ID: 1196031417

View in Genome Browser
Species Human (GRCh38)
Location X:111097989-111098011
Sequence CAAGTCTCCGGACAGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196031412_1196031417 4 Left 1196031412 X:111097962-111097984 CCTTAGGATGTCAAGGAGCTGAC 0: 1
1: 0
2: 0
3: 3
4: 97
Right 1196031417 X:111097989-111098011 CAAGTCTCCGGACAGGCAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 120
1196031409_1196031417 20 Left 1196031409 X:111097946-111097968 CCTGAGGTCAGAGAGACCTTAGG 0: 1
1: 0
2: 3
3: 17
4: 175
Right 1196031417 X:111097989-111098011 CAAGTCTCCGGACAGGCAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196031417 Original CRISPR CAAGTCTCCGGACAGGCAGC TGG Intronic
900002539 1:22642-22664 CAAGGCTCCTGAGAGGCATCTGG + Intergenic
900022258 1:193167-193189 CAAGGCTCCTGAGAGGCATCTGG + Intergenic
900410902 1:2512192-2512214 CAATGCTCCTGACAGGCTGCGGG + Intronic
902167441 1:14583983-14584005 CAAGTCCCCGCCCAGGCTGCAGG + Intergenic
902219968 1:14958606-14958628 CAGGTCTCCGGCCAGGCATGTGG - Intronic
904603904 1:31688759-31688781 CAAGTCTCAGGGCAGGGATCAGG - Intronic
906530044 1:46518514-46518536 CAAGTCTCTGGCCAGGCAATAGG + Intergenic
908398295 1:63746336-63746358 CAGGTCTCCAGACAAGCAGAGGG - Intergenic
910758432 1:90713906-90713928 CAAGCATCCGGACAGGGAGAAGG - Intronic
919583926 1:199411777-199411799 CAAGTCTCCAGACCTGCAGTAGG + Intergenic
919738786 1:200970302-200970324 CACATCCCCAGACAGGCAGCAGG + Intronic
922193656 1:223341244-223341266 CAAGTACCCAGACAGGCATCTGG - Intronic
1069753697 10:70760830-70760852 CATGTCACCGGGGAGGCAGCAGG - Exonic
1071610977 10:87031099-87031121 CAAGGCTCGGGACCTGCAGCTGG - Intergenic
1073985454 10:109203274-109203296 CAAGTGTCAGGAAAGGAAGCAGG - Intergenic
1074147379 10:110728803-110728825 CAGGTCTCAGGACTGACAGCAGG + Intronic
1074419876 10:113299323-113299345 CATGTCACCTGACAGGGAGCAGG - Intergenic
1079051024 11:17159770-17159792 CAAGTCTCCAGATCTGCAGCTGG + Intronic
1082120903 11:48378661-48378683 CAAGTCTCTTTTCAGGCAGCTGG + Intergenic
1082252939 11:50001980-50002002 CAAGTCTACTTTCAGGCAGCTGG - Intergenic
1084317370 11:68353426-68353448 CATGTCTCCGGAGAGGGAGAGGG + Intronic
1089009102 11:115118512-115118534 CAGGTCCCCAGACAGGCAGAAGG + Intergenic
1089178541 11:116565253-116565275 CATGTCTCCGGCCAGGCTGATGG + Intergenic
1091375957 12:24705-24727 CAAGGCTCCTGAGAGGCATCTGG + Intergenic
1091401705 12:185197-185219 CAGGTCTCCGGACAGCTGGCCGG + Intergenic
1091991745 12:4961160-4961182 CTTGCCTCCAGACAGGCAGCAGG + Intergenic
1092835970 12:12488558-12488580 AACGTCTCCTGAGAGGCAGCAGG - Intronic
1096589428 12:52647822-52647844 CATGTCTCCCGACAGTCACCTGG + Exonic
1101058410 12:100944623-100944645 CAAGACTCGAGCCAGGCAGCGGG - Intronic
1103799800 12:123530749-123530771 AAAGTCTCATGTCAGGCAGCAGG - Intronic
1113655695 13:112066955-112066977 CACGGCCCCGGGCAGGCAGCGGG + Intergenic
1116937607 14:50758215-50758237 CAAGTATCTGGTCAGACAGCAGG + Exonic
1121509411 14:94501312-94501334 CAAGGCTCCTGCCAGGCTGCTGG - Intronic
1132450971 15:101968297-101968319 CAAGGCTCCTGAGAGGCATCTGG - Intergenic
1132781569 16:1629275-1629297 CCTGTCTCTGCACAGGCAGCCGG + Intronic
1137037809 16:35581004-35581026 CAAGAGCCTGGACAGGCAGCTGG + Intergenic
1139988543 16:70920544-70920566 GAAGTCTCAAGTCAGGCAGCAGG - Intronic
1142271214 16:89090408-89090430 CGAGTCTCCTGAAAGGCAGGAGG + Intronic
1151540003 17:74759999-74760021 GAAATCTCAGGACAGGCAGGGGG - Intronic
1153539399 18:6137891-6137913 CAAGTCTCAGGACAGGGTGGTGG + Intronic
1156269031 18:35514025-35514047 CAAGTCTTGGGACAAGCAGGGGG - Intergenic
1160622714 18:80181800-80181822 CATGTGTGGGGACAGGCAGCTGG + Intronic
1160634291 19:64250-64272 CAAGGCTCCTGAGAGGCATCTGG + Intergenic
1161153904 19:2722517-2722539 CAAGTCTCCGCAGAGGCAGATGG - Intronic
1161332591 19:3695397-3695419 GAAGGCACGGGACAGGCAGCCGG - Intronic
1162648118 19:12064890-12064912 CAAGTCTCGGGACTCCCAGCGGG - Intronic
925423648 2:3731282-3731304 CAAGTCTCAGGACCAGCAGCTGG + Intronic
925590909 2:5508044-5508066 CCAGACTCCGCACAGGGAGCAGG - Intergenic
929279587 2:40063519-40063541 CAAGTCTCCATTTAGGCAGCAGG + Intergenic
934752538 2:96802805-96802827 CGACTCCCCGGACAGGCATCAGG - Intronic
936567184 2:113590777-113590799 CAAGGCTCCTGAGAGGCATCTGG - Intergenic
937322485 2:120969282-120969304 CAAGCCTCTGGGCTGGCAGCAGG + Intronic
939002685 2:136754729-136754751 AAACTCTCAGGACAGGTAGCTGG - Intergenic
944137663 2:196416717-196416739 CAAGTATCCCGCCAGGCTGCAGG + Intronic
944820758 2:203428343-203428365 CAAGTCTCCTGACAGTCACTGGG + Exonic
945036284 2:205706722-205706744 CAAGCCTCAGGGCAGGCTGCTGG + Intronic
945178174 2:207064649-207064671 GAAGTCTCCGGACAAAGAGCAGG + Intergenic
947765429 2:232634300-232634322 CAAATCTCCGGACTGGCGGGCGG - Intronic
1172427232 20:34863544-34863566 CGGGTCTGCGGGCAGGCAGCCGG + Exonic
1173620837 20:44434666-44434688 CAAATCTCAGCGCAGGCAGCCGG + Intergenic
1174336610 20:49866118-49866140 CAGGGCTCAGGACAGGCAGGTGG - Intronic
1175412947 20:58783517-58783539 CAAGTTTCCACACAGGAAGCCGG + Intergenic
1179532405 21:42028890-42028912 CAAGACTGGGGACAGGCAGAGGG - Intergenic
1180736846 22:18023886-18023908 CAGGTGTCAGGACAGCCAGCAGG - Intronic
1181417067 22:22768076-22768098 CAGCGCTCCCGACAGGCAGCTGG + Intronic
1181499117 22:23305796-23305818 CCAGTCCCCGGCCAGGCAGCAGG + Intronic
1184102638 22:42348893-42348915 CAAGGCTCAGGTCTGGCAGCTGG - Intergenic
1184178759 22:42805409-42805431 CAGGTCTCTGGACCGGCTGCTGG + Intronic
1185319070 22:50192208-50192230 CCAGTCTCAGGACAGCCTGCTGG + Intronic
1185415829 22:50709704-50709726 CAAGCCTCAGGACAGGTTGCTGG + Intergenic
950339373 3:12229185-12229207 CCTGGCTCCAGACAGGCAGCAGG - Intergenic
950441573 3:13013935-13013957 GAAGTCCCCAGGCAGGCAGCAGG + Intronic
953521370 3:43646367-43646389 CAAGGATCAGGACAGGTAGCAGG - Intronic
959648715 3:108730974-108730996 CAAGTCCCCCGACATGCAACAGG - Intergenic
961088497 3:124090398-124090420 CAAATATCAGGCCAGGCAGCAGG - Intronic
963828646 3:149983306-149983328 CATGTCTCCGGCCAGAGAGCCGG + Intronic
968003165 3:195221553-195221575 CAGGCCTCCAGACAAGCAGCAGG - Intronic
968622519 4:1610311-1610333 CAGGTCTTCCGGCAGGCAGCTGG - Intergenic
968737288 4:2304011-2304033 CATGTCACCTGACAGGCACCCGG + Intronic
969467880 4:7368437-7368459 CAGGACTCCCGGCAGGCAGCAGG - Intronic
973728975 4:53804911-53804933 CAAGTCTCAAGCCAGGAAGCTGG + Intronic
975709586 4:77146993-77147015 CAAATCTCAGGAAAGCCAGCAGG - Intergenic
985663849 5:1171747-1171769 CAAGGATGGGGACAGGCAGCAGG - Intergenic
989414778 5:41160978-41161000 CAAGTACCCGGAGGGGCAGCTGG + Intronic
999856284 5:155598026-155598048 CATGTCTCCAGGCATGCAGCTGG + Intergenic
1003975655 6:11341289-11341311 CAAGTCTCCAGGCAGACAGCTGG - Intronic
1004758096 6:18635546-18635568 CACCTCTCCGGACAAACAGCTGG - Intergenic
1005642520 6:27810115-27810137 CAAGGCTCCGCGCAAGCAGCTGG + Exonic
1006374123 6:33662514-33662536 CACGTCTCCCTGCAGGCAGCAGG - Exonic
1006744306 6:36330621-36330643 CAGGTCTCTGGACAGGCCGCAGG - Exonic
1006823460 6:36916719-36916741 CAAGTCTCCTGGCTAGCAGCAGG - Intronic
1007360476 6:41351794-41351816 AAAGTCTGCGGACAGCCGGCCGG + Intergenic
1010046147 6:71446248-71446270 CAAGTGTCCGGGCAGCCAGCTGG + Intergenic
1017159264 6:151350047-151350069 CGATTCTCCGGACAGCCAGGAGG + Exonic
1022642409 7:32200687-32200709 CAAGTATCCCAACAGGCAGCAGG + Intronic
1023966942 7:44967694-44967716 CATGTGGCCGGACGGGCAGCAGG - Exonic
1024736538 7:52311200-52311222 CAAGTCCCCGGATTGGCAGTCGG + Intergenic
1026742255 7:72986193-72986215 AAAGTCTCAGGAAAGGCAGATGG - Intergenic
1026802102 7:73406613-73406635 GAAGTCTCAGGAAAGGCAGATGG - Intergenic
1027028378 7:74870932-74870954 AAAGTCTCAGGAAAGGCAGATGG - Intergenic
1027101480 7:75378885-75378907 AAAGTCTCAGGAAAGGCAGATGG + Intergenic
1029218724 7:98970844-98970866 CTAGTCCCGGGACGGGCAGCAGG + Intronic
1033905336 7:146194519-146194541 CAAGTGTCCTGACAGGGACCTGG - Intronic
1035579008 8:728227-728249 CAAGACTCCGCCCAGGCAGCAGG + Intronic
1037078297 8:14750228-14750250 TAAGTCTCAGGACAGGTAACAGG - Intronic
1037314383 8:17587163-17587185 CAATTCTGTGGTCAGGCAGCTGG + Intronic
1039611292 8:38921386-38921408 CAACTCTCCAGGGAGGCAGCTGG - Intronic
1040059714 8:43093678-43093700 GGAGCCTCCGGACAGGCCGCGGG - Intronic
1041394545 8:57377264-57377286 CAAGACTCAGGACAGGAAGAGGG - Intergenic
1045555776 8:103213386-103213408 CCAGTCTTAGGCCAGGCAGCTGG + Intronic
1047432799 8:124807146-124807168 CAAGTCACGGGACAGGCCCCAGG + Intergenic
1049302386 8:141878501-141878523 CAAGTCACAGGAGAGGCACCCGG - Intergenic
1049386286 8:142344609-142344631 CAGGTCTCTGGACACCCAGCAGG - Intronic
1049553777 8:143272411-143272433 CACGTCTGGGGACAGGCGGCAGG - Intronic
1049573891 8:143381792-143381814 CAAGTCTCCCCACAGGCGGCTGG + Exonic
1049683948 8:143931798-143931820 CAAGGCCCCGGTCAGGCTGCAGG + Intronic
1049885347 9:22755-22777 CAAGGCTCCTGAGAGGCATCTGG + Intergenic
1052233357 9:26181998-26182020 CAAGTCTCCTGAGAGACATCTGG + Intergenic
1056793073 9:89638657-89638679 CTAGTCCCAGGCCAGGCAGCTGG - Intergenic
1058822555 9:108745997-108746019 CAATTCTCTGGAAAGGCATCTGG - Intergenic
1059121492 9:111642963-111642985 CAAGGCTCAGGACAGACAGGAGG + Intronic
1059791137 9:117642889-117642911 CAGGGCTCCGGACCTGCAGCCGG - Intergenic
1060319683 9:122545949-122545971 CAATTCTCAGGACAGGGAGGAGG - Intergenic
1060875144 9:127077788-127077810 GAAGTCTGGGGCCAGGCAGCTGG - Intronic
1061566927 9:131446903-131446925 CAAGTCTACTTACTGGCAGCAGG + Intronic
1061684539 9:132264426-132264448 GAAGCCTCGGGACTGGCAGCTGG + Exonic
1062097215 9:134709656-134709678 CAAACCTCGGGCCAGGCAGCAGG - Intronic
1062436948 9:136550596-136550618 CAAGTCCCCGGGCAGGCACTGGG + Intergenic
1062483575 9:136763463-136763485 CAAGGCTGCGGAGAGGCAGGCGG + Exonic
1196031417 X:111097989-111098011 CAAGTCTCCGGACAGGCAGCTGG + Intronic
1200236578 X:154470633-154470655 CCAGTCTCCAGACAGGCTGCTGG - Intronic