ID: 1196028954

View in Genome Browser
Species Human (GRCh38)
Location X:111074781-111074803
Sequence CAAAATGCTGATGGAGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 502
Summary {0: 1, 1: 1, 2: 6, 3: 99, 4: 395}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196028954 Original CRISPR CAAAATGCTGATGGAGATGT GGG Intronic
901706944 1:11081150-11081172 CAAAATGAGGCTGGAGATGTGGG - Exonic
901871397 1:12140948-12140970 CACAAGCCTGATGGAGGTGTGGG + Intronic
905065297 1:35175858-35175880 CAGAATACTGATGGGAATGTTGG - Intergenic
905246791 1:36620509-36620531 GGAAATGCTGATGGAGATGGAGG - Intergenic
906127095 1:43433401-43433423 CGAAAAGCTGATGGGGATTTTGG + Intronic
907158476 1:52355029-52355051 CAAAATGCAGGTGGAGAGATTGG - Intronic
908139977 1:61174174-61174196 CATTATGCAGATGGAGAGGTCGG + Intronic
908666723 1:66500504-66500526 CCAAATGCTGAAGAGGATGTGGG + Intergenic
908802268 1:67892439-67892461 TAAAGGGCTGATGGAGATTTGGG + Intergenic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
911100730 1:94094040-94094062 CAAAACCCTTATGGAGAAGTGGG + Intronic
911445446 1:97986311-97986333 CAAAATGCTGAGGGTGGGGTGGG - Intergenic
911679739 1:100701632-100701654 CAAAAAGATGAGGGAGATATTGG - Intergenic
912112145 1:106356654-106356676 AGAAATTCTGATGGAGCTGTAGG + Intergenic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912153299 1:106884689-106884711 TAAAATTCTGATGGAGATTATGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
912378080 1:109229208-109229230 AAAAATGCCGATGGATTTGTAGG + Intronic
912923191 1:113889066-113889088 CCAAATGCTGGTGAGGATGTGGG + Intergenic
913562942 1:120041280-120041302 CAAAAGGCTGATGGAGTTGGAGG - Intronic
913635181 1:120752309-120752331 CAAAAGGCTGATGGAGTTGGAGG + Intergenic
914283540 1:146200647-146200669 CAAAACGCTGATGGAGTTGGAGG - Intronic
914544570 1:148651383-148651405 CAAAAGGCTGATGGAGTTGGAGG - Intronic
914622057 1:149419630-149419652 CAAAAGGCTGATGGAGTTGGAGG + Intergenic
917841105 1:178978829-178978851 CAAAATGCAGAGGGGGATGGAGG + Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
919874055 1:201848524-201848546 CAACCTGCTCATGGAGATGTTGG + Exonic
921274084 1:213500292-213500314 CAAAATGAAGATGGTGATATTGG - Intergenic
921313247 1:213866600-213866622 CAAAAGGAAGATGGAGATGAGGG - Intergenic
921536763 1:216359914-216359936 CCAAATGCTGGTGAGGATGTGGG + Intronic
922224069 1:223630116-223630138 CTGAGTGATGATGGAGATGTTGG - Intronic
922950576 1:229555588-229555610 CAAAATGCTGAGACAGATGGAGG + Intronic
923063194 1:230495724-230495746 AACAGTGCTGATGGAGATGATGG - Intergenic
923488240 1:234457477-234457499 TAAGATGCTTATGGAGAGGTGGG - Intronic
924387432 1:243511946-243511968 CAAAATTCTGAAGGTTATGTGGG + Intronic
1062898513 10:1123593-1123615 CCATCTGCTGATGGACATGTGGG + Intronic
1062941796 10:1427574-1427596 CCAAATGCTGGTGAAGATGTAGG + Intronic
1063112503 10:3048855-3048877 GAAAATGCTGATGGAGCAGGAGG + Intergenic
1063666742 10:8065677-8065699 CAAACTGCTGGAGGAGAGGTGGG - Intronic
1064823492 10:19366884-19366906 CCAAATACTGGTGAAGATGTGGG - Intronic
1065641725 10:27789359-27789381 TAAAAAGCAGATGGAGTTGTGGG - Intergenic
1065767178 10:29040769-29040791 GAAGGTGCTGATGGAGATGGAGG + Intergenic
1065767211 10:29040958-29040980 CAAGGTGCTGATGGAGACGGTGG + Intergenic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1066540360 10:36440168-36440190 CAAAATGCTCAAGTAGATGAGGG - Intergenic
1066692432 10:38043604-38043626 CACAATACTGGTGGAGTTGTTGG - Intronic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068843486 10:61643020-61643042 TACAATCTTGATGGAGATGTAGG + Intergenic
1069067952 10:63964277-63964299 TGGAATGCTGATGGACATGTTGG + Intergenic
1069923758 10:71833864-71833886 CAAACTGCTGATTGAGATCCTGG - Intronic
1072252336 10:93591398-93591420 CAAAATGTTGATGGGGAGGAGGG - Intronic
1072296103 10:94010847-94010869 CAAAATACTGATAGAAATATGGG - Intronic
1072818903 10:98536898-98536920 CAAGATGGGGTTGGAGATGTGGG + Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1072985581 10:100136934-100136956 CCAAATGGTGATGAGGATGTGGG + Intergenic
1073695662 10:105864172-105864194 CTAAATGTTGATGAAGGTGTGGG + Intergenic
1074185598 10:111097537-111097559 CACAGTGCTGATGGACATGGTGG + Intergenic
1074305847 10:112277904-112277926 GAAAGTACTGATGGAGCTGTAGG + Intergenic
1075556933 10:123439717-123439739 CAAGACGCTGAAGCAGATGTTGG - Intergenic
1075565396 10:123499891-123499913 CAAGATGATGATGGAGAAGAGGG + Intergenic
1075671569 10:124266947-124266969 CAAGATGCTGAGGCAGAGGTGGG - Intergenic
1077379148 11:2220400-2220422 TAAAATGCTGATAGACATGCAGG - Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1078590937 11:12640635-12640657 CAAAATGAGGCTGGAGATGTAGG + Intergenic
1078899527 11:15628603-15628625 AAAAGTGCTGATGGTGTTGTGGG + Intergenic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1080815299 11:35750091-35750113 CAGAAGGCTCATGGAGATTTTGG - Intronic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1081555098 11:44151857-44151879 CCAAATGTTGGTGAAGATGTAGG - Intronic
1082177372 11:49076695-49076717 CAAAATGCTAATGATGATGGTGG - Intergenic
1082693658 11:56333061-56333083 CAAACAGTTGATGGGGATGTGGG + Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1083982899 11:66188496-66188518 CCAAGTGCTGGTGAAGATGTAGG - Intronic
1084766654 11:71313576-71313598 CCAAATGCTGGTGAGGATGTGGG - Intergenic
1084934171 11:72578303-72578325 CAACAGGCCGATGGAGATGATGG - Exonic
1085307452 11:75496071-75496093 CAAGATGCTGTTGGAGCTGAAGG - Intronic
1085879006 11:80443435-80443457 GAAAAGGCGGTTGGAGATGTAGG + Intergenic
1086688346 11:89759143-89759165 CAAAATGCTAATGATGATGGTGG + Intergenic
1086717514 11:90080802-90080824 CAAAATGCTAATGATGATGGTGG - Intergenic
1086837406 11:91641899-91641921 CAAATGGCTGAAGGAGATATTGG + Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088925802 11:114301098-114301120 CCAAATGCTGATGAGGCTGTGGG + Intronic
1089654378 11:119936086-119936108 CACAATGTGGGTGGAGATGTGGG + Intergenic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1094348998 12:29502407-29502429 CAAAATAAAGATAGAGATGTAGG + Intronic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1094480041 12:30874444-30874466 CAAAGAGCTGAAGGAAATGTGGG + Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1096017407 12:48290057-48290079 ACAAATGCTGATGAAGATGTGGG + Intergenic
1096662006 12:53131493-53131515 CAAAATGCTGACACAGATGGAGG + Intergenic
1097317301 12:58185597-58185619 CAAAATCCTGATGGAGAGGTTGG - Intergenic
1098886376 12:75964689-75964711 CTAAATGCAGAAGGAAATGTTGG - Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1100197496 12:92263787-92263809 CAAAATTCTAATGGAGTTTTGGG + Intergenic
1100412368 12:94333549-94333571 CCAAATGCTGAAGGAAATGGTGG - Exonic
1100930294 12:99600808-99600830 AAAAATAGTGTTGGAGATGTAGG - Intronic
1101120653 12:101576298-101576320 TAACATGCTGTTGGAGATTTAGG + Intronic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1101721005 12:107350701-107350723 CAAAATGCTGGAGGAGATTGGGG + Intronic
1101872675 12:108578819-108578841 CACAATGATGATGGTGATGGTGG - Intergenic
1102923863 12:116812142-116812164 CAAGGGGCTGATGGAGAGGTGGG + Intronic
1103032731 12:117630451-117630473 CAAAATGAAGCTGGAGATGTAGG + Intronic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1104371167 12:128225143-128225165 CAAAATGTTGATGAAGGTGAGGG + Intergenic
1104659351 12:130599065-130599087 AAAAATGGTGATGGAAATATTGG + Intronic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105634027 13:22200014-22200036 AAAAATGGTGATGGTGATGATGG + Intergenic
1105734519 13:23254236-23254258 CAAAATGCTGTTAGAAATGTGGG + Intronic
1106502027 13:30338060-30338082 CAGAAGGCAGTTGGAGATGTCGG + Intergenic
1106730209 13:32533385-32533407 AGACATGCTGATTGAGATGTGGG + Intronic
1107234338 13:38150902-38150924 CCAAATGCTGGTAAAGATGTGGG + Intergenic
1107806688 13:44159936-44159958 TAAAATGCAGATGATGATGTTGG - Intronic
1108422125 13:50261730-50261752 CAAAGTGCTCATGGAGTTGATGG + Intronic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1109368382 13:61388627-61388649 CAAGATGCTAATGTAGATCTGGG + Intergenic
1109454618 13:62568034-62568056 CTAAATGGTGATGTATATGTTGG - Intergenic
1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG + Intergenic
1110463220 13:75770311-75770333 CCCAATGTTGATGGGGATGTGGG + Intronic
1110715293 13:78695974-78695996 CGAAACGCTGATGAGGATGTGGG - Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1113323797 13:109264508-109264530 CAAAATAATGATGGAAATGATGG - Intergenic
1113449216 13:110394688-110394710 CACACTGCTGCTGGAGAGGTGGG + Intronic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114797321 14:25731153-25731175 CAAATTGCTGATGATAATGTTGG - Intergenic
1114917271 14:27284740-27284762 CAAAATGCTGATAAAGATTTTGG + Intergenic
1115767561 14:36639133-36639155 CAAAATACTGATGGAGAGAAGGG - Intergenic
1115932719 14:38515256-38515278 CAAAAAGCTTATGGTAATGTAGG - Intergenic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1117668668 14:58083049-58083071 CAAGAAGATGATGGAGATATGGG + Intronic
1118530164 14:66695380-66695402 CCAAGTGCTGATGAGGATGTGGG + Intronic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120464467 14:84839111-84839133 CCAAATGCTGGTGAGGATGTAGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1123001794 14:105299749-105299771 CCAAGTGCTGGTGAAGATGTGGG + Intronic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1125359999 15:38855113-38855135 CTTTATGCTGATGGAGAGGTGGG - Intergenic
1125412280 15:39417901-39417923 CAGAATGCTGTTGGAGCAGTGGG + Intergenic
1125419530 15:39490304-39490326 TAAAAGGCTGAAGGAGAAGTAGG - Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127053955 15:55113236-55113258 GAAAATGCTGGTGGAGAGGTCGG + Intergenic
1128248589 15:66149591-66149613 CGTGATGCTGATGGAGATGGGGG - Intronic
1128790515 15:70430070-70430092 CAAAATGAGGATGGAGAGGGTGG - Intergenic
1129210153 15:74063745-74063767 GAACATGCTGATGGAGGAGTCGG + Intergenic
1129403869 15:75301657-75301679 GAACATGCTGATGGAGGAGTCGG - Intergenic
1130225765 15:82057384-82057406 CCAAATGCTTATGGAAATGCAGG + Intergenic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131453657 15:92566408-92566430 CAAAATGCTCATAGAAATATGGG - Intergenic
1132436226 15:101805910-101805932 CAAATTGATGATGGAAAGGTTGG - Exonic
1135286445 16:21197580-21197602 CACAAGACTGCTGGAGATGTTGG - Exonic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1137298888 16:47126688-47126710 CAAGATGCTGATGGAAAGGGAGG + Intronic
1137888142 16:52128526-52128548 TAAAATGCAAATAGAGATGTGGG + Intergenic
1138326953 16:56181920-56181942 CTAAAAACTGATGCAGATGTTGG - Intergenic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1140189977 16:72807145-72807167 CAAATTGGTGAAAGAGATGTAGG - Intronic
1140462822 16:75154730-75154752 CAAAATGCTGGTGAGGATGCAGG - Intronic
1140468063 16:75197912-75197934 CAAAATGCGGATGCTGAGGTGGG - Intergenic
1141072260 16:80968444-80968466 CCAAATGCAGATGAAGATGAAGG + Exonic
1142664554 17:1455540-1455562 CAAAGAGCTGAGGGAGATGTTGG - Intronic
1146288100 17:31588199-31588221 CATCATACTGATGGAGAAGTAGG + Intergenic
1147898782 17:43769965-43769987 CAAAGTGCTGGTGAAGATATGGG + Intronic
1148001181 17:44388238-44388260 TATAATGTTGATGGAGATGAGGG + Intronic
1148844262 17:50519573-50519595 CCAGATGCTGGTGGAGATGTGGG - Intronic
1149025004 17:52017343-52017365 CAAAATGCTGATAGAAACATTGG + Intronic
1150277641 17:63910155-63910177 CCAAATGCTGATGGGGGTGAGGG - Exonic
1152565356 17:81097876-81097898 CAAAACGCTGATGAGGCTGTGGG - Intronic
1153360956 18:4196389-4196411 AAAAATGCTGATTGCCATGTGGG + Intronic
1154292260 18:13119304-13119326 CAAAAAGCTGGTGAAGATGTGGG - Intronic
1155931040 18:31708803-31708825 CAAAATGGTGATGGCAATGGGGG + Intergenic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156839781 18:41597781-41597803 CAAAATCCATCTGGAGATGTAGG - Intergenic
1157141842 18:45116200-45116222 CAAAATGCTGAAGGAGGGGTAGG - Intergenic
1157207227 18:45710864-45710886 CAGGATGCAGTTGGAGATGTGGG - Intergenic
1157762437 18:50274647-50274669 CAAAATGTTGCTGGAAATGGGGG - Intronic
1157951707 18:52045739-52045761 CCAAATGCTGACTGAGATGAGGG - Intergenic
1158782881 18:60673036-60673058 CAAAATTCTGATTGATATTTAGG + Intergenic
1160249468 18:77188834-77188856 CTAAACGCTGTTGAAGATGTGGG - Intergenic
1160573521 18:79834594-79834616 CAAACAGCTGGTGGGGATGTGGG + Intergenic
1163901067 19:20100650-20100672 CCAAATGCTGTTGGGGAGGTTGG - Intronic
1164155209 19:22591448-22591470 CTACATGCTCATGGAGATGTTGG + Intergenic
1164556854 19:29259860-29259882 GGGAATGCTGATGGCGATGTGGG + Intergenic
1165352735 19:35284969-35284991 GAAAATGCAGATGGGGAAGTGGG - Exonic
1165423976 19:35735657-35735679 CAACCTGCTGGTGGAGATGGTGG - Intronic
1165896978 19:39147623-39147645 CCAAATGCTGGTGAGGATGTGGG - Intronic
1166259069 19:41625499-41625521 CAAAATGCAGAGGGGGATGCAGG + Intronic
1166454552 19:42929683-42929705 GAAATTGCTGCTGGAGATGGAGG + Exonic
1166491212 19:43262101-43262123 TAAGTTGCTGCTGGAGATGTAGG + Exonic
1166718914 19:44986501-44986523 CACGATGTTGATGGTGATGTTGG - Exonic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
1202711598 1_KI270714v1_random:22280-22302 CAAGATGCAGCTGAAGATGTAGG - Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
925686078 2:6475441-6475463 CAAAATCATAATGGACATGTGGG + Intergenic
925860266 2:8168561-8168583 CAAAAAGCTGATGGAAAGCTAGG + Intergenic
927010715 2:18900842-18900864 CAGACTGCTGGTGGTGATGTTGG + Intergenic
927892298 2:26759243-26759265 AAAAATGTTTATTGAGATGTAGG - Intergenic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
929900231 2:45994220-45994242 CAGAATGCTGATGGTGAGGGAGG - Intronic
930355446 2:50312914-50312936 CAGAATTCTGATGGAGTTCTTGG + Intronic
930560321 2:52951987-52952009 CAAAATGTAAATGGAGATGATGG - Intergenic
930577933 2:53174821-53174843 CAAAATGCTAATGCAAATCTAGG - Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
931169879 2:59791395-59791417 CAAAGTGCTGAGGGAGACGAGGG - Intergenic
932489182 2:72108877-72108899 GAAAATTCTAATGGAGATGGGGG - Intergenic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
933121027 2:78538526-78538548 CCAAATGCTGATGAAGATGTAGG + Intergenic
935330051 2:101970342-101970364 CAAAATGCAGATAGAAATATGGG - Intergenic
935640439 2:105284959-105284981 CAAAGTGGTCATGGAAATGTGGG - Intronic
936816014 2:116461826-116461848 AAAAATGCTGGTGAGGATGTTGG + Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
939677511 2:145090686-145090708 CAGAATGTTGATGGAAATATGGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940373754 2:152931914-152931936 CAATATGCTGATGTACTTGTTGG + Intergenic
940594309 2:155770127-155770149 CAAAATGATGGTGATGATGTTGG - Intergenic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
941232044 2:162922529-162922551 CAAAATCATGATAGAGATGATGG + Intergenic
941389550 2:164894841-164894863 GAAAATGAGGCTGGAGATGTAGG - Intergenic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
942503149 2:176613567-176613589 CAAGTTCCTGATGGAGATGTTGG + Intergenic
942629917 2:177944512-177944534 TAAAAAGCTGATGGAAATTTAGG + Intronic
943223583 2:185140695-185140717 CAAAAAGCCGATAGTGATGTGGG - Intergenic
943642679 2:190376321-190376343 CAAAGTTTTGATGGAGATGAGGG - Intergenic
944086865 2:195858710-195858732 CACAATGCAGATGGAGTTGGAGG - Exonic
944236241 2:197443876-197443898 AAAAATGATGAAGGAGATGGGGG + Intergenic
944571444 2:201049213-201049235 CAATTTGCTGAGAGAGATGTGGG - Intronic
944737059 2:202576883-202576905 AAAAATGCTGATGGATGTGGTGG + Intergenic
945063322 2:205927025-205927047 TAAAATGCAGATGGAATTGTTGG + Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
946220079 2:218217993-218218015 GAGAATGCTGGTGGCGATGTGGG - Intronic
946414489 2:219532960-219532982 GAAGAGGCTGATGGAGAGGTAGG - Intronic
946983859 2:225249336-225249358 CAAAGTGCTAATGGAAATGGAGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
948158348 2:235802621-235802643 CAAAATGATGGTGGTGATGATGG + Intronic
1169027618 20:2383770-2383792 CAAAGTGATGGGGGAGATGTGGG + Intronic
1169750734 20:8990725-8990747 GCAAATGCTGATGGAGAGGGAGG - Intergenic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1170782980 20:19442351-19442373 CCAAATGCTGGTGAAGATGTGGG - Intronic
1170792850 20:19521863-19521885 CAAAATACTGGAGGAGATGGGGG - Intronic
1171217840 20:23365128-23365150 AAAACTGCTGAGGGTGATGTGGG + Exonic
1171260195 20:23725204-23725226 AAAAGTGCTGATGGTGATGGTGG - Intergenic
1171280414 20:23891433-23891455 GAAAATGGTGATGGTGATGATGG - Intergenic
1172039427 20:32033436-32033458 GAAAAATCTGATGAAGATGTCGG - Intergenic
1172276847 20:33684803-33684825 CTAACTGCTGATGGGGGTGTGGG - Intronic
1175060239 20:56235376-56235398 CAATATTCTGATAGAGACGTTGG - Intergenic
1175933496 20:62504436-62504458 GAAAATGGTGATGGTGATGATGG - Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177414885 21:20780658-20780680 CAAAATGCTCAAGGAGCTGTTGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177754773 21:25333114-25333136 ACAAAAGCTGATGAAGATGTTGG - Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1179078354 21:38145133-38145155 CCAAATGCTGGTGAGGATGTGGG - Intronic
1179566006 21:42249632-42249654 CAAAATGATGATGCTGATGATGG - Intronic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1181330554 22:22087366-22087388 CAAAAGGATGATGGAGATGCAGG - Intergenic
1181500325 22:23312308-23312330 CAAAATCCTGTTGAAGATGCTGG - Intronic
1182850367 22:33468864-33468886 GCAAATACTGATGGAGATTTGGG - Intronic
1185209600 22:49562949-49562971 CATAGTGATGATGGAGATGATGG - Intronic
949641798 3:6044255-6044277 CAAAATGCTGAGGGAGTAGTTGG + Intergenic
950344262 3:12277619-12277641 CACAATGTTGATGGACATTTGGG + Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
952095114 3:29941866-29941888 CAAATTGCTAATGAAGGTGTAGG + Intronic
953566147 3:44033512-44033534 CACAATACTGATGGGGATCTGGG - Intergenic
953633410 3:44640338-44640360 GAGAATGCTGATGGAGAGGAGGG - Intronic
955570200 3:60296324-60296346 CTAAATGCTGGTGAAGATGCGGG - Intronic
955675566 3:61444679-61444701 CAAAAAGCTGATGAAGATATGGG - Intergenic
955876530 3:63495776-63495798 CCAAAGGTTGAGGGAGATGTGGG + Intronic
957892243 3:86375589-86375611 GAAAATACTGATGGAAATGAGGG + Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
962617694 3:137143655-137143677 CAAAGTGAAGATGGAGATTTGGG + Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963437544 3:145289892-145289914 CAAGCTGCTGATGGACCTGTTGG + Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
965232713 3:166073438-166073460 AAAAATGCTGATAGAAATATGGG - Intergenic
965541379 3:169875010-169875032 GAAAATGTTGATGGTGAAGTGGG + Intergenic
965757151 3:172039216-172039238 TAAAATGCTGTGGGAAATGTGGG + Intergenic
965788435 3:172361571-172361593 CAAAGCGCTGATGGAAATATGGG - Intronic
965925668 3:173976443-173976465 CAATGTACTGATGAAGATGTGGG + Intronic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967298654 3:187990473-187990495 CAAAACACTGCTGGAGAAGTAGG - Intergenic
968414092 4:414036-414058 ACAAATGCTGATGAGGATGTTGG - Intergenic
968527958 4:1074038-1074060 CCAGATGCTGATGGACAGGTTGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970375358 4:15451549-15451571 CAAACAGCTGGTGGAGATTTAGG + Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971972478 4:33637752-33637774 CAAAATGCTGATAGAGAATAAGG - Intergenic
971980293 4:33742515-33742537 CCAAATGCTGCTGGGGAGGTTGG - Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973029752 4:45322629-45322651 TAAACAGCTTATGGAGATGTAGG - Intergenic
973539345 4:51920632-51920654 CTAAATGCTGATGAGGATATAGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
975586647 4:75956583-75956605 GAAAATGATGTTGGAAATGTAGG + Intronic
976001844 4:80383512-80383534 TAAAATGCTGATGGAAATTATGG - Intronic
976464506 4:85352477-85352499 CCAAGTGCTGTTGGAGAGGTTGG + Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977446161 4:97135687-97135709 TAAAAAACTGATGGAGATATTGG - Intergenic
978480380 4:109183210-109183232 CAGGATGCTGGTGGAGATGCTGG - Intronic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979423857 4:120540163-120540185 CAAAATGCTTATAGTCATGTTGG - Intergenic
981329208 4:143488661-143488683 CAAAAAGCAGAGGGAAATGTAGG + Intergenic
981355372 4:143783941-143783963 CAAAATGCTGGTAGAAATATGGG + Intergenic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
983818877 4:172168542-172168564 CAAGATGGTGATGGTGATGATGG + Intronic
983951713 4:173649846-173649868 CCTGTTGCTGATGGAGATGTGGG - Intergenic
984849129 4:184138473-184138495 CAAAATATTGATGTAAATGTTGG - Intronic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986430945 5:7680345-7680367 CAAAATGCTGATAGCGCTGAGGG + Intronic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
987459955 5:18197400-18197422 CAAAATGCTGAAAGAAATATGGG + Intergenic
987533209 5:19148797-19148819 CAAAATGCTGATAGTGACGAGGG - Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
989359014 5:40578201-40578223 GAAAATGGTGATGCAGATGAGGG + Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990097401 5:52134215-52134237 CATAAGGCTGATGGAGAGATGGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991074707 5:62522178-62522200 CAAAATGCTGATCTTGAAGTTGG - Intronic
991182160 5:63765031-63765053 CAAACTCCTGGTGGAGCTGTTGG - Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
991226203 5:64276036-64276058 CAAGATGCTGATGGATCTCTGGG - Intronic
992022216 5:72635752-72635774 CACAATACTGGTGGAGTTGTGGG - Intergenic
992132767 5:73710196-73710218 CAACATGCTGGTGAATATGTGGG - Intronic
992985499 5:82224715-82224737 CAAAATGCTTATGGAGAAGGTGG + Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993460654 5:88177109-88177131 CCAAATGCTGTTGGGGAAGTTGG + Intergenic
993590892 5:89794225-89794247 CCAAGTGCTGTTGGAGAGGTTGG - Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995601016 5:113796293-113796315 CAAAATGGTAATGGAGATAGTGG - Intergenic
995950748 5:117710180-117710202 CCAAATGCTGGTGAGGATGTAGG - Intergenic
996354332 5:122579590-122579612 CAAAATGTAGATGGAAATGGAGG - Intergenic
998358927 5:141567213-141567235 GAAAATGGTGATGGAAAGGTTGG + Intronic
998432614 5:142079355-142079377 CAATTTGCTGATGGAGCTGCAGG + Intergenic
999072734 5:148764450-148764472 CTACATTCTGATGGAGATTTAGG + Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1001750621 5:174128098-174128120 CCAAGTGCTGGTGGGGATGTGGG + Intronic
1003786772 6:9495258-9495280 TAAAATGCAGATGCAGATGTAGG - Intergenic
1004854799 6:19738153-19738175 TGAAAATCTGATGGAGATGTGGG - Intergenic
1005402361 6:25447983-25448005 CAAAATGTATATGGAGAGGTGGG - Intronic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1007078753 6:39084356-39084378 AAAAGTGCTGAAGGAGATGGGGG + Intronic
1007230446 6:40344295-40344317 CAGAATGCTGATTGACATATAGG - Intergenic
1008170861 6:48203691-48203713 CAAAATGAAGATGGAAATGTTGG + Intergenic
1010583255 6:77625897-77625919 CAATATACTGATGAAGAAGTTGG - Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1012003437 6:93683452-93683474 CAAAATGGTGATTGAGGTGGGGG - Intergenic
1012015689 6:93847182-93847204 CAAAATGCTGATAGAAATTAAGG + Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012130534 6:95485663-95485685 ACAAATGCTGATGAGGATGTGGG + Intergenic
1012388657 6:98710870-98710892 AAAAACGCGGATGGAGATGGTGG - Intergenic
1012518673 6:100093543-100093565 CAGAATGCTGCTGGAGAGGAAGG - Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1012819655 6:104069902-104069924 CAAGATGCTGATGGAGCAATTGG + Intergenic
1013137939 6:107300373-107300395 CCAAGTGCTGTTGGAGAGGTTGG - Intronic
1013448236 6:110252586-110252608 AAAAATGCTTATGGAGATAGTGG - Intronic
1013775945 6:113678519-113678541 CAAAATTGTGATGGAGCTGGAGG + Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014764774 6:125393713-125393735 CACAATGATGAGGGAGAAGTGGG + Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015823089 6:137283520-137283542 CAAAATCTTGAAGGAGATGAGGG - Intergenic
1015864206 6:137711296-137711318 CAAATTCCTGCTGGAGAAGTGGG - Intergenic
1015909127 6:138148996-138149018 CCCGATGTTGATGGAGATGTGGG - Intergenic
1017502614 6:155039440-155039462 CAAAATGCTGATGGCCATGGTGG + Intronic
1017572776 6:155765073-155765095 CAAAATCTAGAGGGAGATGTGGG + Intergenic
1018209186 6:161463801-161463823 CAAAATTTGGATGGAAATGTTGG - Intronic
1018399962 6:163413115-163413137 CAAAATGCAGACGTAGATTTAGG + Intergenic
1018507937 6:164491483-164491505 CAAAATGCAAATGAAGATTTGGG + Intergenic
1018840966 6:167516444-167516466 CAAGATGCTGATGACGATGATGG - Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019804184 7:3110795-3110817 CCAAATGCTGACAAAGATGTGGG + Intergenic
1019980413 7:4617510-4617532 CAAAATGCTGGTGAGGATGCAGG + Intergenic
1020367367 7:7394714-7394736 ATAAATGCTAATGGAGAAGTAGG + Intronic
1020370486 7:7426990-7427012 CAATATGTTTATGGTGATGTGGG + Intronic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1022461019 7:30607029-30607051 CATATTGCTGATGGTGGTGTTGG - Intronic
1024838481 7:53554476-53554498 CAAAATGCAAAAGGAAATGTAGG + Intergenic
1024856254 7:53783066-53783088 TAAAATGCAGAGGGAAATGTGGG - Intergenic
1024895907 7:54261601-54261623 GCAAATGGTGATGGAGATGAAGG - Intergenic
1025529530 7:61861269-61861291 CAAACTGCTGAATGAAATGTAGG + Intergenic
1026338929 7:69418976-69418998 CATGCTACTGATGGAGATGTTGG - Intergenic
1027380417 7:77603057-77603079 TAACTTGCTGGTGGAGATGTGGG + Intronic
1027381146 7:77611029-77611051 AAAATTGCTGATGGAGTGGTAGG + Exonic
1028228806 7:88281357-88281379 CAAAATGCAGATGGTAATGAAGG - Intronic
1028259572 7:88645372-88645394 CCAAATGCTGATGAGCATGTGGG + Intergenic
1028302047 7:89212161-89212183 CAAATTCCTGATGGAAATTTGGG - Intronic
1029603223 7:101582151-101582173 CAAAATCCAGATGGAGAAGGTGG + Intergenic
1030337763 7:108344121-108344143 CCAAATGCTGTTGGGGAGGTTGG - Intronic
1030700460 7:112632937-112632959 CAAAATGCAGAAGGCGCTGTGGG - Intergenic
1031057585 7:117010479-117010501 GGAAATGCTGATGCAGATGCAGG + Intronic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031338460 7:120568253-120568275 CAAAATACTTATGGAGCTTTAGG - Intronic
1033475986 7:141693348-141693370 CCAAATGCTGATGAGGATGTGGG + Intronic
1033548729 7:142425968-142425990 CAAAATGATGATGGAGAAGCAGG - Intergenic
1033562429 7:142545177-142545199 CAAAATGATGATGGAGATGTAGG - Intergenic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1034777700 7:153846131-153846153 CCAAATGTTGACGAAGATGTGGG - Intergenic
1035148711 7:156847763-156847785 CCAAATGCTGGTGAGGATGTGGG + Intronic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1037551393 8:19975105-19975127 CAGAATGCTGGGGGAAATGTAGG - Intergenic
1037661801 8:20934205-20934227 TCAAATGCTGATGAAGATGTGGG + Intergenic
1038380971 8:27093487-27093509 CAAAAAGCTGATGTACTTGTGGG + Intergenic
1038382510 8:27109825-27109847 TAAAATGCTGATGGGGATGAGGG - Intergenic
1038414721 8:27386198-27386220 CAAAATGCTCAGGGGGAAGTCGG - Intronic
1038752450 8:30308254-30308276 CTAAATGCTGGTGAGGATGTGGG - Intergenic
1038812004 8:30856885-30856907 CAAAATTCTGATAGATTTGTTGG + Intronic
1039017247 8:33164808-33164830 CAAAGTGGTGATGGTGATGATGG + Intergenic
1039585627 8:38704791-38704813 CAATCTGCTCCTGGAGATGTGGG + Intergenic
1039652306 8:39354791-39354813 CAAAATGCTGATGAGGCTGTGGG + Intergenic
1039903761 8:41771431-41771453 CAAAATGCAGATGGAGAAGCAGG - Intronic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1042427497 8:68665224-68665246 CAAAATACAGATGGAAATATTGG + Intronic
1043363911 8:79509490-79509512 CAAAATGCTGATGCAGCTGAAGG + Intergenic
1043626195 8:82261855-82261877 CACAATAGTGATGGAGATGATGG - Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044906277 8:97007152-97007174 CAGAATGCTGTTAAAGATGTCGG - Intronic
1045091521 8:98750248-98750270 CAAAATGTAGATGGAGAAGAGGG + Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1045998400 8:108390550-108390572 CAAAGTACTGATGGAAATATGGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046276938 8:111973903-111973925 ACAAATGCTGGTGAAGATGTGGG + Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1047972516 8:130097441-130097463 CAAGAGGCTGTTGGAGATGTGGG - Intronic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052511011 9:29420641-29420663 CAAATTGCTGACAGAGATGAGGG - Intergenic
1056066798 9:82944141-82944163 CCAAGGGCTGATGAAGATGTAGG - Intergenic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1057945860 9:99327604-99327626 CAACATGTGGATGCAGATGTGGG + Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059917171 9:119116958-119116980 CAAAATGTTGATAGAAATATGGG + Intergenic
1060705205 9:125792380-125792402 GAAAATGAGAATGGAGATGTAGG + Intronic
1061298859 9:129693039-129693061 CCAAATGCTGGCGAAGATGTGGG - Intronic
1061511755 9:131065889-131065911 CAAGATGATGATGAAGATGATGG + Intronic
1061709476 9:132477772-132477794 CCAAACTCTGATGGAGATGTGGG + Intronic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1185962081 X:4555670-4555692 CAAAATGCCAACGGAGATGCAGG - Intergenic
1186823924 X:13318721-13318743 CAAAATGACGAGAGAGATGTGGG - Exonic
1187702528 X:21976805-21976827 CAAAAAGCTGAAGGAGAAGATGG - Intronic
1187920583 X:24197524-24197546 GAAAATGCTTATGGAGAAGGAGG + Intronic
1188740553 X:33773860-33773882 AAAAATACTGGTGAAGATGTGGG - Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189183078 X:39021735-39021757 TCAAATGCTGGTGAAGATGTGGG - Intergenic
1189586706 X:42469097-42469119 AAAAATGCTGATGGGAATGCAGG + Intergenic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189766549 X:44378197-44378219 CAAACTGCTGTTGGAGGAGTGGG + Intergenic
1190059254 X:47200428-47200450 CTAAATCCTGATGGAGGAGTAGG + Intronic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191142116 X:57125918-57125940 TATACTGCTGATGGAAATGTAGG - Intergenic
1191724571 X:64266232-64266254 CAAAATACAGATTGAGATATGGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192792459 X:74396234-74396256 TAAAAAGCTTATGAAGATGTAGG + Intergenic
1193202191 X:78704626-78704648 CAAAATGGTGATGGTGTTGGTGG + Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194418948 X:93649034-93649056 CCAAATGGTGATGGTGATATGGG + Intergenic
1195974139 X:110507526-110507548 CCAAATGCTGGTGAACATGTGGG + Intergenic
1196028954 X:111074781-111074803 CAAAATGCTGATGGAGATGTGGG + Intronic
1196150312 X:112366328-112366350 CATAATGATGATGGTGATGATGG - Intergenic
1197053247 X:122086470-122086492 CAAAGTTTTGAGGGAGATGTGGG - Intergenic
1197136298 X:123064243-123064265 CCCAGTGTTGATGGAGATGTTGG - Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1199264195 X:145811122-145811144 CAAAATGCTGATGATTATTTTGG - Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1200851318 Y:7886833-7886855 CAAAGTGCTGTTGGGGAGGTTGG + Intergenic
1201761581 Y:17545256-17545278 CAAAATGTTGATGGAGAATGAGG + Intergenic
1201839971 Y:18360734-18360756 CAAAATGTTGATGGAGAATGAGG - Intergenic