ID: 1196031582

View in Genome Browser
Species Human (GRCh38)
Location X:111098950-111098972
Sequence GTCCATTCCAGGCCCTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 237}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196031582_1196031590 22 Left 1196031582 X:111098950-111098972 CCTCTGCAGGGCCTGGAATGGAC 0: 1
1: 0
2: 2
3: 21
4: 237
Right 1196031590 X:111098995-111099017 ACAGCTTCTCCAGCAGGGGGCGG 0: 1
1: 0
2: 1
3: 36
4: 277
1196031582_1196031592 29 Left 1196031582 X:111098950-111098972 CCTCTGCAGGGCCTGGAATGGAC 0: 1
1: 0
2: 2
3: 21
4: 237
Right 1196031592 X:111099002-111099024 CTCCAGCAGGGGGCGGAAAAGGG 0: 1
1: 0
2: 2
3: 18
4: 201
1196031582_1196031588 18 Left 1196031582 X:111098950-111098972 CCTCTGCAGGGCCTGGAATGGAC 0: 1
1: 0
2: 2
3: 21
4: 237
Right 1196031588 X:111098991-111099013 CTACACAGCTTCTCCAGCAGGGG 0: 1
1: 0
2: 0
3: 26
4: 251
1196031582_1196031586 16 Left 1196031582 X:111098950-111098972 CCTCTGCAGGGCCTGGAATGGAC 0: 1
1: 0
2: 2
3: 21
4: 237
Right 1196031586 X:111098989-111099011 CACTACACAGCTTCTCCAGCAGG 0: 1
1: 0
2: 0
3: 31
4: 163
1196031582_1196031587 17 Left 1196031582 X:111098950-111098972 CCTCTGCAGGGCCTGGAATGGAC 0: 1
1: 0
2: 2
3: 21
4: 237
Right 1196031587 X:111098990-111099012 ACTACACAGCTTCTCCAGCAGGG 0: 1
1: 0
2: 0
3: 36
4: 256
1196031582_1196031584 -7 Left 1196031582 X:111098950-111098972 CCTCTGCAGGGCCTGGAATGGAC 0: 1
1: 0
2: 2
3: 21
4: 237
Right 1196031584 X:111098966-111098988 AATGGACTCGTCTGCCAAGTCGG 0: 1
1: 0
2: 0
3: 2
4: 58
1196031582_1196031589 19 Left 1196031582 X:111098950-111098972 CCTCTGCAGGGCCTGGAATGGAC 0: 1
1: 0
2: 2
3: 21
4: 237
Right 1196031589 X:111098992-111099014 TACACAGCTTCTCCAGCAGGGGG 0: 1
1: 1
2: 3
3: 18
4: 234
1196031582_1196031591 28 Left 1196031582 X:111098950-111098972 CCTCTGCAGGGCCTGGAATGGAC 0: 1
1: 0
2: 2
3: 21
4: 237
Right 1196031591 X:111099001-111099023 TCTCCAGCAGGGGGCGGAAAAGG 0: 1
1: 0
2: 0
3: 11
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196031582 Original CRISPR GTCCATTCCAGGCCCTGCAG AGG (reversed) Intronic
900940917 1:5798165-5798187 GGCCACTGCTGGCCCTGCAGGGG - Intergenic
902881577 1:19375063-19375085 TTGCATTCCAGGGCCTGCTGTGG + Intronic
903329872 1:22591865-22591887 TGCCCTTCCGGGCCCTGCAGTGG + Intronic
903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG + Intronic
905367110 1:37458587-37458609 GCCCTTCCCAGACCCTGCAGGGG + Intergenic
907460847 1:54604588-54604610 CTCGACTCCAGGCCCTGCAGGGG - Intronic
908128762 1:61054100-61054122 GTCCCTCTCAGGGCCTGCAGTGG + Intronic
910916432 1:92294385-92294407 GTACATTCCAGGACCCCCAGTGG + Intronic
912798330 1:112706105-112706127 CTCCATTCCAGGCCCTGTGTGGG - Exonic
912950723 1:114118583-114118605 GGCCATGCCAGGCCCTCCGGCGG + Intronic
913073001 1:115318094-115318116 CTCCCTTCCATGGCCTGCAGGGG + Intronic
915229136 1:154432863-154432885 GTCTCTTCCAGGCCCTGCAGTGG - Intronic
919897125 1:202015887-202015909 GACTGTTCCAGGCCCTCCAGTGG + Exonic
920250952 1:204622150-204622172 GTGCATCCCAGACCCTCCAGAGG - Exonic
920352020 1:205343780-205343802 GTCCACGCCTGGCCCTGCGGGGG + Exonic
921631795 1:217442183-217442205 CTCCATTCAAGTCCCTGCAAAGG - Intronic
923430205 1:233912598-233912620 ATGCATTCCAGGCCCCCCAGTGG + Intronic
923751930 1:236754375-236754397 TTGAAATCCAGGCCCTGCAGAGG - Intronic
924392494 1:243578375-243578397 CTCCATTCATGTCCCTGCAGAGG - Intronic
1064352900 10:14592968-14592990 GGCAATTCCAGGCAGTGCAGTGG - Intronic
1065017947 10:21478784-21478806 GTACCGTTCAGGCCCTGCAGTGG - Intergenic
1066561982 10:36679528-36679550 GCACATTCCAGGCCCAGGAGGGG + Intergenic
1067472394 10:46546553-46546575 GTCCCTTTCAGGCCCTGCTCTGG - Intergenic
1067839318 10:49663458-49663480 GTCCATGCCAGGCCCTGGGCTGG - Intronic
1069660972 10:70123342-70123364 ATCCCGCCCAGGCCCTGCAGAGG + Intronic
1069697658 10:70398835-70398857 GTACATTTCAGGCCATGTAGAGG + Intergenic
1069880392 10:71589045-71589067 GGCCTTTCCTGGCCCTGTAGAGG - Intronic
1070410942 10:76139852-76139874 GACCATATCAGGCCCTGAAGAGG + Intronic
1070748341 10:78948647-78948669 GTCCCTTCCAGGCCCAGCAGGGG - Intergenic
1075847355 10:125555486-125555508 CTACATGCCAGGCTCTGCAGAGG + Intergenic
1075859363 10:125661535-125661557 GCAACTTCCAGGCCCTGCAGTGG - Intronic
1076448312 10:130534390-130534412 GACCATGCCAAGCCCTGGAGAGG - Intergenic
1076711669 10:132339107-132339129 GTCCCACCCAGGCCCTGCCGTGG - Intronic
1076890298 10:133280124-133280146 GACCATAAGAGGCCCTGCAGGGG + Intronic
1077422994 11:2461693-2461715 CTCCATGCCAGGCCCCGCACTGG - Intronic
1081330045 11:41791096-41791118 CTCCATTGCATGCCCTGCAAGGG + Intergenic
1081659079 11:44876986-44877008 GTCCGCTGCAGGCTCTGCAGGGG - Intronic
1082009041 11:47438125-47438147 ATGCATCCCAGCCCCTGCAGAGG - Intronic
1083069357 11:59960870-59960892 GTACATTCACAGCCCTGCAGAGG - Intergenic
1088061148 11:105652748-105652770 ATACATTCCAAGACCTGCAGTGG + Intronic
1088728150 11:112657469-112657491 GACCCCTCCAGGGCCTGCAGAGG - Intergenic
1088750239 11:112836768-112836790 TTTCATTACAGGCCCAGCAGTGG + Intergenic
1089776110 11:120837276-120837298 GTCCTTTCCAGGGGCTGCTGTGG + Intronic
1089842610 11:121431308-121431330 GTCCATATCAGTCCCTGAAGAGG - Intergenic
1089963638 11:122637553-122637575 GTCCAGTCCAGGCCCCACTGTGG - Intergenic
1090664507 11:128905635-128905657 CTTCATCCCTGGCCCTGCAGAGG - Exonic
1091656169 12:2348274-2348296 GGCCTGTCCTGGCCCTGCAGTGG - Intronic
1098006546 12:66003563-66003585 CCCAAGTCCAGGCCCTGCAGGGG + Intergenic
1098090088 12:66892207-66892229 GTCCCTTCCAGGCTGTGCAATGG - Intergenic
1098145657 12:67495487-67495509 GTCCATTCATGTTCCTGCAGAGG - Intergenic
1099010641 12:77287053-77287075 GTCCACTCCAGACCCTGCTTGGG - Intergenic
1100178822 12:92061315-92061337 GTACTGTCCAGGCCCTCCAGAGG - Intronic
1100242361 12:92722263-92722285 GTCAATTCCATGCCTGGCAGTGG - Intronic
1102030236 12:109736117-109736139 GTCCCTGCCTGGCCCTGCATAGG + Intronic
1102042991 12:109812417-109812439 CTCCATTCCTGGCCATCCAGTGG - Intronic
1104169833 12:126269390-126269412 CTACATAGCAGGCCCTGCAGTGG + Intergenic
1104828414 12:131731269-131731291 GGCCATTCCAGAATCTGCAGAGG + Intronic
1106688370 13:32086537-32086559 GTCCCTTCCAGGAGCTGCAGTGG + Intronic
1106919914 13:34552292-34552314 ATCCATGCCAGGCACTGCAAAGG + Intergenic
1109172284 13:59111952-59111974 TTTCATTCCAGGCCCTACACAGG - Intergenic
1113418314 13:110149214-110149236 GTCCATGCGATGCCCTGCTGAGG + Exonic
1113421782 13:110176654-110176676 GTCCTTTCCAGGCACTCCTGGGG + Exonic
1113783106 13:112987727-112987749 GCCCCTTCCAGGCCCTGGACAGG - Intronic
1114569696 14:23657954-23657976 ATGCACTCCAGGCCCTGCTGGGG + Intergenic
1114704489 14:24711464-24711486 GTTTATTCCAGGAGCTGCAGGGG - Intergenic
1117409463 14:55438163-55438185 GTGCATTCCTGACCCTTCAGTGG - Intronic
1121443185 14:93961943-93961965 TTCCATGCCTGGCCCTGCTGTGG + Intronic
1122155480 14:99747819-99747841 GTGCATTGCTGACCCTGCAGCGG - Intronic
1122194185 14:100072912-100072934 GTCTAGTCCAGGCTCTGCCGCGG + Intronic
1123055436 14:105567074-105567096 GCCATTCCCAGGCCCTGCAGGGG + Intergenic
1123079888 14:105686918-105686940 GCCATTCCCAGGCCCTGCAGGGG + Intergenic
1123849930 15:24344020-24344042 CTCCATTCCTGTCCCTGCAAAGG + Intergenic
1124611120 15:31209498-31209520 GTCCATTTCTTGCCCTGCACTGG - Intergenic
1124905875 15:33867990-33868012 CTCCTTTCCAGGCCCTGGTGGGG + Intronic
1127641900 15:60923924-60923946 GTCCATGCCTGGCCCTGCTGTGG + Intronic
1129257968 15:74344948-74344970 GTTCAGTACAGACCCTGCAGAGG - Intronic
1129394486 15:75236493-75236515 GGCCCTTCCAGGCCCAGCAGGGG - Intergenic
1129656791 15:77529866-77529888 GAACCTGCCAGGCCCTGCAGGGG - Intergenic
1130444091 15:83982571-83982593 GTGCATTGCAGGCTCTGCACAGG + Exonic
1132356397 15:101174320-101174342 ATCAGTTCCAGGCCCAGCAGGGG + Intergenic
1132501398 16:286149-286171 CTCCCTGTCAGGCCCTGCAGAGG + Intronic
1132802927 16:1763072-1763094 CTCCCCTCCAGGCCCTGAAGCGG + Intronic
1133543841 16:6786075-6786097 GCCCACTCCAGGCCCTGAACAGG - Intronic
1133856351 16:9552764-9552786 CTCCATCCCAGTCCCTGCAAAGG + Intergenic
1135321853 16:21502530-21502552 GTCCAATCAAGGACCTGCGGTGG + Intergenic
1135970919 16:27071217-27071239 TTCCCTTCCTGGCCCTGCAGGGG - Intergenic
1136129807 16:28212363-28212385 CTATATTCCAGGCCCTGCTGTGG + Intergenic
1136453013 16:30364993-30365015 GCCCGTTCCAGCTCCTGCAGTGG + Exonic
1137236527 16:46623062-46623084 CCCAAGTCCAGGCCCTGCAGGGG + Intergenic
1138201410 16:55091427-55091449 GTCCACTCTAGGCCCTGCCCTGG + Intergenic
1139449513 16:67018353-67018375 GTCCTTTCCAGGCCATGCCCTGG + Intergenic
1142033736 16:87851387-87851409 GAACATTCCAGGCCTGGCAGGGG - Intronic
1142968535 17:3595940-3595962 GTACACTCCAGGCCTGGCAGTGG - Intronic
1143266860 17:5644455-5644477 CCCCAGTCCCGGCCCTGCAGAGG - Intergenic
1143524306 17:7463329-7463351 GGCCATGGCTGGCCCTGCAGCGG + Exonic
1144359776 17:14480932-14480954 GTTCATCCCAGGCCTGGCAGAGG + Intergenic
1145269068 17:21394860-21394882 ATTCTTTCCAGGCCCTGCTGGGG + Intronic
1147388172 17:40093813-40093835 CTCTATGCCAGGCCCTGCACCGG - Exonic
1147558873 17:41496904-41496926 GTCCTGCCCAGGCCCTGCAGGGG - Intergenic
1148194958 17:45706684-45706706 GTCCACTCCATCCTCTGCAGTGG - Intergenic
1150643296 17:66964025-66964047 GGTCCTTCCAGGCCCTGCAAGGG + Intergenic
1151392617 17:73797806-73797828 GTGCATACCAGGGCCAGCAGTGG + Intergenic
1151888909 17:76940598-76940620 GCCTCTTCCAGGACCTGCAGGGG - Intronic
1151973775 17:77472471-77472493 GTCCCTTCCAGGTCCTGCAAAGG + Intronic
1151983872 17:77529502-77529524 CTGCTTGCCAGGCCCTGCAGAGG + Intergenic
1152592814 17:81222231-81222253 GTCCCTCCCAGGACCTGAAGGGG + Intronic
1154099616 18:11458485-11458507 ATACATTCCAGGACCTCCAGTGG - Intergenic
1154165443 18:12011121-12011143 GTCCATTCGAGGGTCTTCAGTGG + Intronic
1156019258 18:32580865-32580887 GTCCATTCCTGAACCAGCAGGGG - Intergenic
1156550930 18:38015807-38015829 CTCCATCCCTGCCCCTGCAGAGG + Intergenic
1157284260 18:46366422-46366444 GCCCAGCCCAGCCCCTGCAGAGG + Intronic
1158511515 18:58094727-58094749 CTCCATGCCATGCCTTGCAGTGG - Intronic
1162054777 19:8056025-8056047 AACCCTTCCAGGCCCGGCAGAGG - Intronic
1162368658 19:10265463-10265485 GGTCAGTCCAGTCCCTGCAGAGG + Intergenic
1162483368 19:10942865-10942887 GACCAGTGCAGTCCCTGCAGGGG - Intergenic
1163494270 19:17636146-17636168 GTCCATTTCAGGCCAAGAAGGGG - Exonic
1163794522 19:19329458-19329480 CTACATGCCAGGCCCTGCATTGG + Intronic
1163915390 19:20236731-20236753 GTACATTTCAGGCCCTGCTTAGG + Intergenic
1164800982 19:31076387-31076409 TTCAATTGCAGGCCCTGCAAAGG - Intergenic
1165115396 19:33525231-33525253 GGCCTTTGCAGGGCCTGCAGAGG + Intergenic
1167139931 19:47643422-47643444 GCTCAGTCCAGGCCCTGGAGGGG + Intronic
925051556 2:819554-819576 GCTCATTCCAGGCCCTACTGTGG + Intergenic
927510682 2:23642257-23642279 GACCATCCCCGGCCCTGCACTGG - Intronic
929454533 2:42056453-42056475 TTCCATCCCAGGCCCTTCTGAGG + Intronic
931272860 2:60717972-60717994 TTCCATTCCTAGGCCTGCAGAGG - Intergenic
937845402 2:126573582-126573604 GTCCAATCCAGACACTGCACTGG - Intergenic
938302436 2:130226683-130226705 CTCCATTCTGGGCTCTGCAGTGG - Intergenic
938454248 2:131447568-131447590 CTCCATTCTGGGCTCTGCAGTGG + Intergenic
939436450 2:142183397-142183419 GTTCATTCCAGACCATGCATAGG - Intergenic
939728724 2:145755127-145755149 CTCAATTCCAAGCTCTGCAGAGG - Intergenic
939975626 2:148714211-148714233 CTCCATTCATGTCCCTGCAGAGG + Intronic
944610227 2:201396457-201396479 ATACATTCCACGACCTGCAGTGG + Intronic
946180488 2:217946062-217946084 TTCCAGTCCAAGCTCTGCAGTGG + Intronic
946251612 2:218417569-218417591 ATACATTCCAGGACCCGCAGTGG - Intergenic
948102236 2:235384458-235384480 GTACATTCCAGTCCCTGCCAGGG + Intergenic
948869713 2:240791916-240791938 CCCCATCCCAGGCCCTGCACTGG + Intronic
949041255 2:241850948-241850970 GGCCATTGCAGGCCGTCCAGGGG - Exonic
1169797206 20:9476080-9476102 ATCCATTCCAGGCCTTGCTTTGG - Intronic
1170866099 20:20159651-20159673 TTACAGTCCAGGCCATGCAGAGG - Intronic
1172218356 20:33252475-33252497 GCCTGTTCCAGGCCCTGCATGGG - Intergenic
1172448675 20:35006617-35006639 CTCCATGCCAGGCCCTGGTGGGG - Intronic
1173869033 20:46330374-46330396 GTCCTTCCCGGGCCCTGCAGAGG + Intergenic
1174522232 20:51140749-51140771 GTCAAAGCCAGGACCTGCAGAGG + Intergenic
1176110603 20:63408929-63408951 GTGGGCTCCAGGCCCTGCAGTGG - Intronic
1179114917 21:38482109-38482131 GTCCCTTCCAGGCCATGGATGGG - Intronic
1179190042 21:39115780-39115802 GTGCGTTCCAGCCCCTGCGGAGG + Intergenic
1179354538 21:40646784-40646806 ATCTCTTCCAGGCCCTCCAGGGG + Intronic
1180985486 22:19901737-19901759 GGCCATTCACGGCCCAGCAGGGG + Intronic
1183179358 22:36248332-36248354 GGCCATTCAAGGCTATGCAGGGG + Intergenic
1183574990 22:38682260-38682282 ATCCATTCCTGGCCCCGCTGCGG - Intronic
1184247788 22:43244499-43244521 CTCCCTTCCAGGCCCAACAGAGG - Intronic
1184333098 22:43838264-43838286 TTCCATTCCAGCCCCTGAGGAGG - Intronic
1184607920 22:45584948-45584970 TTCTATGCCAGGCCCTGCACTGG + Intronic
1184713680 22:46268204-46268226 GTCCCTTCCAGGCGTTGCCGCGG - Intronic
1184715155 22:46277769-46277791 GTGCATTCCAGGCCGGGCAGGGG + Intronic
1185018226 22:48358128-48358150 TCCCATTCCTGGCCCGGCAGTGG - Intergenic
1185087594 22:48749177-48749199 GTCCACTCCAGGCCCCCTAGGGG - Intronic
950521425 3:13500183-13500205 GGCCATCCCAGGGGCTGCAGGGG + Intronic
950627002 3:14254532-14254554 GGCCATTGCAGGCCCTGCTGAGG - Intergenic
952529830 3:34252022-34252044 GTTCATTCCAGGACCTTCAAAGG + Intergenic
953493865 3:43370281-43370303 GTTAAATGCAGGCCCTGCAGTGG + Intronic
955200824 3:56850741-56850763 ATCCATTCCAGGCCTTCAAGGGG + Intronic
956452645 3:69389697-69389719 CTCCACTCCAGGGACTGCAGTGG + Intronic
959365893 3:105457199-105457221 CTCCATTCCTGTCCCTGCAAAGG + Intronic
959735077 3:109648740-109648762 GTCCATTCCAGGCCCTGTTCTGG - Intergenic
960986851 3:123286443-123286465 GTCCCTTCCATGCCCAGTAGAGG + Intronic
961749647 3:129087760-129087782 CCCAAGTCCAGGCCCTGCAGGGG + Exonic
962311137 3:134327602-134327624 GTCCATGCCAAGCCTGGCAGTGG + Intergenic
965455631 3:168896546-168896568 ATCCATTCCTGGACCTGGAGTGG + Intergenic
967959505 3:194909181-194909203 GCCCCCTCCAGGCCCAGCAGAGG + Intergenic
968380333 4:89841-89863 GTCTATTCCAGGTCCTGCTTTGG + Intergenic
968908308 4:3464403-3464425 GTGCAGTCCAGGCCCTGCAAGGG - Intronic
969464036 4:7344205-7344227 TTCCATCCCAGGCCCTGCACTGG - Intronic
973128981 4:46625739-46625761 GGCCATTTCAAGACCTGCAGTGG + Intergenic
974389127 4:61242275-61242297 GTACATTCGTTGCCCTGCAGAGG + Intronic
975557769 4:75681407-75681429 GTACATTCCAGGACCCTCAGTGG + Intronic
979586087 4:122419220-122419242 CTCCATCCATGGCCCTGCAGAGG - Intronic
982136127 4:152275885-152275907 GACCATTCGAGGCCCTGGAATGG - Intergenic
982224838 4:153155878-153155900 CTCCCTGCCTGGCCCTGCAGTGG - Intronic
982788908 4:159567613-159567635 TTCCATCCCAGTCCCTGCAAAGG + Intergenic
983638398 4:169921459-169921481 TTCCATTCCAAGCCATGGAGCGG - Intergenic
985147126 4:186904979-186905001 CTCCACTACAGGCCCTGTAGCGG - Intergenic
985549573 5:526128-526150 GCCCTGTCCAGACCCTGCAGTGG - Intergenic
987471252 5:18331279-18331301 GTCCATTCATGTCCCTGCAAAGG + Intergenic
990183671 5:53190636-53190658 GTCCACTCCACACCCTGCAGTGG + Intergenic
991317093 5:65320849-65320871 GTCCATCCAAGTCCCTGCAAAGG + Intronic
996602642 5:125283357-125283379 TTCCATTTCAGGCCCTGCTTGGG + Intergenic
997911127 5:137874501-137874523 ATCCATTCAGAGCCCTGCAGGGG - Intronic
998424242 5:142013181-142013203 GTCTGTTCCAGGGCCTGCCGGGG - Intergenic
1002069789 5:176672337-176672359 GTCCTCTGCAGGACCTGCAGGGG - Intergenic
1002635278 5:180604395-180604417 CTCCATTCCTGGCCCTCCTGCGG + Intronic
1004823263 6:19392971-19392993 CTCCATTCATGTCCCTGCAGAGG + Intergenic
1005693819 6:28333144-28333166 TTTCATTCCAGGACCTGCAGTGG + Intronic
1006434762 6:34020363-34020385 GTCCAGGGCAGGGCCTGCAGGGG - Intronic
1006625893 6:35397489-35397511 GACCATTCCAGACCCTTCAAAGG - Exonic
1006736438 6:36276810-36276832 GCACATACTAGGCCCTGCAGAGG + Intronic
1006801003 6:36759630-36759652 GTCCACTCCAGGCTCTGGGGTGG + Intronic
1013414625 6:109913503-109913525 GTCCATTGCAGGCCCTGACCAGG + Intergenic
1014451993 6:121592485-121592507 TTCCTTTCTAGACCCTGCAGGGG - Intergenic
1016614218 6:146028353-146028375 GTCCCTTGCAGGCCCTGCCAGGG + Intronic
1016759874 6:147725361-147725383 GGTCAGTCCAGGCCCTGCTGAGG - Intronic
1016862108 6:148731093-148731115 GCCCCTTCCAGGCCTTGCACCGG - Intergenic
1017989461 6:159473500-159473522 GTCCATATGAGGCCCTGGAGAGG + Intergenic
1018430322 6:163716788-163716810 GCCCATGACAGGCCCTGCTGGGG + Intergenic
1018688193 6:166319543-166319565 GCCCATTCCAGGAAGTGCAGGGG - Intergenic
1019171972 6:170137825-170137847 GACCAGACCAGGCGCTGCAGAGG + Intergenic
1019385758 7:755187-755209 GGCCCTTCCAGGCCTCGCAGGGG + Intronic
1019521820 7:1464125-1464147 GTCCCTTCCACGCTCTGCAGGGG - Intergenic
1020761556 7:12273353-12273375 ATACATTCCAAGCCCTCCAGTGG - Intergenic
1021910865 7:25385004-25385026 GCCCAGTCCCAGCCCTGCAGGGG - Intergenic
1022313593 7:29221760-29221782 CTCCATTCATGTCCCTGCAGAGG + Intronic
1022341552 7:29473105-29473127 ATCCATACCATGCCCTGCAGGGG - Intronic
1025181032 7:56824045-56824067 GTCAATTTCGGGGCCTGCAGAGG + Intronic
1026028954 7:66772408-66772430 GCCATTTCCAAGCCCTGCAGTGG - Intronic
1026868867 7:73838813-73838835 GTCTCTGCCAGGCCCAGCAGAGG - Intronic
1029160709 7:98549437-98549459 GTCCATTGCAGGAGATGCAGGGG - Intergenic
1029599679 7:101556334-101556356 CTCTACTCCAGGCCCTGCAGAGG - Intronic
1031161177 7:118170469-118170491 CTCCACTCAAGGCTCTGCAGTGG - Intergenic
1031292901 7:119960992-119961014 ATTCATTCCAGGGCCTCCAGTGG - Intergenic
1032911719 7:136439791-136439813 ATCCATTCATGGCCCTGCAAAGG + Intergenic
1033311445 7:140264825-140264847 CTCCTTTCCAGGCAATGCAGGGG + Intergenic
1033556171 7:142490094-142490116 GAGCATGCCAGGCCATGCAGTGG + Intergenic
1033558535 7:142509540-142509562 GAGCATGCCAGGCCATGCAGTGG + Intergenic
1034159480 7:148982654-148982676 TGCCTTTCCAGGCTCTGCAGTGG - Intergenic
1034211300 7:149365421-149365443 GTCAATCCCAGGCCCTGAATGGG + Intergenic
1034269817 7:149798059-149798081 GTCTCTGCCAGGCCCTGCAGAGG - Intergenic
1035781202 8:2229468-2229490 CTCCAGTCCAGCCCCTGCAGCGG + Intergenic
1036069564 8:5425675-5425697 GTCCAATCCACTGCCTGCAGGGG - Intergenic
1036743606 8:11388865-11388887 CTCCTCTCAAGGCCCTGCAGTGG + Intergenic
1038137446 8:24802948-24802970 GTGCATTCCAGGCAGTGCAAAGG - Intergenic
1039824401 8:41160958-41160980 TTACTTTCCAGGCTCTGCAGTGG + Intergenic
1040686063 8:49874846-49874868 GTATATTCCAGAGCCTGCAGAGG + Intergenic
1041341465 8:56850931-56850953 GTCCATTCATGTCCCTGCAAAGG - Intergenic
1041870585 8:62630209-62630231 ATGCATTCCACGACCTGCAGTGG - Intronic
1042586138 8:70340772-70340794 GTCCATTCATGTCCCTGCAAAGG - Intronic
1044927882 8:97224580-97224602 GGCCATTCCTGACCCTGTAGGGG - Intergenic
1046179289 8:110622129-110622151 CTCCATTCCTGTCCCTGCAAAGG - Intergenic
1048359600 8:133686507-133686529 TTACATTCCAAGCCCCGCAGGGG - Intergenic
1048442426 8:134469788-134469810 GTCCTGTCCTGGCCTTGCAGGGG - Intergenic
1048867084 8:138769185-138769207 CTGCACGCCAGGCCCTGCAGGGG - Intronic
1049543842 8:143220543-143220565 GTGCATTCCAGAGCCTGCTGGGG - Intergenic
1051782119 9:20700869-20700891 TTCCATGCCAGACCCTGAAGGGG + Intronic
1053021978 9:34701431-34701453 CTCCCTTCCTGGGCCTGCAGGGG + Intergenic
1055941150 9:81651320-81651342 AACCATCCCAGGTCCTGCAGTGG + Intronic
1060198034 9:121635802-121635824 CTGCCTGCCAGGCCCTGCAGGGG - Intronic
1060215557 9:121736502-121736524 GCCCTTCCCAGGCCCGGCAGCGG - Intronic
1060416494 9:123434554-123434576 CTCAGTGCCAGGCCCTGCAGTGG + Intronic
1061134954 9:128728518-128728540 GCCAGGTCCAGGCCCTGCAGGGG + Intergenic
1061303215 9:129718220-129718242 GTCCAGCCAAGGCCCAGCAGGGG - Intronic
1061574370 9:131496885-131496907 CTCCATACCCTGCCCTGCAGGGG + Exonic
1062017005 9:134296057-134296079 GTCCTTTCCAGCCCTTGCACCGG + Intergenic
1062522511 9:136964122-136964144 GACCATCCCAGGCCTGGCAGGGG + Intergenic
1062580970 9:137229092-137229114 GGCCATTCCCACCCCTGCAGGGG + Exonic
1062638007 9:137501561-137501583 GTCCAGTCCAGGCCCTCCTCTGG + Intronic
1187254118 X:17626476-17626498 GTCCATTCCAGGGCTGGCTGGGG - Intronic
1187258923 X:17667483-17667505 GTGCATTCCAGGCCCTGTGGAGG - Intronic
1188096746 X:26032960-26032982 GTACATTGCAGGCCAGGCAGAGG + Intergenic
1194565552 X:95483781-95483803 GTCTCTTCCAGGCCCTCCAATGG - Intergenic
1195702431 X:107715519-107715541 CCCCAGTCCAGGCTCTGCAGAGG + Intronic
1196031582 X:111098950-111098972 GTCCATTCCAGGCCCTGCAGAGG - Intronic
1199704277 X:150410559-150410581 CTCCATTCCAGTCCTAGCAGAGG - Intronic