGGCCCTCCCAGAACAAGGGTGG - Intronic
922448926 1:225720921-225720943 TGTACTTCCCATCACAAAGTAGG + Intergenic
923346081 1:233053912-233053934 TGTGACCCACAGAACAAGGTCGG + Intronic
1069990052 10:72309683-72309705 TGTAGCTCCCAGAATGAGGGGGG - Intergenic
1071392907 10:85193468-85193490 TTTTCTTCCCAGAACAATGTTGG + Intergenic
1074915830 10:117954094-117954116 TGTACCTCTCATCACATGGTAGG + Intergenic
1076333863 10:129691997-129692019 TCTAGTTCCCATAACAAGGTAGG - Intronic
1080686533 11:34520247-34520269 TGTGACTCCCAGAAAAATGTAGG - Intergenic
1085906417 11:80769612-80769634 TGTCCCTCCCATGACAATGTGGG - Intergenic
1089982728 11:122785830-122785852 TGTAATACCCAGCACAAGGTGGG + Intronic
1090627619 11:128619925-128619947 AGGACTTCCCAGAACAAGGCTGG + Intergenic
1092367206 12:7886665-7886687 TCTACCTCCCAGAGGAAGGAAGG + Intronic
1093768785 12:22996400-22996422 AGCGCCTCCCTGAACAAGGTTGG + Intergenic
1095627457 12:44333447-44333469 TGTCCCTCCCACAACAAGTCAGG - Intronic
1096048695 12:48586926-48586948 TGTACCTCCCTCCACAAGGCCGG + Intergenic
1098288773 12:68934777-68934799 TGTACCTACCTAAATAAGGTTGG + Intronic
1102646618 12:114407960-114407982 CGTACCTCCCAGCTCAAGGTTGG + Exonic
1106281468 13:28276763-28276785 TGTAACTCCCAGAATATAGTGGG - Intronic
1110045016 13:70816941-70816963 GGTACCTCCTAGAAAAAGGATGG - Intergenic
1115460435 14:33653976-33653998 TCTACATCCCAGTTCAAGGTGGG - Intronic
1117051313 14:51862590-51862612 TGTGCCTCCCCAAACAAAGTAGG - Intronic
1119197671 14:72729368-72729390 TGTTCCTCCCAGAACATGCCAGG - Intronic
1120046215 14:79809487-79809509 TCTAGTTCCCAGAAAAAGGTAGG - Intronic
1120569000 14:86094573-86094595 TGTTCCTCCCAGGCAAAGGTTGG - Intergenic
1129217422 15:74108189-74108211 TTTCCCACCCAGACCAAGGTAGG + Intronic
1130712886 15:86301186-86301208 TGTACCTCCCAGAGACATGTGGG + Intronic
1130943205 15:88529097-88529119 TGTACCTACCAGAAAAAACTAGG + Intronic
1138153015 16:54676858-54676880 TGTGCCTCCCACAATAAGATAGG + Intergenic
1138399492 16:56733937-56733959 TGTACCTAACAGATCAATGTAGG - Intronic
1140867494 16:79076622-79076644 TGTACCTACCACAGCTAGGTAGG + Intronic
1142265187 16:89061180-89061202 GGTCCGTCCCAGAAGAAGGTGGG - Intergenic
1151711237 17:75808150-75808172 TGTACCTCCCAGGAGAGGGATGG + Intronic
1152574235 17:81133091-81133113 GGTACATCCCAGAGCAGGGTGGG + Intronic
1153494190 18:5680929-5680951 TGTACCCACCAGAATAAGGGTGG + Intergenic
1156202651 18:34852272-34852294 TCTACCACCCAGAAACAGGTAGG + Intronic
1156278307 18:35606573-35606595 TGTACCTCCCAGAAAGAATTTGG - Intronic
1157102906 18:44745949-44745971 TGTGCCTTCCAGATCAAGGAAGG - Intronic
1157120572 18:44906633-44906655 TATACCTTCCAGAACAAGGGAGG - Intronic
1158891018 18:61871717-61871739 TGTCCCTACCAGAACAAGCCAGG - Intronic
1163834100 19:19562894-19562916 TGTGCTTCCCAGGACCAGGTGGG + Intronic
1164446920 19:28325638-28325660 TGTGCCTCCCAGGACAAAGAGGG - Intergenic
1165266322 19:34665753-34665775 TGTCCCTCCCAGGACAAAGCAGG + Intronic
1165871348 19:38975632-38975654 ACTGCCTCCCAGAACAAAGTGGG - Exonic
925917017 2:8614162-8614184 TGTCCCTTCCAGAACAGGCTCGG - Intergenic
927054183 2:19354908-19354930 TGTACCTCCAAGTGCAAGGTTGG + Intronic
931415396 2:62075702-62075724 TGTAGCTCTCAGAACGGGGTGGG - Intronic
931704271 2:64934171-64934193 TGTACCTCCCATCACACGTTAGG - Intergenic
938646468 2:133335985-133336007 TGTATCTGTCAGAACTAGGTAGG + Intronic
939521887 2:143241789-143241811 TGTACCTCCCAGATAAAGTCAGG - Intronic
945435250 2:209810256-209810278 TGTATCTCCCAGAACTATTTTGG + Intronic
946060473 2:216936743-216936765 TTTTCCTCCAAGAACAAGGGAGG + Intergenic
1173816141 20:45989601-45989623 TATAGCCCCCAGAACAAAGTTGG + Intergenic
1174639924 20:52035188-52035210 TGTACCTTACAGAAAAAGGCAGG + Intergenic
1175941133 20:62537992-62538014 TTTACCTCCCACTCCAAGGTGGG - Intergenic
1178729588 21:35087933-35087955 TTTATCTCCAAGAACAAAGTCGG + Intronic
1182049621 22:27302747-27302769 TGTACCTCCTAAAACCTGGTGGG + Intergenic
1183773535 22:39947377-39947399 CGAACCTCCCAGGACAAGGATGG - Intronic
1184688081 22:46105331-46105353 TGTGCCTCCTAGAAGAAGGCAGG + Intronic
949890042 3:8726922-8726944 TGGACATCCGAGATCAAGGTGGG + Intronic
950480757 3:13242397-13242419 AGTACCCCCAAGAGCAAGGTGGG + Intergenic
950821322 3:15762415-15762437 AGTACCTTCCTGAACAGGGTAGG - Intronic
953329460 3:42040462-42040484 TTCACCTCACAGAACAAAGTTGG - Intronic
953573965 3:44098003-44098025 TGTCCCTCTCAAAGCAAGGTGGG - Intergenic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
955296318 3:57738381-57738403 GGTATCTCCCAGGACAAGGGAGG + Intergenic
957014980 3:75052969-75052991 TGTCCCTCCCATCAAAAGGTAGG + Intergenic
958187107 3:90136232-90136254 TGCACCTCCCACCACAGGGTAGG + Intergenic
967962758 3:194939061-194939083 TGTACAACCCAGAACAAGGCTGG - Intergenic
969560240 4:7942118-7942140 AGTACATCCCAGAACACAGTGGG - Intergenic
975389689 4:73802118-73802140 TGTAGCTCCACCAACAAGGTAGG + Intergenic
975893060 4:79052131-79052153 TGTACCTCTGAGGAAAAGGTGGG - Intergenic
981644202 4:146980002-146980024 GGTACCTTCCATAACAAGGTTGG - Intergenic
982464011 4:155707728-155707750 TATACCATCCAGAACAATGTTGG - Intronic
985021651 4:185697780-185697802 TGTGCTTCTCAGTACAAGGTGGG - Intronic
988858430 5:35252148-35252170 GGTCCCTCCCACAACAATGTGGG + Intergenic
990878974 5:60518853-60518875 TGTATTTCCCAAAATAAGGTAGG - Intronic
994677771 5:102846630-102846652 TGGACATCCCAGAATAAGGCAGG + Intronic
995597582 5:113764363-113764385 TTTACTTCTCAGAACTAGGTAGG - Intergenic
997030706 5:130124254-130124276 TGAAGCTCACAGGACAAGGTGGG - Intronic
997030795 5:130125124-130125146 TGAATCTCACAGGACAAGGTGGG + Intronic
1003537300 6:6986545-6986567 TGTGCCTCCCAGTACCATGTGGG - Intergenic
1010730213 6:79382829-79382851 TGATCCTCCCAGAACAAGAGAGG - Intergenic
1011096795 6:83674908-83674930 TGCACTTCCCAGAAGAAGGGAGG + Intronic
1013918055 6:115366048-115366070 TGGACCACCCAGAAGAAGGCAGG + Intergenic
1018706332 6:166465997-166466019 TGTACTTCCCAGAGGAAGGCAGG - Intronic
1023152722 7:37216945-37216967 TCTTCCTTCCAGAAAAAGGTGGG + Intronic
1024660457 7:51487947-51487969 TGTACCCCCCAGAAAAAGCCAGG - Intergenic
1028722547 7:94050185-94050207 TGTGGCTCCCAGAACCAGGCAGG + Intergenic
1029979175 7:104862224-104862246 TGTAACTTCCAGCAAAAGGTGGG - Intronic
1030368103 7:108669401-108669423 TGTACCCACCAGATCAAGGGTGG - Intergenic
1035528998 8:336673-336695 TGGAAGTCCCAGATCAAGGTTGG - Intergenic
1036030816 8:4970147-4970169 TGTACCTCCAATAATAAAGTAGG - Intronic
1043792982 8:84497140-84497162 TGTACTTTCTAAAACAAGGTAGG - Intronic
1044649413 8:94478754-94478776 TGGTCCTTCCAGAACAAGTTAGG - Intergenic
1047726749 8:127690595-127690617 TGTAGCACCTAGATCAAGGTAGG + Intergenic
1048210265 8:132449151-132449173 TGTACCTCCTAGCACAAGGCAGG + Intronic
1050221054 9:3390577-3390599 GGTTCCTCCCACAACAATGTGGG - Intronic
1051713250 9:19954759-19954781 TGCACCTCTCAGAAGAATGTAGG - Intergenic
1055543458 9:77340751-77340773 TCTACCTCCCTTAACAAGCTGGG - Intronic
1058426490 9:104879764-104879786 TGTAGCACTCAGAACAAGGGAGG + Intronic
1058696954 9:107566673-107566695 TTTCCCTCCCAGAACAGGGCAGG + Intergenic
1060415444 9:123426465-123426487 TGGAGCTCCCAGAACAAAGGTGG + Intronic
1188779820 X:34268101-34268123 TCTGCCTCACAGAACAAGGTAGG - Intergenic
1189235993 X:39487827-39487849 TGTGCCTCCCAGAAAGAGCTGGG + Intergenic
1189589433 X:42496032-42496054 TTTCCCTCCCAGAAGAAAGTGGG + Intergenic
1194941854 X:100019839-100019861 TGTGCCTCCCAGCACTGGGTTGG - Intergenic
1195626816 X:107012358-107012380 TGCACCTCTCACAACAAGGAAGG + Intergenic
1196021378 X:110994639-110994661 TGTACCTCCCAGAACAAGGTAGG + Intronic
1196053629 X:111331961-111331983 TGTGCATCACAGCACAAGGTTGG - Intronic
1198611233 X:138403001-138403023 ACTACTTCCCAGAACAATGTAGG - Intergenic
1199533554 X:148876824-148876846 TGATCCTCCCAGAACAAGAGAGG + Intronic
1199665778 X:150095399-150095421 TGTACCTTCCAGAACCAAGCTGG + Intergenic
1199672457 X:150158697-150158719 TGTACCCCCCAGTATGAGGTGGG - Intergenic
1200317123 X:155145893-155145915 TGTACCTCCCACAACAAAAAAGG - Intronic
1201526313 Y:14938397-14938419 TGTACCACCCAGAAAGAGGAGGG - Intergenic
1201935957 Y:19411282-19411304 TGGAGCTCCCAGAGGAAGGTGGG + Intergenic