ID: 1196029810

View in Genome Browser
Species Human (GRCh38)
Location X:111084630-111084652
Sequence CTGCTTAACTAGAAAAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 640
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 585}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196029810_1196029811 26 Left 1196029810 X:111084630-111084652 CCATTTTTTTTCTAGTTAAGCAG 0: 1
1: 0
2: 3
3: 51
4: 585
Right 1196029811 X:111084679-111084701 TTTGTCGATGCTTCACAACCAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1196029810_1196029812 27 Left 1196029810 X:111084630-111084652 CCATTTTTTTTCTAGTTAAGCAG 0: 1
1: 0
2: 3
3: 51
4: 585
Right 1196029812 X:111084680-111084702 TTGTCGATGCTTCACAACCAGGG 0: 1
1: 0
2: 0
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196029810 Original CRISPR CTGCTTAACTAGAAAAAAAA TGG (reversed) Intronic
901393830 1:8965880-8965902 CTGCTTCAAAAAAAAAAAAAAGG + Intronic
902474587 1:16675098-16675120 TTGTTTAGCTAGAGAAAAAAAGG - Intergenic
902484274 1:16732646-16732668 TTGTTTAGCTAGAGAAAAAAAGG + Intergenic
902495213 1:16867384-16867406 TTGTTTAGCTAGAGAAAAAAAGG + Intronic
903463000 1:23532014-23532036 CCCCTTAACTGGAAAAACAAGGG - Intergenic
903747620 1:25598836-25598858 CTGCTTAACCAAAAAGAAAGTGG + Intergenic
904512293 1:31022163-31022185 CTGCTCATCTAAAAAAAAATGGG + Intronic
905150897 1:35926626-35926648 CTGCAAAGCTAGAACAAAAATGG - Exonic
905160961 1:36033477-36033499 CTACTTAAATAAAAAAAAAAAGG + Intronic
905429731 1:37912945-37912967 CTGCTAAAAAAAAAAAAAAAGGG + Intronic
906462761 1:46049159-46049181 CTTCTTAAAAAAAAAAAAAAAGG + Intronic
906682852 1:47742474-47742496 CTGCTTAACAAAAAAAAAGAAGG + Intergenic
906996091 1:50795872-50795894 CTGATTACCAAGAAAAAAATTGG + Intronic
906998462 1:50824473-50824495 CTGATTAATGCGAAAAAAAAAGG + Intronic
907401328 1:54226666-54226688 CTTCTTAAAAAAAAAAAAAAAGG - Exonic
908372165 1:63493920-63493942 CTGGTCAACTAGAAACAAAAGGG + Intronic
908437974 1:64125588-64125610 CTGATTAACCAGAAATGAAAAGG - Intronic
908542104 1:65131347-65131369 CTGCTTAGCTAGAGCAGAAATGG + Intergenic
909448450 1:75773130-75773152 CTGTTTAAAAAAAAAAAAAAAGG + Intronic
909891985 1:81018775-81018797 GTGCTTAAAGAGAAAAAAAGAGG + Intergenic
910068156 1:83178860-83178882 CAGTATAATTAGAAAAAAAATGG - Intergenic
911289555 1:96040443-96040465 CTTATTAACTGAAAAAAAAATGG - Intergenic
911456497 1:98130797-98130819 ATTCTTAAAAAGAAAAAAAATGG + Intergenic
911782532 1:101900640-101900662 CTGATAAAGTAGAAAAAAAATGG + Intronic
912823641 1:112886593-112886615 CTTCTTAAAAAAAAAAAAAAGGG - Intergenic
913311880 1:117506689-117506711 TTGCTTAACCTGAAAAACAAGGG + Intronic
913662132 1:121013369-121013391 TTGTTTAGCTAGAGAAAAAAAGG - Intergenic
914013506 1:143796554-143796576 TTGTTTAGCTAGAGAAAAAAAGG - Intergenic
914164318 1:145164631-145164653 TTGTTTAGCTAGAGAAAAAAAGG + Intergenic
914336102 1:146716287-146716309 CTGCATAAAGAGAAAACAAATGG - Intergenic
914652131 1:149705163-149705185 TTGTTTAGCTAGAGAAAAAAAGG - Exonic
915220827 1:154373099-154373121 CTGTTTAAAAAAAAAAAAAAAGG + Intergenic
915250468 1:154584684-154584706 TGGCTTAAAAAGAAAAAAAAAGG + Exonic
915453494 1:156023352-156023374 CTGCCTAAAAAGAAAAAAAAAGG - Intergenic
916837781 1:168566319-168566341 CTGCTCTACCAGAAAAAAAATGG + Intergenic
917987236 1:180333295-180333317 CTGGTTAAATAGAAAATAATTGG + Intronic
918036444 1:180877732-180877754 ATGCTTATCTTAAAAAAAAAAGG + Intronic
918275612 1:182951464-182951486 CTGCCTAACAAGAGAAAAAATGG + Exonic
918636561 1:186781690-186781712 CTGGCAAACTAGAAAACAAAGGG - Intergenic
918650909 1:186962117-186962139 ATTATTAAGTAGAAAAAAAAAGG - Intronic
919489757 1:198192279-198192301 CTGATCAATTAAAAAAAAAAGGG - Intronic
919614013 1:199782483-199782505 TTACTTAATTAAAAAAAAAAAGG - Intergenic
919676319 1:200386957-200386979 CTTCTTAACAATAAAAAACATGG + Intergenic
921584067 1:216927532-216927554 CTTCTGAACTAGAAAGAAAAAGG + Intronic
921843145 1:219850103-219850125 AAGCTCAACTAGAAATAAAAAGG + Intronic
922275840 1:224077461-224077483 ATTTTTCACTAGAAAAAAAAGGG + Intergenic
922284085 1:224153386-224153408 CTGGTTAAGTGGAAAAAAACCGG - Intronic
922510480 1:226162259-226162281 TTGCTTAATGAAAAAAAAAAAGG + Intronic
923174422 1:231449897-231449919 AAGCTTAATTAGAAATAAAATGG + Intergenic
923508683 1:234630006-234630028 GTGCTGAACTATAAAAGAAAGGG - Intergenic
923804197 1:237240419-237240441 ATGCTTAAGTAGAAAAACAAAGG + Intronic
923871284 1:237996638-237996660 ATGATTAAAAAGAAAAAAAAAGG - Intergenic
924077808 1:240359177-240359199 CTGATAAACTAGAAGAAACATGG - Intronic
1062900880 10:1145508-1145530 TTTCTTAACTTGAAACAAAAAGG - Intergenic
1063101736 10:2955944-2955966 CAACTTAAGTAGAAATAAAAAGG + Intergenic
1063279389 10:4608570-4608592 ATCTTTCACTAGAAAAAAAAAGG - Intergenic
1064442529 10:15366755-15366777 CTGCTTACCAAGAAAACATATGG - Intronic
1064801069 10:19072917-19072939 CTGTCTAACCAGAAAAAAAAGGG - Intronic
1064858670 10:19799999-19800021 CTGTAGAACTAGAAAAAAATGGG + Intergenic
1065190716 10:23205177-23205199 ATACTTGACTAGAAAAAGAAAGG - Intronic
1066317273 10:34260273-34260295 CTGTTTAAAAAGAAAAAAATTGG - Intronic
1066379864 10:34892078-34892100 TTGCTTAAAAAAAAAAAAAAAGG - Intergenic
1066445814 10:35481800-35481822 CTGCTCAACTAGGATATAAAAGG - Intronic
1067036107 10:42918706-42918728 CTGCATAAGAAGAAAAAAATTGG - Intergenic
1067066711 10:43108021-43108043 CTGGGTAACTTAAAAAAAAAAGG + Intronic
1067489574 10:46685702-46685724 CTGCTTAACTCCAAAATCAAGGG + Intergenic
1067605094 10:47654682-47654704 CTGCTTAACTCCAAAATCAAGGG - Intergenic
1068946003 10:62729330-62729352 CTGCTAAAAAAGAAAGAAAAAGG - Intergenic
1069312013 10:67049582-67049604 GTGTTTAACTTGAACAAAAAAGG + Intronic
1070166936 10:73906104-73906126 ATGCTTAACTAGAAGCAAAGGGG - Intergenic
1070261254 10:74858019-74858041 TTTCTTAATTAAAAAAAAAAAGG + Intronic
1070491822 10:76983720-76983742 CTGTTTAAAAAAAAAAAAAAAGG + Intronic
1070533392 10:77357218-77357240 CTGCTTAAGAACCAAAAAAATGG - Intronic
1071549329 10:86554356-86554378 CTGCTTAACTTAAGCAAAAATGG + Intergenic
1071691438 10:87824211-87824233 CTGATTAAAGAGGAAAAAAAAGG + Intronic
1071740240 10:88350134-88350156 CTTTTTAAGTAGAACAAAAAAGG - Intronic
1072204375 10:93189409-93189431 CTGCTTAAAAAAAAAAAAATTGG - Intergenic
1072587461 10:96795428-96795450 CTGCTCAACAGGAAAAAACAGGG - Intergenic
1072633344 10:97162297-97162319 TTACTTAAATAGAAAAAAATTGG - Intronic
1072918782 10:99558078-99558100 CTGGTTAAAAAAAAAAAAAAAGG - Intergenic
1074000622 10:109368498-109368520 ATGGCTAACTAGAAAAAACAGGG + Intergenic
1074766878 10:116706193-116706215 CTGCTTAAAAAAAAAAAAAGAGG - Intronic
1074972342 10:118549530-118549552 CTGTTTAACTAGAAGAGACATGG - Intergenic
1075339720 10:121636872-121636894 CTGCCTAAAAAAAAAAAAAAAGG - Intergenic
1077056115 11:594101-594123 ATGCTTAAAAAGAAAAAAAAAGG + Intronic
1077773999 11:5251507-5251529 TTGTTTTACTAAAAAAAAAAAGG + Intronic
1078781891 11:14446870-14446892 CATCTTAAAAAGAAAAAAAAAGG + Intronic
1078925541 11:15871535-15871557 CGGCTTCACTAAAAAAAAAAGGG + Intergenic
1079224589 11:18594528-18594550 CTGGTTAACAAGAAAAAAATTGG + Intergenic
1079227326 11:18618583-18618605 CTGCCTAACAAAACAAAAAAAGG - Intronic
1079974938 11:27078993-27079015 CGCTTTAACTAGAAGAAAAAGGG - Intronic
1080038624 11:27735606-27735628 CTCCCTAACTATAAATAAAATGG - Intergenic
1080112961 11:28589704-28589726 TTGTTTAAATAAAAAAAAAAAGG + Intergenic
1080192165 11:29563938-29563960 CTGCATAAATACAGAAAAAAAGG - Intergenic
1080299061 11:30763915-30763937 CTGAGAAATTAGAAAAAAAATGG + Intergenic
1080697255 11:34613269-34613291 CTGCCAAACTGGAAAGAAAATGG + Intergenic
1080835771 11:35939490-35939512 TTTCTCAACTGGAAAAAAAAAGG - Intergenic
1081581734 11:44356772-44356794 CTTCATAGCCAGAAAAAAAAAGG - Intergenic
1082791964 11:57351996-57352018 CAGCTTAAATAGAACAAATAGGG + Intronic
1083075923 11:60037637-60037659 CTGGCTAACTAGAAGAAAATTGG + Intergenic
1083972471 11:66088298-66088320 TTTCTTAAATAGAAAATAAAAGG - Intronic
1085079540 11:73622766-73622788 CTGCTTAAAAAAAAAAAAGAAGG + Intergenic
1086206138 11:84260139-84260161 TTTCTGCACTAGAAAAAAAAGGG - Intronic
1086218660 11:84414397-84414419 CTGCATAACCATAAAAGAAATGG + Intronic
1086764868 11:90683418-90683440 CTGAATAATTACAAAAAAAATGG - Intergenic
1086825750 11:91493707-91493729 TTGCTTAAATAGAAAAAAAAGGG - Intergenic
1087025848 11:93648962-93648984 ATGCTAAACTGAAAAAAAAATGG + Intergenic
1087026666 11:93656666-93656688 CTAGTTAAAAAGAAAAAAAAAGG - Intergenic
1087301205 11:96438661-96438683 CTTCTAAAAAAGAAAAAAAAAGG - Intronic
1087379640 11:97388077-97388099 CTGTTTAACTAGAAAAAGAATGG + Intergenic
1088426063 11:109704791-109704813 CTGTATATTTAGAAAAAAAATGG - Intergenic
1088698701 11:112392491-112392513 CTGCTTATTTAAAAATAAAATGG + Intergenic
1088763677 11:112956453-112956475 CTGCACAATTAAAAAAAAAAAGG + Intergenic
1088793096 11:113243729-113243751 CTGCTTGCACAGAAAAAAAATGG + Intronic
1088804818 11:113342663-113342685 CTACTAAAGAAGAAAAAAAAAGG - Intronic
1089022881 11:115235226-115235248 CTGCTTTTCTGAAAAAAAAAGGG + Intronic
1089217571 11:116844050-116844072 CTCCTTTCCCAGAAAAAAAAAGG + Intronic
1091575260 12:1727853-1727875 CTGTTTAAAAAAAAAAAAAAAGG + Intronic
1091620844 12:2087681-2087703 GTGCTTTCCTAGAAAAAAATGGG + Intronic
1092462162 12:8696962-8696984 TTTCTTAAGGAGAAAAAAAAAGG - Intronic
1092629204 12:10360576-10360598 ATGCTTACCAAGAAAAACAATGG + Intergenic
1094353791 12:29556051-29556073 CTTCTAAACTTAAAAAAAAAAGG - Intronic
1094664288 12:32502954-32502976 CTGTTGAAATAGAAAAACAAAGG - Intronic
1095176576 12:39099053-39099075 AAGCTCAACTAGAAACAAAATGG + Intergenic
1095393652 12:41739306-41739328 CTGGGTGACTAGAAAAAAACAGG + Intergenic
1095421643 12:42030530-42030552 CTGATGAGCTAAAAAAAAAAAGG - Intergenic
1096311869 12:50528427-50528449 CTGCTTTCCAAAAAAAAAAAAGG + Intronic
1096326980 12:50672115-50672137 CTGATTGTCAAGAAAAAAAAGGG - Intronic
1096332322 12:50724760-50724782 TTGCTGACCTAGAAAACAAATGG - Exonic
1096381964 12:51166391-51166413 CTGCCTCAAAAGAAAAAAAAAGG + Intronic
1096632257 12:52935524-52935546 CTACTTAAAAAAAAAAAAAAAGG + Intronic
1097651575 12:62304825-62304847 ATGCTTAAAAAAAAAAAAAAAGG + Intronic
1097984622 12:65770357-65770379 GTGCATAACTAGAAAAGAGAAGG - Intergenic
1098209255 12:68145762-68145784 CACCAAAACTAGAAAAAAAAAGG - Intergenic
1099664914 12:85615918-85615940 CTGGTTATTTAGAAATAAAATGG + Intergenic
1100637362 12:96447777-96447799 CTAATTAAGTAAAAAAAAAAGGG - Intergenic
1100861939 12:98815670-98815692 CTGAGGAACTGGAAAAAAAATGG - Intronic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1101446631 12:104741462-104741484 CTGCTTGACTAAGAAATAAATGG + Intronic
1101715608 12:107309380-107309402 CTGTTTAAAAAAAAAAAAAATGG - Intergenic
1101894597 12:108746495-108746517 CTGATTAAATATAAAAAAATCGG + Intergenic
1102348831 12:112177218-112177240 TTGTTTAACCAGAAAAATAAAGG - Intronic
1102356657 12:112242607-112242629 CTGCTTAAAAAAAAAAAAAAAGG + Intronic
1102540567 12:113616330-113616352 CTGCTTTCCTAGAAAAGAACTGG + Intergenic
1103645690 12:122390729-122390751 GTTCTTGACTTGAAAAAAAATGG - Intronic
1103660184 12:122508248-122508270 TTGCTGAACAAGAGAAAAAAAGG - Exonic
1104117264 12:125761518-125761540 ATAATCAACTAGAAAAAAAATGG - Intergenic
1105752447 13:23433751-23433773 CTCTTTAAGAAGAAAAAAAAAGG - Intergenic
1106264089 13:28094403-28094425 CTGTTTAACCTAAAAAAAAATGG + Intronic
1106368752 13:29110536-29110558 ATTCTTTACAAGAAAAAAAATGG + Intronic
1107183434 13:37488901-37488923 CTGAGACACTAGAAAAAAAATGG + Intergenic
1107345733 13:39458688-39458710 CTGCCTAAAAAAAAAAAAAAAGG + Intronic
1107879015 13:44817031-44817053 CTGATTAACTGGAATAAAACAGG + Intergenic
1108224014 13:48269130-48269152 CTGTGCAACTGGAAAAAAAAAGG - Exonic
1108742332 13:53350825-53350847 CTTCATAAAAAGAAAAAAAATGG + Intergenic
1108747768 13:53412512-53412534 CTGGTTAACTAGATAAATAGGGG + Intergenic
1109244721 13:59939778-59939800 TTGTTTAACTAGAAAATAAAAGG - Intronic
1109550324 13:63888192-63888214 CTGGATAAATAGAAAATAAATGG + Intergenic
1109625288 13:64966053-64966075 AAGCTAAACTAGAAACAAAATGG + Intergenic
1109660644 13:65455417-65455439 ATGTTTAAATAGAAAATAAAGGG + Intergenic
1110112970 13:71773970-71773992 CTGTTTAAAAAAAAAAAAAAAGG + Intronic
1110198991 13:72826279-72826301 TTTGTTAACTAGAAGAAAAAAGG + Intronic
1110246334 13:73328479-73328501 CTGCTTTACAAAAGAAAAAAAGG + Intergenic
1110287411 13:73765872-73765894 CTTATTTACAAGAAAAAAAATGG + Intronic
1110629221 13:77687212-77687234 TTGAATAACTACAAAAAAAAAGG + Intergenic
1110675381 13:78236951-78236973 CTGAGAAACTAAAAAAAAAATGG - Intergenic
1110927633 13:81175061-81175083 CTACATAACTGGAAAAAAGAGGG + Intergenic
1111849644 13:93556215-93556237 CTTATGAACTAGAAAATAAATGG - Intronic
1112537148 13:100270572-100270594 CTACTTATTTAGAGAAAAAAAGG + Intronic
1112986136 13:105452278-105452300 TTGAGTAACTGGAAAAAAAAAGG + Intergenic
1113514398 13:110881464-110881486 TTGCTTAAATATAAAAAAAAAGG - Intronic
1114412416 14:22513565-22513587 TTGCTGTACTAGAAATAAAAAGG - Intergenic
1115140622 14:30167297-30167319 CTGTATTACTAGAAAAAAAATGG - Intronic
1115386945 14:32808679-32808701 CTGCTCAGAAAGAAAAAAAACGG - Intronic
1115718928 14:36138089-36138111 CTGCTAAATTAGAAAAACCAAGG + Intergenic
1115784280 14:36806809-36806831 CTCTTTAGCTAGAAAAAAAGGGG - Intronic
1116294419 14:43088064-43088086 CTGCTTAACTTTAAATATAATGG - Intergenic
1116357278 14:43945250-43945272 TTGCTTAGATAGAAAAAAAAGGG + Intergenic
1116455668 14:45118296-45118318 TTTCTTCAATAGAAAAAAAAGGG + Intronic
1117394545 14:55296110-55296132 TTGGTTAACTTTAAAAAAAAGGG - Intronic
1117813454 14:59573169-59573191 ATGCTTAGGTATAAAAAAAATGG + Intronic
1118021969 14:61726199-61726221 CTGCTTTACTAGATAAATTAAGG + Intronic
1118118926 14:62814266-62814288 CTGCCTAACAAGTTAAAAAATGG - Intronic
1118286000 14:64473589-64473611 ATTCTTAACTATAAAAAATAAGG - Exonic
1118290483 14:64516950-64516972 CTGCTCATCTAGATAAGAAAGGG + Intronic
1118404261 14:65408187-65408209 CGGCTTAACTTCCAAAAAAAAGG - Intergenic
1119970840 14:78968353-78968375 TAGCTTAACAAGAAAAAAATAGG - Intronic
1120871894 14:89345350-89345372 CTGCTTTAAAAAAAAAAAAAAGG + Intronic
1121543424 14:94745751-94745773 TTGCTTAAAAAAAAAAAAAAGGG + Intergenic
1121771074 14:96540412-96540434 CTGGTTAAAAAAAAAAAAAAAGG - Intronic
1121833601 14:97072615-97072637 CTGCTGATCTGGAAAGAAAATGG - Intergenic
1123860681 15:24463152-24463174 CTACTAAAATACAAAAAAAATGG + Intergenic
1124806915 15:32893455-32893477 CTGCTTAATTAGAGTTAAAAAGG + Intronic
1125116018 15:36092672-36092694 GTGATTAACAAGGAAAAAAAAGG - Intergenic
1125126519 15:36229390-36229412 ATATTTAACAAGAAAAAAAATGG - Intergenic
1126056731 15:44736720-44736742 CTGCTAAGTTAAAAAAAAAAAGG - Intronic
1126546836 15:49883143-49883165 CTGCTTTAAAAAAAAAAAAATGG - Intronic
1127099861 15:55553398-55553420 CTTCTTAAAAAAAAAAAAAAAGG - Intronic
1127221475 15:56885594-56885616 TTCCTTTAGTAGAAAAAAAAAGG - Intronic
1127360634 15:58241988-58242010 CTGCTGACCTAGAAAGAAGAGGG + Intronic
1127453029 15:59134926-59134948 CTTTTTAATTAGGAAAAAAAGGG + Exonic
1128694174 15:69747940-69747962 CTGCTTGAAAAGAAAAAAGATGG - Intergenic
1129094327 15:73187199-73187221 GAGCTTAACTAGAAAAATAATGG - Intronic
1129554797 15:76496226-76496248 CTTTTTAATTAAAAAAAAAAAGG - Intronic
1130372379 15:83296030-83296052 CTGTTTAAAAAAAAAAAAAAAGG - Intergenic
1130372634 15:83298735-83298757 CTGATAAACTAAAAAAAAAAAGG + Intergenic
1130808376 15:87351218-87351240 CTACTTAACCAGAAAATAAAAGG + Intergenic
1131027837 15:89159858-89159880 CAGGTGACCTAGAAAAAAAATGG + Intronic
1132364036 15:101243044-101243066 CAGCTTAATTAAGAAAAAAAAGG - Intronic
1133519307 16:6541945-6541967 CTCTTTAATTAAAAAAAAAAAGG - Intronic
1133952865 16:10411878-10411900 AAGCTCAACTAGAAACAAAATGG - Intronic
1134870922 16:17651832-17651854 CAGATTTACTACAAAAAAAATGG - Intergenic
1135963340 16:27015749-27015771 CAGCTTAACTGGAAAATGAATGG + Intergenic
1136644636 16:31600904-31600926 TTCCTTAAGTAGAAAAAAACTGG - Intergenic
1136660534 16:31756369-31756391 CTCCTTAAGTAGAAAAACACTGG + Intronic
1137069535 16:35889710-35889732 TTGGTTAACTAGAAATAAAAAGG + Intergenic
1138138993 16:54550281-54550303 CTGGTTAACTAGGGACAAAAAGG + Intergenic
1138752166 16:59436451-59436473 TTTTTTAACTAGAAGAAAAAAGG - Intergenic
1139094042 16:63683633-63683655 CTTCCTAAATAAAAAAAAAAAGG + Intergenic
1139870193 16:70101909-70101931 TCTCTTAACAAGAAAAAAAAAGG + Intergenic
1139997519 16:70994932-70994954 CTGCATAAAGAGAAAACAAATGG + Intronic
1141811056 16:86376313-86376335 TTGCTAAATTAAAAAAAAAAAGG + Intergenic
1144502978 17:15805764-15805786 CTGCTTCAGTGGAAAAAAATAGG - Intergenic
1145165164 17:20608466-20608488 CTGCTTCAGTGGAAAAAAATAGG - Intergenic
1146123788 17:30216675-30216697 CTGTCTCACTAAAAAAAAAAAGG - Intronic
1147292068 17:39451466-39451488 CTGCTAAAATAAAAAAAAAATGG - Intergenic
1147908454 17:43839322-43839344 CTGTTTAAAAAAAAAAAAAAAGG + Intergenic
1148362209 17:47020977-47020999 TTTGTTAAATAGAAAAAAAATGG + Intronic
1149164632 17:53736572-53736594 CTACTTAAAAAAAAAAAAAAAGG + Intergenic
1149299348 17:55289901-55289923 CAGCCTAGTTAGAAAAAAAAAGG + Intronic
1149742886 17:59064398-59064420 CTAATTCACTAAAAAAAAAAAGG + Exonic
1150036217 17:61801758-61801780 CAGTTTAATCAGAAAAAAAAAGG - Intronic
1150149574 17:62798186-62798208 CTTGTGAACTAGAAAAAAATTGG + Intronic
1150615767 17:66769996-66770018 CTGCTTATCCAGAAAAACCAGGG - Intronic
1151151579 17:72092433-72092455 CTGTTTAAAAAAAAAAAAAAAGG + Intergenic
1151386611 17:73759001-73759023 CTGCCTAAAAAAAAAAAAAAAGG + Intergenic
1152686817 17:81697998-81698020 CTGGCTAATTAAAAAAAAAAGGG + Intronic
1153795759 18:8620558-8620580 CTGATTAGTTAAAAAAAAAAAGG - Intronic
1153846289 18:9052482-9052504 CTTCTTAACCATAAAAACAATGG + Intergenic
1154036672 18:10809979-10810001 CTGCTTATTTGGAAATAAAAAGG + Intronic
1155062388 18:22240366-22240388 CTGTATCACTAAAAAAAAAATGG - Intergenic
1156661750 18:39354255-39354277 AAGCTAAACAAGAAAAAAAATGG + Intergenic
1158552051 18:58444509-58444531 CTCTTTGACAAGAAAAAAAAAGG + Intergenic
1158856321 18:61546012-61546034 TTGCTTCAAAAGAAAAAAAAAGG + Intronic
1159226359 18:65542539-65542561 CAGCTTAAGAAGAAAGAAAAAGG - Intergenic
1159696282 18:71560618-71560640 CTGCCTCAACAGAAAAAAAATGG + Intergenic
1160220702 18:76975515-76975537 CTGCTTAAAAAAAAAAAAAAAGG - Intergenic
1161674991 19:5641169-5641191 ATGCTTAAAAAGAAAAAAGAAGG - Intronic
1162232239 19:9277095-9277117 CTGCTTAAAAAAAAAAAAAAAGG - Intergenic
1162646208 19:12052406-12052428 ATTTTTAACTGGAAAAAAAAAGG + Intronic
1164184158 19:22847255-22847277 ATACTTAATTAAAAAAAAAAAGG - Intergenic
1164455701 19:28404821-28404843 CTGCTTAGGAAGAAAAGAAAAGG + Intergenic
1164569328 19:29359804-29359826 TAGCTTAACTAAGAAAAAAAGGG + Intergenic
1164620088 19:29690282-29690304 CTGTTTAAAAAAAAAAAAAAAGG + Intergenic
1164755741 19:30688013-30688035 CTGCTAAAAAAAAAAAAAAAAGG + Intronic
1164884140 19:31762358-31762380 CTTCTCATCTAGAAAAATAAGGG - Intergenic
1165084423 19:33333725-33333747 TTTCTTAAATAAAAAAAAAAAGG + Intergenic
1167570358 19:50283577-50283599 ATCCATAACTAGAAAAAAACTGG - Intronic
1168006571 19:53494699-53494721 CTGCTAAAATTGAAACAAAAAGG + Exonic
1168198741 19:54797315-54797337 CTGTTTAGCTGGAAAAAGAAGGG - Intronic
1202707906 1_KI270713v1_random:37181-37203 TTGCTTAGCTAGAGAAAAAAAGG - Intergenic
925564259 2:5232643-5232665 CTGCTTATATAAAAACAAAAAGG + Intergenic
925750428 2:7085269-7085291 CTGGTTAAAAAAAAAAAAAAAGG - Intergenic
925826738 2:7856932-7856954 TTCCTTAACTAGAACACAAAAGG + Intergenic
927498329 2:23565226-23565248 CTACTGAAGAAGAAAAAAAAAGG - Intronic
928144125 2:28756440-28756462 CTGTTTCACAAGAAAGAAAAGGG - Intronic
928926311 2:36583228-36583250 CTGTATAACCAGAAAAAAATAGG + Intronic
929369031 2:41198880-41198902 CAGCTAAACTATAAACAAAATGG - Intergenic
929517824 2:42620792-42620814 CTGGTTAACTCGAGAAAACATGG + Intronic
929846222 2:45531128-45531150 CTGCTTTCCTTGAAAAGAAAAGG + Intronic
929887403 2:45891335-45891357 TTGCATAACTAAAAAAGAAATGG + Intronic
930074085 2:47392344-47392366 CTACTAAAATACAAAAAAAATGG - Intergenic
930504139 2:52261046-52261068 CTGCTTAACAAAACAAACAAAGG - Intergenic
931942425 2:67267342-67267364 TTGCTTAACTGGCAGAAAAATGG + Intergenic
932811818 2:74832611-74832633 CTGCTTTAAAAAAAAAAAAAAGG + Intergenic
932992801 2:76808888-76808910 CTGCTAAAATGGAAAAGAAATGG - Intronic
934055710 2:88249926-88249948 ATGCTTTCCTAGAAAAATAAAGG + Intergenic
934515971 2:94986891-94986913 TTGCTTATTTAAAAAAAAAAAGG + Intergenic
934612870 2:95753762-95753784 CTGCTCAATTAAAAAAAAAGTGG - Intergenic
934841411 2:97626483-97626505 CTGCTCAACTGAAAAAAAAGTGG + Intergenic
935175580 2:100645987-100646009 CAGCTTGACCAGAAAAAAACAGG + Intergenic
935228860 2:101078706-101078728 CTTCATAACAAAAAAAAAAAAGG + Intronic
936374612 2:111929953-111929975 TTGCTTAAATAGAAAACAAAAGG - Intronic
936825710 2:116578599-116578621 CAGCTTCAATAAAAAAAAAATGG - Intergenic
937513022 2:122620072-122620094 TTTCTTATTTAGAAAAAAAAAGG - Intergenic
937635954 2:124155522-124155544 CTGCTTTACTAGGAAAAAATAGG + Intronic
938072062 2:128313935-128313957 TTGCTTAAAAAAAAAAAAAAAGG + Intronic
940047523 2:149425062-149425084 CAGCTTATCTGGAAGAAAAAAGG - Intronic
940373953 2:152935389-152935411 TTGCTATACTAGAAAAGAAATGG - Intergenic
941351566 2:164443550-164443572 CTTCTTAACTGAAAAAAAATAGG + Intergenic
941613155 2:167685922-167685944 CTGCTTTACTTAAATAAAAAAGG + Intergenic
941835410 2:170012352-170012374 ATGCTTAAAAAGAAAAAAAATGG - Intronic
941839791 2:170068732-170068754 CTGATTGATAAGAAAAAAAAAGG + Intronic
942256468 2:174105176-174105198 TTGTTGAAATAGAAAAAAAAAGG + Intronic
942593454 2:177570002-177570024 CTGTTTAAATAGAAAGAATAGGG + Intergenic
942608791 2:177719867-177719889 CATCTTAACAACAAAAAAAAAGG + Intronic
942740700 2:179174274-179174296 CTGTTTGACTAGAAGTAAAAAGG + Intronic
942764281 2:179435463-179435485 TTGGTGAACTGGAAAAAAAAAGG - Intergenic
943402079 2:187426110-187426132 CTCATTATATAGAAAAAAAAAGG + Intronic
943679954 2:190758026-190758048 CTTCTTAACTGTAAGAAAAATGG - Intergenic
943715419 2:191146750-191146772 CTGCCTCCCTAAAAAAAAAAAGG + Exonic
945096520 2:206224361-206224383 CTGTTTTAATTGAAAAAAAAAGG - Intergenic
945230374 2:207582564-207582586 GTGCTTAAAAAGAAAAAAATGGG - Intronic
945438275 2:209845082-209845104 CTTCTTAAAAAAAAAAAAAAAGG + Intronic
945767239 2:213996125-213996147 CTGCTTCACTGGAAAAAATAGGG + Intronic
946122304 2:217526793-217526815 CTTCTTAGGTAGAAAAATAAGGG - Intronic
947500908 2:230670195-230670217 TTGCATGACTAGAAAAATAAGGG + Intergenic
947607262 2:231495729-231495751 CATCTTTACTATAAAAAAAAGGG + Intergenic
947784848 2:232807736-232807758 CTCTTTAAAAAGAAAAAAAAAGG - Intronic
948371464 2:237492224-237492246 CTGATGAACTTCAAAAAAAAAGG + Intronic
1169634395 20:7672183-7672205 CTGTTTAAAAAAAAAAAAAAAGG - Intergenic
1170506671 20:17033378-17033400 AAACTTAACTAGGAAAAAAAGGG - Intergenic
1170871347 20:20209590-20209612 CAGCTCAATTAGAAAAAAATAGG - Intronic
1170946763 20:20898214-20898236 GTTCCTAACTAGAAAAAGAAAGG - Intergenic
1171765439 20:29265935-29265957 CTACTCAATTAAAAAAAAAAAGG - Intergenic
1172709155 20:36907090-36907112 CTCCTTAAAAAAAAAAAAAAAGG - Intronic
1174116349 20:48229142-48229164 CTGCTTCTCTAGAAAAACGAGGG - Intergenic
1177320184 21:19511037-19511059 CTGCTTAGTTAAGAAAAAAATGG - Intergenic
1177379384 21:20319285-20319307 CTGCTAAACAAGTAAAAAGAGGG + Intergenic
1177579089 21:22995975-22995997 AAGCTCAATTAGAAAAAAAATGG + Intergenic
1178181942 21:30171601-30171623 CTGCTTAAAAACAAAACAAAAGG + Intergenic
1178763162 21:35423330-35423352 CTTTTTAAAAAGAAAAAAAATGG + Intronic
1178967738 21:37139196-37139218 CTGTTTTCCTAGAAAAACAAAGG + Intronic
1179064335 21:38010314-38010336 CTGCTTAGCTACAACAAAAGTGG - Intronic
1179196690 21:39170822-39170844 CACCTTAATTAAAAAAAAAAGGG + Intergenic
1179511088 21:41874150-41874172 TTGCTTAATTTAAAAAAAAAAGG + Intronic
1179608242 21:42532220-42532242 CTGCTTATTTATGAAAAAAAGGG + Intronic
1183200285 22:36381169-36381191 TTTCTTAACTATAAAAATAAGGG - Intronic
1183519886 22:38290849-38290871 CTCTTTAATTAAAAAAAAAAAGG + Exonic
1184268529 22:43363988-43364010 CTGCTCACTTAAAAAAAAAAGGG + Intergenic
949181836 3:1141240-1141262 CTGGTCAACTAAAAACAAAAGGG + Intronic
949275294 3:2272809-2272831 GTGGTTAAATAAAAAAAAAAAGG - Intronic
949719889 3:6976671-6976693 CAGCCTAACTGAAAAAAAAATGG + Intronic
950817012 3:15715865-15715887 TTGTTCAACCAGAAAAAAAAAGG + Intronic
951176576 3:19608040-19608062 ATGCTTAAAAAAAAAAAAAAAGG + Intergenic
951464059 3:22982921-22982943 CTGCTCCACTTAAAAAAAAATGG - Intergenic
951535810 3:23739615-23739637 CTGTTTAAAAAAAAAAAAAAGGG + Intergenic
951761630 3:26153433-26153455 TTGCTTAAGAAGAAAATAAAAGG + Intergenic
952050561 3:29379340-29379362 TAGAGTAACTAGAAAAAAAATGG + Intronic
952348360 3:32509884-32509906 CTGTTTAAAAAAAAAAAAAAAGG + Intergenic
952539220 3:34349590-34349612 TTGCTTAACTAGTAAGATAAGGG - Intergenic
953395012 3:42561983-42562005 CTGATTAACTCAAAAAAAAAGGG + Intronic
954319637 3:49822977-49822999 CTATTTAAAAAGAAAAAAAAAGG + Intergenic
955424437 3:58773016-58773038 CTGCTTTAAGAAAAAAAAAAAGG - Intronic
955510570 3:59676565-59676587 CTGATGAGCTAAAAAAAAAATGG + Intergenic
956292560 3:67676720-67676742 CTCCTGACCTAGATAAAAAATGG + Intergenic
956590315 3:70907701-70907723 CTGCTTAGCTACGAAAACAAAGG - Intergenic
957169228 3:76716281-76716303 CTGCTTAACTACAATAAAACTGG + Intronic
957258533 3:77870443-77870465 CTGCTAAACCACAAAAAAATAGG + Intergenic
957697704 3:83663406-83663428 ATGCTCAATTAGACAAAAAATGG - Intergenic
957773674 3:84727923-84727945 CTATTTAAAGAGAAAAAAAATGG + Intergenic
957945144 3:87053837-87053859 ATGCTTAGCTAGAAATAACATGG - Intergenic
958186567 3:90128298-90128320 TTGCTTAACAACAATAAAAATGG - Intergenic
958439995 3:94145010-94145032 CTTCTTAACTACAAACAAGAGGG - Intergenic
958645185 3:96861383-96861405 TATCTTAAATAGAAAAAAAAGGG - Intronic
959040189 3:101413655-101413677 CTGTTTAGCAAGAAAAAGAAAGG + Intronic
959203735 3:103279914-103279936 CTCCTGAAGTAGAAAAATAAGGG + Intergenic
959236374 3:103727722-103727744 AAGCCTAACTAGAAATAAAACGG - Intergenic
959302465 3:104620485-104620507 CTATTTTACTGGAAAAAAAAAGG + Intergenic
959435948 3:106315305-106315327 CAGACTAACTAGGAAAAAAAGGG - Intergenic
959508251 3:107178341-107178363 GGGCTTAAGAAGAAAAAAAATGG - Intergenic
959722035 3:109502700-109502722 AAGCTTAATTAGAAACAAAAAGG - Intergenic
960331609 3:116366751-116366773 CTGCTTTACTACAATAAAAGTGG + Intronic
960426946 3:117520437-117520459 CTCCTTAAAGAGAAAATAAAAGG + Intergenic
960625082 3:119674383-119674405 CTTTTTAATTAAAAAAAAAATGG + Intronic
961638983 3:128352981-128353003 CTCCATAACTGGAAAAAAATGGG - Intronic
962231714 3:133671472-133671494 CTGCCTTAAAAGAAAAAAAAAGG + Intergenic
962939427 3:140112152-140112174 CTGCTTAAGAAGACAAGAAAGGG + Intronic
963822544 3:149914183-149914205 GTGCTTAATAATAAAAAAAAGGG - Intronic
964363242 3:155920865-155920887 CTGCTTTACTACAACAGAAAAGG - Intronic
964517637 3:157530204-157530226 GTGCTTAAAAAAAAAAAAAAAGG + Intronic
964980641 3:162672854-162672876 CTGCTAGACTACAGAAAAAAGGG - Intergenic
965166748 3:165203792-165203814 CTACTTAGCAGGAAAAAAAATGG - Intergenic
965249214 3:166320299-166320321 CTGTTTAACTATAAAGGAAAAGG + Intergenic
965482444 3:169235864-169235886 TTGCTTAAAAAAAAAAAAAAAGG + Intronic
965935204 3:174100808-174100830 CTGGTGAACTAGAAAAAAAATGG - Intronic
966013206 3:175107947-175107969 ATTCTTATCTATAAAAAAAATGG + Intronic
966570551 3:181438277-181438299 CTCCTTAACAACAAAAAAAGTGG + Intergenic
966799197 3:183746656-183746678 CTGCTAAAAAAAAAAAAAAAAGG - Intronic
967298649 3:187990420-187990442 ATGGATAACAAGAAAAAAAAAGG + Intergenic
967485672 3:190027623-190027645 TTGCTTAAAAAAAAAAAAAAAGG - Intronic
970018588 4:11540729-11540751 CTGATGAACTAAAAAAAAAAAGG + Intergenic
970086756 4:12356476-12356498 ATGATTAAATAGAAAATAAATGG + Intergenic
970337619 4:15066398-15066420 CTGTTTAACAAGGAAAGAAAGGG + Exonic
971090565 4:23339113-23339135 ATGCTTAATTACAAACAAAAAGG + Intergenic
971173950 4:24262702-24262724 CTGCTTAACTTGAGAAGTAAAGG - Intergenic
971298091 4:25418140-25418162 GAGCTTAACTAAAAAAGAAAAGG - Exonic
971512209 4:27440746-27440768 GTGCTCACCTAGAAGAAAAATGG - Intergenic
972306447 4:37834827-37834849 TTGCTTAACTGTAAAAACAATGG + Intronic
973070527 4:45852592-45852614 CTGCATACCTAGAAAACCAAAGG - Intergenic
973136274 4:46710689-46710711 TTATTTAACTAGAAAAAAATAGG - Intergenic
973291602 4:48476713-48476735 CTTCTTAACTAGAGAGGAAAGGG + Intergenic
974506002 4:62772787-62772809 CTACTTGGCCAGAAAAAAAATGG + Intergenic
975046793 4:69814861-69814883 CTTCTTAACTATAAAATCAAGGG + Intronic
975510038 4:75184190-75184212 AAGCTCAACTAGAAACAAAATGG + Intergenic
976007935 4:80453189-80453211 TTCCTTAAATATAAAAAAAAGGG - Intronic
976099003 4:81540449-81540471 TTTCTTAAATAAAAAAAAAAAGG + Intronic
976263015 4:83163918-83163940 TTATTTAAATAGAAAAAAAAAGG - Intergenic
976346671 4:84011017-84011039 CTGCTTAAGTTGAATAAAAGGGG + Intergenic
976749186 4:88437059-88437081 CTGCCTCAATAAAAAAAAAAAGG - Intronic
976829466 4:89298075-89298097 TTTCTTAAATAGGAAAAAAATGG + Intronic
976942721 4:90725887-90725909 CTAGGTAACTAGAAAATAAAAGG + Intronic
977248612 4:94663349-94663371 CAGCTTTATTAGAAAAGAAAAGG - Intronic
979557881 4:122071425-122071447 TTCCTTAACTACAAAAACAATGG - Intergenic
979857102 4:125647725-125647747 CTTTTTAAACAGAAAAAAAATGG + Intergenic
980181994 4:129412691-129412713 CTGCTGAACTAAAAGAAGAAGGG - Intergenic
980425719 4:132625504-132625526 CTGCTTCACAAAAAAAATAAAGG - Intergenic
980551750 4:134345508-134345530 CTGATTAACTTGAAATAAAGAGG + Intergenic
981324676 4:143432165-143432187 CTGTCTAACTCGAAAAAAGAAGG + Intronic
982130772 4:152227023-152227045 CTGCTTATCTATAAAATAGAGGG - Intergenic
982450833 4:155550658-155550680 TTGTTTAAAGAGAAAAAAAAAGG - Intergenic
982980993 4:162134858-162134880 CTACTTAACAAGAGAAGAAAAGG - Intronic
983257855 4:165422386-165422408 CTGCTTAAATATAAAAATAAAGG - Intronic
984531578 4:180922877-180922899 CTGCTTTACAGGAAAAATAAAGG + Intergenic
984549182 4:181140485-181140507 CTACTTAAAAAGAGAAAAAATGG - Intergenic
984637570 4:182128232-182128254 ATGCCTACATAGAAAAAAAAAGG - Intergenic
985037276 4:185853135-185853157 ATCCTTAACTTGAAGAAAAAGGG + Intronic
985341852 4:188962669-188962691 CTAATAAACTAGAAGAAAAATGG + Intergenic
985526129 5:402853-402875 CTGTTCAACCAGAAAAAGAAGGG + Intronic
986386531 5:7239625-7239647 ATGTTTAACTAAAAAATAAATGG - Intergenic
987107544 5:14655307-14655329 CTGCTTAACGAAATAACAAAAGG - Intergenic
987244020 5:16029944-16029966 CTGCTAAAATAGAAAACAGATGG - Intergenic
987504899 5:18754993-18755015 TTGGTTAACTAATAAAAAAAAGG + Intergenic
987617256 5:20292345-20292367 CTGCTGAAGTAGAGAAATAAAGG + Intronic
987874652 5:23665583-23665605 TTGCTGAAATGGAAAAAAAACGG + Intergenic
988312897 5:29584346-29584368 CTGCTCAAAAAAAAAAAAAAAGG + Intergenic
988403213 5:30789846-30789868 CTGATCAACTACAATAAAAATGG - Intergenic
988422888 5:31027755-31027777 CTACCTAACAAGAAAAAAAAGGG + Intergenic
990043760 5:51403069-51403091 CTGCTCAAAAAAAAAAAAAAAGG + Intergenic
990340796 5:54821134-54821156 GTGCTGAGCTAGAAATAAAAGGG + Intergenic
990425955 5:55689137-55689159 CTACTGAAGTAGAAAAAATAAGG + Intronic
990690261 5:58355789-58355811 TTGCTTCAATAAAAAAAAAAAGG - Intergenic
991000001 5:61773058-61773080 CTGATTAACAAGACAAAATAGGG - Intergenic
991122737 5:63034243-63034265 CTTCTTAAAGAGAAAAAAAGAGG - Intergenic
992356905 5:75995081-75995103 GGGCCTAAATAGAAAAAAAAAGG - Intergenic
992492806 5:77261495-77261517 GTGATTAATTAGAAACAAAATGG - Intronic
992966648 5:82009288-82009310 TACCTTAACGAGAAAAAAAATGG - Intronic
993270003 5:85784745-85784767 GTGCTTTATTACAAAAAAAAAGG - Intergenic
993446566 5:88019972-88019994 ATTATTTACTAGAAAAAAAATGG + Intergenic
993469411 5:88288560-88288582 CTGCCCAAATAGAACAAAAAGGG - Intergenic
993515082 5:88822088-88822110 ATGCTTTATTAGAAAAAACAGGG - Intronic
993865827 5:93194006-93194028 CTGATTAATGAGACAAAAAAGGG - Intergenic
994473943 5:100243475-100243497 CTGCTTAGTCAGAAAAAAAAGGG + Intergenic
994719055 5:103359655-103359677 CTTCTTATGTAGAAAAAGAATGG - Intergenic
994880926 5:105494667-105494689 CTACTCAACTACAACAAAAAGGG - Intergenic
995062446 5:107825632-107825654 ATGTTTGGCTAGAAAAAAAAAGG - Intergenic
995101905 5:108321450-108321472 CTGTTTCACATGAAAAAAAATGG + Intronic
996228564 5:121032652-121032674 CTACTTAAAAAAAAAAAAAAAGG + Intergenic
996239245 5:121174056-121174078 TGGCTTAAAAAGAAAAAAAAAGG + Intergenic
996437203 5:123447868-123447890 CTGCTTAATTAAAAACAATATGG - Intergenic
996486071 5:124036147-124036169 CTGCTTCACTAGAATATACAGGG - Intergenic
996756153 5:126937329-126937351 CTTGTTAAAAAGAAAAAAAAAGG - Intronic
996862417 5:128082543-128082565 CTGCTTATATAGAAACAGAAAGG - Intergenic
996881584 5:128303120-128303142 ATTTTTAACTAGAAAAAAATGGG + Intronic
997020796 5:129999326-129999348 CTGCATAACTGCAAATAAAAAGG - Intronic
998055502 5:139073345-139073367 CTGTTTAACCATAAAAAATAAGG + Intronic
998194023 5:140051035-140051057 CTGCTTTATTTAAAAAAAAAAGG + Intergenic
998817261 5:146027122-146027144 CTGCTTATCAAGAAAGCAAAGGG - Intronic
999387901 5:151168276-151168298 CTGTTCAAAAAGAAAAAAAAAGG + Intergenic
1000115183 5:158147506-158147528 CTGCTTAACTTAATAAACAAGGG - Intergenic
1000302813 5:159971625-159971647 CTGTTTAACTAGATCAAGAAAGG + Intronic
1000525866 5:162356858-162356880 CTCCTTAAAAAAAAAAAAAAAGG - Intergenic
1000646376 5:163765165-163765187 CTGCTAGACTCGAATAAAAAAGG - Intergenic
1000862898 5:166477454-166477476 TTACTGTACTAGAAAAAAAAAGG + Intergenic
1000881911 5:166707772-166707794 GTTCTTAGCAAGAAAAAAAATGG + Intergenic
1001615178 5:173037510-173037532 TTGCTTAAAAAAAAAAAAAAAGG - Intergenic
1002759593 6:191416-191438 CTGGTTCACTAGAACAGAAAAGG + Intergenic
1002861045 6:1079884-1079906 CTGATTAAATACAATAAAAAAGG + Intergenic
1003007701 6:2397198-2397220 CTGGTAAACAAGAGAAAAAAAGG - Intergenic
1003349945 6:5306932-5306954 CTGAAAAACTAAAAAAAAAATGG + Intronic
1003934547 6:10961795-10961817 CTGCTTAAAAATAAAAAAATTGG - Intronic
1004204653 6:13580959-13580981 CTTCACAACAAGAAAAAAAAGGG - Intronic
1004545606 6:16595635-16595657 CTGGTTAACTACAAAAAGCAAGG + Intronic
1004648149 6:17582494-17582516 CTGCTTGGTTAAAAAAAAAAAGG - Intergenic
1005346136 6:24892537-24892559 CCAGTGAACTAGAAAAAAAATGG - Intronic
1005986642 6:30880132-30880154 CTGCCTAAAAAAAAAAAAAAAGG - Intronic
1006876036 6:37297342-37297364 CTGCTTGGCCAGAAAAACAAGGG - Intronic
1007559869 6:42798390-42798412 TTTTTTAATTAGAAAAAAAAAGG + Intronic
1007649767 6:43412129-43412151 CAGCCTAATTAAAAAAAAAAAGG + Intergenic
1007837126 6:44682370-44682392 CTGGTTTCCTAGAAAAAAAAGGG + Intergenic
1007862670 6:44929768-44929790 CTGCTAAAAAAAAAAAAAAAAGG - Intronic
1007910676 6:45511185-45511207 CTGCTTATATACAGAAAAAAAGG - Intronic
1008248732 6:49210770-49210792 CTCCTTAATTAGAAAAGGAATGG - Intergenic
1008693310 6:54005273-54005295 CTGCTTAAATGAAAAAAGAATGG - Intronic
1009025192 6:57991070-57991092 ACCCTTAACAAGAAAAAAAATGG - Intergenic
1009200765 6:60742522-60742544 ACCCTTAACAAGAAAAAAAATGG - Intergenic
1009288062 6:61847612-61847634 CTGCTTAGCTATATAAAACAGGG + Intronic
1009500228 6:64403815-64403837 CTGCTTATGTAGAGAAATAAAGG + Intronic
1009809651 6:68644393-68644415 ATGCCCATCTAGAAAAAAAATGG + Intronic
1009890959 6:69681339-69681361 CTGTTAAATTACAAAAAAAATGG - Intronic
1011297894 6:85843212-85843234 CTGCTAAACTAAATAAAAAGAGG - Intergenic
1012242828 6:96893372-96893394 CTCCTTAGCAAGAAAAATAAGGG + Intronic
1012519876 6:100108788-100108810 GTGCTTAAATACAAAAAAGAAGG + Intergenic
1012727010 6:102826164-102826186 CTGCATAACTAAAAAAGGAAAGG - Intergenic
1012896062 6:104950897-104950919 CTGCTGAACTAAATTAAAAATGG + Intergenic
1012971928 6:105740428-105740450 CTGCTTAACAAAATAAAAAATGG - Intergenic
1013172591 6:107650067-107650089 CTGATTAACAAGTAAAATAAGGG + Intronic
1013860075 6:114625293-114625315 CTCCATAACCACAAAAAAAAAGG + Intergenic
1014028754 6:116678144-116678166 CTGCTTAAGTAAAAAGAAATTGG + Intergenic
1014090372 6:117397775-117397797 CTACTTAAGTGGAAAAAGAAAGG + Intronic
1014771615 6:125464206-125464228 GTGCTTAAGTAGAGAAAGAATGG + Intergenic
1015013347 6:128377762-128377784 GTTCTTAACTACAAAATAAATGG + Intronic
1015222794 6:130824193-130824215 CTACTTAAAGAGACAAAAAAAGG + Intergenic
1015310276 6:131759582-131759604 CTGGCTACCAAGAAAAAAAAGGG - Intergenic
1015520321 6:134123578-134123600 GTGCTTAAGAAGAAAAAAAGTGG - Intergenic
1015602875 6:134927632-134927654 CGACTAAAATAGAAAAAAAATGG + Intronic
1016057078 6:139589469-139589491 CTGCTGAACTAGAAAAGAGATGG + Intergenic
1016481448 6:144486119-144486141 TTGCTTAACAAAAAAGAAAAGGG + Intronic
1017458570 6:154626158-154626180 CTTCTTAAAAAGAAAAAAAAAGG - Intergenic
1017857069 6:158359160-158359182 CCTCTTACCTAGAAAAGAAATGG + Intronic
1018062808 6:160103731-160103753 CTGTTTCCCTATAAAAAAAAAGG - Exonic
1018645785 6:165946908-165946930 CTTATTAACTGAAAAAAAAATGG - Intronic
1019280290 7:196315-196337 CTGCTGAATTGGACAAAAAAGGG + Intronic
1019899177 7:4006685-4006707 CTCTTTCACTAGAAAATAAAAGG - Intronic
1019953390 7:4391626-4391648 CTCCTTAACTAACAAAAAACCGG - Intergenic
1020138961 7:5602205-5602227 CTACTTAAAAAAAAAAAAAAGGG - Intronic
1021234938 7:18131460-18131482 CTGCTTTACTACCAAAGAAAAGG + Intronic
1021421246 7:20447605-20447627 ACACTGAACTAGAAAAAAAATGG + Intergenic
1021568828 7:22043945-22043967 CTGCTTAGCTATAATGAAAAAGG + Intergenic
1021938395 7:25654000-25654022 CTGCTTCTCTAGAAAATCAATGG - Intergenic
1021949692 7:25762577-25762599 CTGCTTTACTAGTAAACAGATGG - Intergenic
1021956833 7:25833709-25833731 CTGCTCCACTAGAACAAGAAAGG + Intergenic
1022999182 7:35789938-35789960 CTGCTCAACAAAAAAAAAAGAGG - Intergenic
1023338279 7:39192833-39192855 CTGCTCAAATAAAAAAGAAAGGG + Intronic
1023517543 7:41017134-41017156 TTGCTTTGCAAGAAAAAAAAAGG - Intergenic
1024393904 7:48844652-48844674 CTGCTAAAAAAAAAAAAAAATGG - Intergenic
1025951416 7:66148359-66148381 CTCCTTCTCTAGAAAACAAAAGG + Intronic
1026174156 7:67981328-67981350 CTGCCTCACAACAAAAAAAAAGG - Intergenic
1026667446 7:72355213-72355235 CTGCTTAACGAGGATACAAAAGG + Intronic
1026732347 7:72923123-72923145 AGACTTAACTTGAAAAAAAAAGG - Intronic
1027275942 7:76555899-76555921 CAGTATAATTAGAAAAAAAATGG + Intergenic
1027343711 7:77236289-77236311 CATTTTAACTAGAAATAAAATGG + Intronic
1027626891 7:80556365-80556387 AAGCTCAATTAGAAAAAAAAAGG - Intronic
1027736763 7:81942222-81942244 CTGGTTATATTGAAAAAAAAAGG - Intergenic
1027745570 7:82069711-82069733 CAGCTGAAATAAAAAAAAAAGGG - Intronic
1027848368 7:83415728-83415750 CTGCTTGACCTAAAAAAAAATGG - Intronic
1027982497 7:85243677-85243699 TTTTTTAACTACAAAAAAAATGG + Intergenic
1028216268 7:88137569-88137591 CTGGTTAGATAGAGAAAAAAGGG - Intronic
1028428618 7:90720509-90720531 ATGCTTAAATAGAAACAAATTGG - Intronic
1028440534 7:90854608-90854630 CTTCTTAACCAGAAAACATAAGG + Intronic
1030432201 7:109464394-109464416 CAGCAAAACTAGAAATAAAACGG - Intergenic
1030584803 7:111404099-111404121 CTACTTGGCTAGAAAACAAATGG + Intronic
1030667185 7:112292302-112292324 CTGCTTAACTAGGCAAGGAAAGG - Intronic
1030868503 7:114728864-114728886 CTGCCTAACAAAAAAAAAAGAGG - Intergenic
1030875538 7:114809055-114809077 CTGGTTAAAAAAAAAAAAAAGGG + Intergenic
1031162787 7:118188654-118188676 CTACTTAACTAGTAGAAAAATGG - Intronic
1031176124 7:118353496-118353518 TTTCTTCACAAGAAAAAAAAAGG - Intergenic
1031279590 7:119780914-119780936 ATGCTTAGCTTGAAATAAAAGGG + Intergenic
1031339300 7:120579203-120579225 TTGCTTAAAAGGAAAAAAAAAGG - Intronic
1031393792 7:121247866-121247888 CTGCTTAGCCAGAAGAAAATAGG + Intronic
1031961740 7:127996134-127996156 CTGCTTTAAAAAAAAAAAAAAGG + Intronic
1032818240 7:135499281-135499303 CAGCCTAACTAGAAAAGAAAAGG + Intronic
1032858360 7:135855934-135855956 CTGATTTACTAGCAAAAACAAGG - Intergenic
1033024552 7:137759919-137759941 CTGAAAAACTAGAAACAAAAAGG + Intronic
1034045320 7:147921110-147921132 CTGTTAAACAAAAAAAAAAAAGG - Intronic
1035215328 7:157362064-157362086 CTATTTAAATACAAAAAAAAAGG - Intronic
1037010670 8:13838656-13838678 CTGCCTAAGAAAAAAAAAAAAGG - Intergenic
1037310710 8:17552980-17553002 TGTCTTAACTAGAAAATAAAAGG - Intronic
1039763625 8:40605032-40605054 AAGCTTAATTAGAAACAAAACGG - Intronic
1040135182 8:43844998-43845020 CTGCTGAATCAAAAAAAAAAAGG - Intergenic
1040762827 8:50871637-50871659 CTGCTATACCAGAAAATAAATGG + Intergenic
1040921449 8:52624403-52624425 CTGCATAACTAGAGACAAAAAGG - Intronic
1041441442 8:57901306-57901328 CGGCTTAATTAGAAAACCAAGGG + Intergenic
1041539952 8:58972620-58972642 TTGTTGAACTAGAACAAAAATGG - Intronic
1041565073 8:59267798-59267820 TTACTTAATGAGAAAAAAAAAGG + Intergenic
1041620254 8:59959135-59959157 GTTCTTAATTACAAAAAAAAAGG - Intergenic
1041754473 8:61298963-61298985 CTGCTTTCCTAGTAAAAGAATGG + Intronic
1042057218 8:64777413-64777435 CTTCTTAATTAGACAAAAATGGG - Intronic
1042435261 8:68757014-68757036 CTCCTTCACAAGATAAAAAAAGG + Intronic
1042445121 8:68875259-68875281 CTGCTTTAATGGGAAAAAAATGG + Intergenic
1042938282 8:74082298-74082320 ATGCTCAACCAGAAGAAAAATGG - Intergenic
1043473714 8:80585785-80585807 CTCCTTAAGTTGAAAAAAAAAGG - Intergenic
1043985583 8:86691579-86691601 AAGCTCAACTAGAAACAAAATGG - Intronic
1044292139 8:90485134-90485156 AAGCTCAATTAGAAAAAAAAGGG + Intergenic
1044308777 8:90667876-90667898 CTGCTTGAATAGAACAACAATGG - Intronic
1044914407 8:97097181-97097203 CTACTTGACTAAACAAAAAAAGG - Intronic
1046573251 8:115993070-115993092 CTCCTTTGCTAGAAAAAAATGGG - Intergenic
1046674276 8:117091381-117091403 CTTCTGAAAGAGAAAAAAAATGG - Intronic
1046949283 8:120004389-120004411 CTGCTAAAGTAGAATGAAAAAGG + Intronic
1048670485 8:136713472-136713494 GTGCTTCAGTAGAAAATAAAAGG + Intergenic
1049037100 8:140085333-140085355 CTGTTTAAAAAAAAAAAAAAAGG + Intronic
1049058366 8:140256772-140256794 CTGCTTTACTTGTAAAAGAAGGG - Intronic
1049382147 8:142322238-142322260 TTCCTTAACTAGAAAAAAGAAGG + Intronic
1050940001 9:11446509-11446531 CTGCTAAAAAAAAAAAAAAAAGG + Intergenic
1050983041 9:12044798-12044820 ATGCTTCACTAGAAAAAATTTGG - Intergenic
1051224494 9:14884703-14884725 GTGCACAACAAGAAAAAAAATGG + Intronic
1051436143 9:17034516-17034538 CAGCTTAACCAGAATAAAGATGG - Intergenic
1053103234 9:35389250-35389272 CTGCCTAACTAGATAAGATAGGG - Intronic
1053162501 9:35823205-35823227 CTGCATGAGCAGAAAAAAAAGGG - Intronic
1053529465 9:38865451-38865473 CTGTTTAACTGAAAAAAAAATGG + Intergenic
1054201693 9:62089879-62089901 CTGTTTAACTGAAAAAAAATGGG + Intergenic
1054636666 9:67498480-67498502 CTGTTTAACTGAAAAAAAATGGG - Intergenic
1055143198 9:72899977-72899999 CTGCTAATTTGGAAAAAAAAAGG + Intergenic
1055599366 9:77899576-77899598 CTACATGACTAGGAAAAAAAAGG + Intronic
1055765552 9:79659401-79659423 ATGGTTATCTAAAAAAAAAAGGG - Intronic
1056444707 9:86654536-86654558 CTGATGATCAAGAAAAAAAAAGG - Intergenic
1056501770 9:87216602-87216624 CTGCTGAACTGTAGAAAAAATGG + Intergenic
1057051978 9:91931310-91931332 CTCCTTAATTAGAAGTAAAAGGG + Intronic
1057667827 9:97060255-97060277 CTGGTTAGCTCTAAAAAAAAAGG - Intergenic
1058197706 9:101999337-101999359 GTGCATAACTAAAACAAAAATGG + Intergenic
1059260450 9:112971049-112971071 CTGCTTTCCCAGAAGAAAAATGG - Intergenic
1060721244 9:125980589-125980611 CTTGTTAAGAAGAAAAAAAATGG + Intergenic
1186656927 X:11622618-11622640 CTGCTTAATCTGAAAAATAAGGG + Intronic
1186806333 X:13143678-13143700 CTTCATAACTGGAAAAAACATGG + Intergenic
1188604701 X:32013794-32013816 ATGTTTAACTGGAAATAAAACGG + Intronic
1188617224 X:32173007-32173029 CTGCTCAATTAAAAAAAAATTGG + Intronic
1189079346 X:37953611-37953633 CTCCAAAACCAGAAAAAAAAAGG + Intronic
1189426643 X:40907745-40907767 ATGCTTAACTTAAAAAGAAATGG + Intergenic
1189636950 X:43021518-43021540 ATGATTAACTGAAAAAAAAAGGG + Intergenic
1190413617 X:50160934-50160956 CTGCTTATCTATAAAATTAAAGG + Intergenic
1191595558 X:62940182-62940204 CTGCTTAAAAACAAAAAGAAAGG - Intergenic
1191818278 X:65273401-65273423 CTGTCTGAATAGAAAAAAAAAGG + Intergenic
1191994581 X:67078507-67078529 TTGCTTAACTAGAGAAAGATAGG - Intergenic
1192305524 X:69955519-69955541 CTGATTAAGTGGAAAAAAAATGG - Intronic
1192463154 X:71335293-71335315 CTCCATAAAAAGAAAAAAAAAGG + Intergenic
1193185789 X:78510775-78510797 AAGCTCAACTAGAAACAAAATGG + Intergenic
1193241517 X:79175766-79175788 CCACTTAAATAAAAAAAAAAAGG + Intergenic
1193255666 X:79345786-79345808 AAGCTCAACTAGAAAAAAAATGG + Intergenic
1193636065 X:83950077-83950099 AAGCTTAATTAGAAACAAAATGG + Intergenic
1193755903 X:85408462-85408484 CTGCTTGAAAAAAAAAAAAATGG - Intergenic
1193882875 X:86946508-86946530 ATGCTCAGCTAGAGAAAAAAAGG + Intergenic
1193924724 X:87469898-87469920 AAGCTTAATTAGAAACAAAATGG + Intergenic
1194532470 X:95068656-95068678 CTGCTGAAGGAAAAAAAAAATGG + Intergenic
1196029810 X:111084630-111084652 CTGCTTAACTAGAAAAAAAATGG - Intronic
1196222354 X:113126225-113126247 CTGATTAAAAACAAAAAAAAAGG - Intergenic
1196509679 X:116494067-116494089 CAGCTTAAATAAACAAAAAATGG - Intergenic
1196719922 X:118844121-118844143 CTGGTTTAATAGAATAAAAAGGG + Intergenic
1196835563 X:119810812-119810834 ATTATTAACTGGAAAAAAAATGG - Intergenic
1197918979 X:131569006-131569028 TTGCAAAACTAGAAAAAAAGAGG + Intergenic
1198701617 X:139402831-139402853 CTGCTATTGTAGAAAAAAAATGG + Intergenic
1199239990 X:145535361-145535383 CTGGTTCTCCAGAAAAAAAAAGG + Intergenic
1200599105 Y:5183940-5183962 CTCATTAAAAAGAAAAAAAAAGG - Intronic
1200704304 Y:6428592-6428614 CTGCCTAAGCAGAGAAAAAATGG + Intergenic
1201029807 Y:9736116-9736138 CTGCCTAAGCAGAGAAAAAATGG - Intergenic
1201426903 Y:13861360-13861382 CTGTTTCACTTGAAAATAAAGGG + Intergenic
1201711637 Y:16999179-16999201 CTGATAACCTAGAAAAAAGAAGG + Intergenic
1201904048 Y:19071767-19071789 CTGTGTAAGTGGAAAAAAAAGGG + Intergenic
1201922739 Y:19252441-19252463 TTGCTTATCTAGGAAAAACAGGG + Intergenic
1202328084 Y:23713905-23713927 TTGCTTAATTAAAAAAAAAAAGG - Intergenic
1202542686 Y:25956147-25956169 TTGCTTAATTAAAAAAAAAAAGG + Intergenic