ID: 1196031528

View in Genome Browser
Species Human (GRCh38)
Location X:111098725-111098747
Sequence GCTTTTACATGGGTGGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196031521_1196031528 -3 Left 1196031521 X:111098705-111098727 CCTAGACAGGTAGGTTGACTGCT 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1196031528 X:111098725-111098747 GCTTTTACATGGGTGGGCTGGGG 0: 1
1: 0
2: 2
3: 15
4: 171
1196031517_1196031528 30 Left 1196031517 X:111098672-111098694 CCTCAAAGGGAAGTGGAGGCGCT 0: 1
1: 0
2: 0
3: 12
4: 90
Right 1196031528 X:111098725-111098747 GCTTTTACATGGGTGGGCTGGGG 0: 1
1: 0
2: 2
3: 15
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196031528 Original CRISPR GCTTTTACATGGGTGGGCTG GGG Intronic
902615850 1:17623197-17623219 GGTTTTACCTTGGTGGGCTGGGG - Intronic
903680053 1:25090427-25090449 CCATTTAGATGGGTGGGTTGAGG + Intergenic
905883710 1:41480543-41480565 GCTTGTACCAGGCTGGGCTGGGG + Intronic
906945417 1:50290380-50290402 GCTTGACCATGGGAGGGCTGAGG + Intergenic
908227568 1:62071574-62071596 GCTTTTACCTGGGGAGGCGGAGG - Intronic
909376449 1:74947614-74947636 GATTTTCCCTGGGTGGCCTGTGG - Intergenic
910036105 1:82790940-82790962 GCTATAACACAGGTGGGCTGGGG + Intergenic
910121000 1:83790316-83790338 GCTTTTACATAGGCCGGGTGCGG - Intergenic
910159785 1:84260427-84260449 CCTTTGCCAGGGGTGGGCTGGGG + Intergenic
915806544 1:158859367-158859389 GCTATTACACAGGTGGGCTGGGG + Intergenic
916423286 1:164656909-164656931 GTTTATACATGGGTTGACTGTGG + Intronic
917072677 1:171169386-171169408 GCTGTAACACAGGTGGGCTGGGG + Intergenic
924284270 1:242469949-242469971 GATTTTACATGGGCGGATTGTGG - Intronic
924943389 1:248827701-248827723 GCATTTTCATGGGGGAGCTGGGG + Intergenic
1069453919 10:68538840-68538862 GCTTTTACTTGGGATAGCTGAGG - Intergenic
1069714982 10:70514823-70514845 GCTTTGAGGTGGGTGGGGTGAGG + Intronic
1069823769 10:71242922-71242944 ACTCTTGAATGGGTGGGCTGAGG - Intronic
1070703617 10:78621302-78621324 GCTTATACATGGGAAAGCTGAGG + Intergenic
1073252301 10:102128432-102128454 GCTTTTAGAGGGGCGGGGTGCGG - Intergenic
1074431530 10:113398938-113398960 GCTTTTTCCTGGGTGGCTTGAGG + Intergenic
1076184990 10:128440026-128440048 GCCTTTACAGGGGAGGGATGTGG - Intergenic
1078417714 11:11179561-11179583 GCTTGCACATGGGTTGGCTTAGG + Intergenic
1080230535 11:30014723-30014745 GCTTTTACAGGGCCTGGCTGAGG - Intronic
1080276932 11:30513228-30513250 GCTTAACCATGGGTGGACTGAGG - Intronic
1080435000 11:32231807-32231829 GCTTGTACATTGGTGGGGAGGGG - Intergenic
1080806029 11:35654790-35654812 GCTTTTACCGGAGTGGGCTTCGG - Intergenic
1080900892 11:36489880-36489902 GCTTTGACATGGGTAGCCTTCGG - Exonic
1081235620 11:40643764-40643786 GCTTATATATGAGTGGGCAGGGG - Intronic
1081957548 11:47106755-47106777 GCTCCTGCATGGGTGGGCTTTGG - Intronic
1082883413 11:58060093-58060115 GCTTAGCCATGGGTGGGCAGTGG + Intronic
1082985743 11:59169644-59169666 GATTTTAAATGGGTGGGATCAGG - Intergenic
1083174330 11:60939702-60939724 GCTTGTACATGGTGGGGATGGGG + Intronic
1083322100 11:61854126-61854148 ACTTTCACCTGGCTGGGCTGCGG - Intronic
1083704431 11:64504285-64504307 GCATTTGAATCGGTGGGCTGAGG - Intergenic
1085067786 11:73513503-73513525 TCTTTTACCTGGGTGGGGCGCGG - Intronic
1085315913 11:75544860-75544882 GCTTTAACATGGGTGGGTGTTGG - Intergenic
1086037717 11:82436890-82436912 GTTTTTACATGGATGGGGTGTGG - Intergenic
1091345422 11:134849710-134849732 GCTTTGTCATTGGTAGGCTGGGG - Intergenic
1091395817 12:153720-153742 GCTTTTGCATGGGGGTGGTGAGG - Intronic
1092204269 12:6606266-6606288 GATGTTACCTGGGTGGGGTGGGG + Exonic
1096274272 12:50192050-50192072 GCTTGAACATGGGGGGGCGGAGG + Intronic
1099698432 12:86053099-86053121 GCATTCACATGTGTAGGCTGAGG - Intronic
1101731786 12:107432915-107432937 GCTTGTTAATGAGTGGGCTGTGG - Intronic
1104906046 12:132214052-132214074 GCTTTCACCTGGGAGGACTGAGG - Intronic
1105329595 13:19403172-19403194 GCATTTTGATGGGTGGGGTGGGG - Intergenic
1105862241 13:24425866-24425888 GCATTTTGATGGGTGGGGTGGGG + Intronic
1106933883 13:34696954-34696976 GCTATAACATAGGTGAGCTGGGG - Intergenic
1109593720 13:64522550-64522572 GCTATAACACAGGTGGGCTGGGG - Intergenic
1111028908 13:82570295-82570317 GCTATAACACAGGTGGGCTGGGG - Intergenic
1115755040 14:36520842-36520864 ACTTTTGCATGGCTGAGCTGCGG - Intronic
1117768433 14:59107572-59107594 GCTGTGAGATGGGTGGCCTGGGG + Intergenic
1117814299 14:59581534-59581556 GCTTTTTCATGGGTGGCCTTGGG - Intergenic
1121412101 14:93755323-93755345 GCTTTCACATCGGTGTGATGGGG + Intronic
1121434887 14:93912507-93912529 GTTGTGACTTGGGTGGGCTGGGG - Intergenic
1122146134 14:99689903-99689925 GCTTTGACTTTGGTGAGCTGGGG - Intronic
1124150261 15:27171355-27171377 GCTTTTACATTGGTAGGCCAGGG - Intronic
1124193987 15:27604477-27604499 GCTTTTGCTAGTGTGGGCTGTGG + Intergenic
1124345524 15:28919212-28919234 CCTTTTACCTGGGTGGGCAGGGG + Intronic
1126066738 15:44831514-44831536 GCATCTACGTGAGTGGGCTGAGG - Intergenic
1126093094 15:45069045-45069067 GCATCTACGTGAGTGGGCTGAGG + Exonic
1126321801 15:47432012-47432034 AATGTTACATGGCTGGGCTGGGG + Intronic
1127629828 15:60817699-60817721 GCCTTCCCATGTGTGGGCTGAGG + Intronic
1127760629 15:62135980-62136002 GCATTTACAAGGCTGGCCTGGGG + Intergenic
1128261992 15:66239066-66239088 GCTTTTAAATGGCAGAGCTGGGG + Intronic
1130864959 15:87925083-87925105 GCTTTGACAAGGGTAGGCTTTGG - Intronic
1132435358 15:101796567-101796589 GTTTGTGCATGGGAGGGCTGTGG - Intergenic
1134043914 16:11087768-11087790 GCTTTTACATGGGTACACCGAGG + Intronic
1135056210 16:19233861-19233883 GGTATGTCATGGGTGGGCTGTGG - Intronic
1136986400 16:35109531-35109553 AGTTTTACCTGGGTGTGCTGGGG - Intergenic
1138449220 16:57083191-57083213 GTTTATAGATGGGTAGGCTGAGG - Exonic
1139105677 16:63823935-63823957 GAGTTTAAATGGGTGGTCTGTGG - Intergenic
1142206529 16:88785475-88785497 GCTTCTCGCTGGGTGGGCTGCGG + Intergenic
1143272138 17:5683611-5683633 GATTTTACCTGGGTGGACTGAGG + Intergenic
1144757071 17:17686287-17686309 GCCTTTAGATGAGTGGGGTGAGG + Intronic
1144782579 17:17815393-17815415 GCTTTTTCCTGGGTGGGCTGGGG + Intronic
1145018168 17:19412192-19412214 GCATTTGCATGGCTGGGATGTGG + Intronic
1148547954 17:48531175-48531197 GCTCTCAGATGGATGGGCTGCGG - Intergenic
1151413489 17:73946701-73946723 ATTTTTCCATGGGTGGGGTGGGG - Intergenic
1151456461 17:74229127-74229149 ACTGTGACATGGGTGGCCTGAGG + Intronic
1151765377 17:76130961-76130983 GCTTTAAGATGGGAGGCCTGGGG - Intergenic
1151817992 17:76481018-76481040 TCTTTGACATGGGTGAGCAGGGG - Intronic
1152147414 17:78576795-78576817 GCCATAACATGTGTGGGCTGAGG + Intronic
1153177472 18:2394574-2394596 GCTTATTCATGTGTGGGGTGTGG + Intergenic
1157193720 18:45602474-45602496 GCTTTTCCATGGATGAGCTCTGG + Intronic
1158018317 18:52810390-52810412 GCTATAACATAGGTGAGCTGGGG - Intronic
1158322705 18:56280866-56280888 GCTGTGACAAGGGTGGCCTGAGG + Intergenic
1161084984 19:2330802-2330824 ACTTTAACCTGGGCGGGCTGAGG + Intronic
1161921333 19:7268405-7268427 CCTTTTACCTGGGTGTGGTGAGG + Intronic
1165159286 19:33806380-33806402 TCGTTTACATGGGTTGGGTGGGG + Intronic
1167736286 19:51296372-51296394 GCATCCATATGGGTGGGCTGAGG + Intergenic
1168091424 19:54087860-54087882 CCTTGTACTTGGGAGGGCTGGGG - Intergenic
925348066 2:3184141-3184163 GCTCTTAAATGGCCGGGCTGTGG - Intergenic
926301775 2:11609994-11610016 GCTTTTCCATTGGTGCCCTGGGG + Intronic
932306232 2:70705774-70705796 GCTTTGACATGAATGGGATGGGG - Intronic
933361534 2:81292924-81292946 GTTTTTAAAAGGGTGGGCTACGG - Intergenic
936676689 2:114723932-114723954 CCTTTTATATGGGTGTGCAGAGG - Intronic
937299295 2:120829444-120829466 GCTGTTAAGTGGCTGGGCTGGGG - Intronic
938259911 2:129888145-129888167 GCTTCCTCCTGGGTGGGCTGGGG - Intergenic
939393957 2:141604922-141604944 GCTATAACACAGGTGGGCTGGGG + Intronic
940338726 2:152556959-152556981 GCTTTTCCATTGGTGGCCTATGG - Intronic
941058810 2:160821311-160821333 GTTTTTACATGAGTGGGTGGTGG + Intergenic
941686457 2:168453804-168453826 GCTTTCACTTGGGAGGGATGAGG + Intergenic
941719715 2:168800212-168800234 GCTTTTACATGAGTGAGGTCAGG + Intronic
941978830 2:171433720-171433742 GCTTGTCCTTGGGTGGCCTGCGG - Intronic
942054482 2:172169552-172169574 GATTTGACATGGGTGTTCTGAGG - Intergenic
946220954 2:218226337-218226359 GCTTTGACATGGATTGGGTGCGG + Intronic
948228094 2:236328574-236328596 GCTAATACATGGGTGGCCTAGGG - Intronic
949023377 2:241753650-241753672 GCTTCCACTCGGGTGGGCTGAGG - Intronic
1169208445 20:3752875-3752897 GCTCTTCCATGGCTGGGGTGGGG - Exonic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1178385108 21:32142700-32142722 GCTGTTAGATTGGAGGGCTGGGG + Intergenic
1180565323 22:16658886-16658908 GCATTTTGATGGGTGGGGTGGGG + Intergenic
1181975581 22:26726990-26727012 GATTTTCCAGGGGTGGGGTGAGG + Intergenic
1184568590 22:45308542-45308564 GTGGTTACATGTGTGGGCTGAGG + Intergenic
1184805481 22:46792610-46792632 GCTCTGATATGGGAGGGCTGTGG + Intronic
1185080669 22:48707859-48707881 GCTTTCTCGTGGGTGTGCTGGGG + Intronic
1185320592 22:50198673-50198695 TCCTTTATTTGGGTGGGCTGGGG - Exonic
949270348 3:2209264-2209286 TCTTTTACATGAGTGGGCACTGG + Intronic
952753933 3:36849499-36849521 GCTTATATGTGGGTGGGTTGAGG - Intronic
954295103 3:49670124-49670146 GGTATTCCATGGGTGGGGTGAGG - Exonic
955347178 3:58169806-58169828 GCCTTTTCAAGGGTGGGGTGGGG + Intronic
957911188 3:86621668-86621690 GTTTTTACAGGGGAGTGCTGAGG - Intergenic
959087829 3:101869835-101869857 GTTTTTCCATGGATGGGCTGTGG + Intergenic
960611398 3:119558110-119558132 GCCTTTTCATGGAAGGGCTGTGG - Intronic
962374620 3:134849858-134849880 GCCTTTACTGGGCTGGGCTGGGG + Intronic
964624852 3:158748992-158749014 GCTTCTCCATGGCTGGGCTGGGG + Intronic
966101692 3:176276948-176276970 GATTTTACATAGGTGGGGTCAGG + Intergenic
966985539 3:185176789-185176811 ACTTGTGCATGGGTGGGATGCGG - Intergenic
970094935 4:12452783-12452805 GCTTTTAGATGGGTGATGTGGGG - Intergenic
973639206 4:52886477-52886499 GCTATAACATGGGTGAGCTGGGG + Intronic
974021930 4:56699123-56699145 GCTCTGACATGGGAAGGCTGTGG + Intergenic
976611490 4:87035222-87035244 GCTCTTACCTGGGAGGGCTGAGG + Intronic
981000692 4:139826007-139826029 GCTTTTCCATGGGAGCCCTGTGG + Intronic
982399882 4:154954514-154954536 TCTATAACATAGGTGGGCTGGGG - Intergenic
984075285 4:175169749-175169771 GTTTTCACAAGGGTGTGCTGAGG + Intergenic
985704527 5:1392677-1392699 GCTTTGCTGTGGGTGGGCTGGGG + Intergenic
986643684 5:9895698-9895720 GATTTAAGATTGGTGGGCTGGGG - Intergenic
988060984 5:26170443-26170465 GCATTTGCATTGGTGGACTGAGG - Intergenic
993292689 5:86095666-86095688 GCTATTACACAGGTGAGCTGGGG - Intergenic
993616452 5:90118249-90118271 GATTTTAAATGGGTGGGCGTGGG - Intergenic
998543634 5:143006808-143006830 GCTTTTCCAAGTGTGGCCTGTGG + Intronic
999321750 5:150619573-150619595 GCGTTTCCATGGGCTGGCTGTGG - Intronic
999700068 5:154219639-154219661 GCATTTCTATGGGTGGGCCGGGG + Intronic
1003200081 6:3951385-3951407 CCTGTTACATGGGGAGGCTGAGG - Intergenic
1003989345 6:11470381-11470403 GCTTGAACCTGGGTGGGCGGAGG - Intergenic
1004278631 6:14259658-14259680 GATTTGACAAGGGTGGGCAGAGG - Intergenic
1005436023 6:25813137-25813159 GCTTATACATGGGTGGTCTTTGG + Exonic
1006840438 6:37025174-37025196 GTTTTTACATGGGTACTCTGTGG - Intronic
1006988338 6:38192200-38192222 GCTGTCACTTGGGAGGGCTGAGG + Intronic
1007115774 6:39342252-39342274 GCTTTTAGCTGGGTAGGTTGGGG - Intronic
1010529679 6:76952366-76952388 GCATTTAAATTGGTGGACTGAGG - Intergenic
1013241904 6:108254159-108254181 TCTTTTACTGGGGTGGGGTGGGG - Intronic
1014072930 6:117204095-117204117 GATTGTACATGTGTGGGCTCAGG - Intergenic
1016537052 6:145119137-145119159 GCTTTAACCAGGGTGGGCAGGGG + Intergenic
1017120822 6:151022442-151022464 GCTTTTACATGTATAGTCTGTGG + Intronic
1021691819 7:23237686-23237708 GTTTTTATATAGGTGAGCTGAGG + Intronic
1027215402 7:76180222-76180244 TGTTTTCCATGGGTGGGGTGGGG - Intergenic
1028689058 7:93629760-93629782 ACTTTTACATGGTAGGGCTGTGG + Intronic
1028963937 7:96780446-96780468 GCTTTTACATAGTTGGGCTAAGG - Intergenic
1030249597 7:107427745-107427767 GCTGTAACATGGGTGGGCTGGGG - Intronic
1031808881 7:126341138-126341160 GCTGTTACATGAGTGAGCTGGGG - Intergenic
1032076062 7:128836793-128836815 GCTTTCTCAGGGGTGGGCAGAGG - Intronic
1032830974 7:135625308-135625330 GCTTTTAAAAGGGGAGGCTGTGG - Exonic
1032992165 7:137405815-137405837 GCTTTCAGCTGGGAGGGCTGTGG - Intronic
1037620157 8:20556346-20556368 TCTTCTCCATGGGTTGGCTGTGG + Intergenic
1038347469 8:26745447-26745469 GCCTTTACTTGCCTGGGCTGAGG + Intergenic
1040509445 8:48081192-48081214 GCTGTAACACAGGTGGGCTGGGG + Intergenic
1040816219 8:51511094-51511116 GCTTTTACAGGGGCAGGATGGGG + Intronic
1040955272 8:52973760-52973782 GCATTCAACTGGGTGGGCTGAGG + Intergenic
1043915801 8:85920968-85920990 GCTTGAACCTGGGTGGGCGGAGG - Intergenic
1044784951 8:95783700-95783722 GTTTTTCCATGGATGGGGTGTGG - Intergenic
1046690870 8:117282896-117282918 GCTGTAACACAGGTGGGCTGGGG + Intergenic
1047673332 8:127172437-127172459 GTTTTTACTTGGGTGGTCAGGGG + Intergenic
1048396922 8:134022710-134022732 GAATTCACATGAGTGGGCTGAGG + Intergenic
1049709766 8:144058231-144058253 GCTTTGACATGGGAGGTATGAGG - Exonic
1056579764 9:87882555-87882577 GCTATGAAATGGGTGGGCTCAGG + Intergenic
1056754628 9:89373999-89374021 GCCTTTTCAAGGGTGGGCCGAGG - Intronic
1057800502 9:98188243-98188265 GTTTTAACTAGGGTGGGCTGGGG - Intronic
1062293001 9:135805797-135805819 GCCTTTTCCTTGGTGGGCTGTGG - Intergenic
1189141560 X:38612371-38612393 GCTTTTCCTGGCGTGGGCTGAGG - Intronic
1191071137 X:56401296-56401318 GCTATAACACAGGTGGGCTGGGG - Intergenic
1191833143 X:65436478-65436500 GCATTTAAATTGGTGGGCTGAGG - Intronic
1193505451 X:82336861-82336883 GCTATAACACAGGTGGGCTGGGG + Intergenic
1193960081 X:87914529-87914551 GCTTCTACATTGGTGGATTGTGG + Intergenic
1195146057 X:102018442-102018464 GCTATTATACAGGTGGGCTGGGG - Intergenic
1196031528 X:111098725-111098747 GCTTTTACATGGGTGGGCTGGGG + Intronic
1198546106 X:137694531-137694553 TCTCTTAGATGGGTGGGTTGTGG + Intergenic
1198737896 X:139807657-139807679 GATGTTAAATGGGTGGGGTGTGG + Intronic
1202601698 Y:26600278-26600300 GCATTTTGATGGGTGGGGTGGGG + Intergenic