ID: 1196026062

View in Genome Browser
Species Human (GRCh38)
Location X:111042515-111042537
Sequence GGCTATGTTGCACACCCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196026060_1196026062 -7 Left 1196026060 X:111042499-111042521 CCTGTACCACGGCACAGGCTATG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1196026062 X:111042515-111042537 GGCTATGTTGCACACCCACAAGG 0: 1
1: 0
2: 0
3: 7
4: 75
1196026053_1196026062 22 Left 1196026053 X:111042470-111042492 CCAAGGATAGGGCTCTTCAGAGT 0: 1
1: 0
2: 2
3: 9
4: 154
Right 1196026062 X:111042515-111042537 GGCTATGTTGCACACCCACAAGG 0: 1
1: 0
2: 0
3: 7
4: 75
1196026059_1196026062 -6 Left 1196026059 X:111042498-111042520 CCCTGTACCACGGCACAGGCTAT 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1196026062 X:111042515-111042537 GGCTATGTTGCACACCCACAAGG 0: 1
1: 0
2: 0
3: 7
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196026062 Original CRISPR GGCTATGTTGCACACCCACA AGG Intronic
900475506 1:2874603-2874625 GGCTCACATGCACACCCACAGGG - Intergenic
901197547 1:7448494-7448516 GGCTCTGTCCCCCACCCACAAGG - Intronic
901683331 1:10929092-10929114 GGCACTGTTAGACACCCACATGG + Intergenic
902958778 1:19946489-19946511 GGCTCTGTGGCACACCTAGAAGG + Intergenic
905412199 1:37778443-37778465 GGCTATCCTGGCCACCCACAAGG + Intergenic
907367384 1:53973637-53973659 GGATATGTTACACAGCAACAGGG + Intergenic
910444833 1:87289545-87289567 GGCAATGTTGCACAACAATATGG - Intergenic
910640426 1:89455131-89455153 GGCTTTCTTGCTCACTCACAGGG - Intergenic
918848125 1:189645171-189645193 GGTTATGTTGCAGAGCCTCAGGG - Intergenic
920171968 1:204077641-204077663 GGCTATCATGCACACACGCAAGG + Intronic
921187869 1:212685352-212685374 GGTTCTGCTGCTCACCCACAGGG + Intergenic
1063124795 10:3128648-3128670 CGGGATGCTGCACACCCACATGG - Intronic
1063671007 10:8099897-8099919 TGCTATGCAGCACACCAACATGG + Intergenic
1064451413 10:15445329-15445351 TGCTAGGCTGCACACCCTCAAGG + Intergenic
1069747366 10:70724349-70724371 GGCTACGAGGCACACCCACAGGG - Intronic
1076743026 10:132497449-132497471 GGCCAAGTGGCAGACCCACAGGG + Intergenic
1077262814 11:1632090-1632112 GGCTCTGTTGCAGCCCCAGAAGG + Intergenic
1078632569 11:13016520-13016542 TGCCATGTTGCATACCCTCAAGG + Intergenic
1079650835 11:22926986-22927008 GGAAATGCTGCAAACCCACATGG + Intergenic
1080542986 11:33286867-33286889 TGCAATGTTGCAAACCAACATGG + Exonic
1085412295 11:76298427-76298449 GGCCGTGCTGCCCACCCACATGG + Intergenic
1102208282 12:111105551-111105573 GCCTATACTGCACACCCCCAGGG + Intronic
1120516438 14:85476543-85476565 GGCTATGTTGCAGACACAGAAGG + Intergenic
1120722058 14:87900380-87900402 AGCTGTGTTGAACACACACAGGG + Intronic
1125532277 15:40421510-40421532 GGTTCTGTTGCCCTCCCACAGGG - Intronic
1132312655 15:100868492-100868514 GGCTGTGTGGCACAACCACCTGG - Intergenic
1138333107 16:56231033-56231055 GGCTATATGACATACCCACAGGG - Intronic
1141095251 16:81158585-81158607 GCCTGTGCTTCACACCCACATGG + Intergenic
1141656119 16:85417511-85417533 CGCTATGCTGCACACACACCTGG - Intergenic
1162826073 19:13253048-13253070 GACGATGTTGAACACCCGCAGGG + Exonic
1162883755 19:13680833-13680855 GGGTATGTTGCAGACCCACCAGG + Intergenic
1164429430 19:28174162-28174184 GGCTCTGATGCAGACCCACTGGG - Intergenic
1167341813 19:48921021-48921043 GGCTTCTTTGCCCACCCACATGG + Intronic
926147114 2:10403365-10403387 GGCTATGTCACACACCCTGACGG - Intronic
927429394 2:23014187-23014209 GGCCATGATGCACAGACACAGGG - Intergenic
929904567 2:46034709-46034731 GGCTCTGCTGCCCAACCACAGGG + Intronic
937709856 2:124967803-124967825 GACTCTGTTACACACACACAGGG - Intergenic
940823192 2:158380897-158380919 GGTTCTGTTGGATACCCACATGG + Intronic
948168066 2:235878396-235878418 CGCTGTGTTGCACAACCCCAGGG + Intronic
1169029344 20:2395790-2395812 GACTATGGTGAACACCCATAGGG + Intronic
1173296231 20:41760906-41760928 GGCTATTTTGCACACACATATGG + Intergenic
1173903724 20:46610549-46610571 GGCGGTGTTGCTCAGCCACATGG + Exonic
1176368518 21:6048521-6048543 GGCTCTGTTGAACACGCCCAGGG + Intergenic
1178943268 21:36925363-36925385 GGCCACGATGAACACCCACAAGG + Intronic
1178982925 21:37280418-37280440 GGCTCTATTGCACACCAGCATGG - Intergenic
1179755001 21:43490021-43490043 GGCTCTGTTGAACACGCCCAGGG - Intergenic
1181594624 22:23906348-23906370 GGCACTGCTGGACACCCACATGG - Intergenic
1182362674 22:29756218-29756240 GGCTTTATTGCACGCCCACTAGG + Intronic
1184440897 22:44514108-44514130 TCCTATGTTGCTCACTCACATGG + Intergenic
950423693 3:12913407-12913429 TGGTATGTGGCTCACCCACAAGG - Exonic
950970009 3:17176939-17176961 GGCGTTGTAGCACTCCCACAGGG - Intronic
963167208 3:142216825-142216847 TACTAGGTTGCACACACACAGGG + Intronic
967948558 3:194823093-194823115 GCCTGTGGTGCACACCAACATGG - Intergenic
968475150 4:801664-801686 TGCACTGTTGCACACCCAGATGG - Intronic
972827756 4:42780661-42780683 GGCTATTTTGCTTACCCACAGGG + Intergenic
976224150 4:82781926-82781948 GGTGATTTTGCTCACCCACAGGG - Intronic
981026328 4:140080399-140080421 GGTAATGTTCCACACCCACAGGG + Intronic
984168831 4:176336630-176336652 TGCTATGGTGCACTGCCACAAGG - Intergenic
985924164 5:3002819-3002841 GGCTCTATTTCACACCCACCTGG + Intergenic
986201048 5:5579052-5579074 GGCTGTGTTGCAACCCCAGAAGG + Intergenic
986741201 5:10707009-10707031 GGCTAAGTTCAAAACCCACATGG + Intronic
987742050 5:21922022-21922044 GTCAATGTTGGACACCCCCATGG - Intronic
991456794 5:66812469-66812491 GGTTATCTTGCAGAGCCACACGG + Intronic
1009305446 6:62083584-62083606 GACTCTGTTGCAGGCCCACATGG + Intronic
1018305888 6:162454807-162454829 GGCTCTGGTGCACCACCACAGGG + Intronic
1021561253 7:21970718-21970740 GGCTATGTGACACAACCACTTGG - Intergenic
1028889152 7:95967470-95967492 GCCTAGGTTGCTCTCCCACAGGG + Intronic
1034216159 7:149407511-149407533 GGCTATTTTGCAAAATCACAGGG + Intergenic
1035672318 8:1428787-1428809 GCATGTGCTGCACACCCACATGG + Intergenic
1039290644 8:36090800-36090822 TGCTATGTTGCAAACAGACATGG + Intergenic
1040964025 8:53065751-53065773 GGCTGTGCGGCCCACCCACAGGG - Intergenic
1041544830 8:59031347-59031369 GCCTATGTTTCACACCAACTGGG + Intronic
1044003117 8:86909605-86909627 TGCAATGTTGCACACCAACATGG - Intronic
1044932730 8:97265542-97265564 GGGTATGATGCACACTCACTTGG - Intergenic
1049724883 8:144141161-144141183 TGCTCAGTTGCTCACCCACAGGG + Intergenic
1058291182 9:103242160-103242182 GGCTCTGCTGCTCACCCCCAGGG + Intergenic
1058902867 9:109457351-109457373 GGATATGGTGCACAACCACCTGG - Exonic
1060877451 9:127093544-127093566 GGCCATTTTGCAAACCCACCAGG - Intronic
1061380581 9:130254382-130254404 AGCTATGTTCCCCACCCTCAGGG - Intergenic
1185559566 X:1049228-1049250 GTCTATGTTGGAAACCCACGTGG - Intergenic
1191729128 X:64314863-64314885 AGCTATGATGCAGACCCCCAGGG + Intronic
1196026062 X:111042515-111042537 GGCTATGTTGCACACCCACAAGG + Intronic
1199303102 X:146235756-146235778 AGCTATTTTGCATACCCACTGGG + Intergenic