ID: 1196034762

View in Genome Browser
Species Human (GRCh38)
Location X:111132219-111132241
Sequence TGTCACCCATAGGAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196034755_1196034762 30 Left 1196034755 X:111132166-111132188 CCAGCTAAAGAGTAACGAAGTCA 0: 1
1: 0
2: 1
3: 1
4: 58
Right 1196034762 X:111132219-111132241 TGTCACCCATAGGAGGTGGATGG 0: 1
1: 0
2: 0
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196034762 Original CRISPR TGTCACCCATAGGAGGTGGA TGG Intronic
905363484 1:37436003-37436025 TGTCTCCCGTAGGAGGTGCCTGG - Intergenic
907741482 1:57170422-57170444 TGTGACACATAAGAGATGGAGGG + Intronic
908845507 1:68320565-68320587 TTTCTCCCATATGAAGTGGAAGG - Intergenic
911146730 1:94559649-94559671 TGTCAGGCAAAGGCGGTGGATGG - Intergenic
911921020 1:103761389-103761411 TGGGACCCAAAGGAGGTGGGAGG - Intergenic
912554900 1:110508739-110508761 TGTCACCCTTAGGAGGGCAATGG + Intergenic
912707725 1:111927344-111927366 TCACACCCATAGGTGGAGGAGGG + Intronic
914728425 1:150348786-150348808 TTTCACCCAATGGAGGAGGAGGG - Intronic
916842248 1:168612733-168612755 AGTCACCAATGGGAGGAGGAAGG + Intergenic
918657611 1:187047608-187047630 TGTCACCCTTAAGAGGGGGATGG - Intergenic
922786962 1:228287619-228287641 GGTCCCCTATAGGTGGTGGAGGG - Intronic
1065628273 10:27653339-27653361 TGTCAGACAAAGGAGGTGCAGGG - Intergenic
1067251439 10:44590044-44590066 TGTCTGCCAAAGGAGGTGGGAGG + Intergenic
1068560056 10:58504315-58504337 TGTCAGCCATAAGAGGAGGTTGG + Intergenic
1069072609 10:64005237-64005259 GGACCCCCATAGCAGGTGGATGG + Intergenic
1069612931 10:69787376-69787398 TGTGACAGATAGAAGGTGGAGGG + Intergenic
1071428259 10:85581295-85581317 TACCACCCAGAGGAGGTGAATGG - Intergenic
1071734529 10:88283414-88283436 TGTCCTCCAAAGGAGGGGGAGGG - Intronic
1072617523 10:97059598-97059620 TGTGACATCTAGGAGGTGGAGGG - Intronic
1075221351 10:120587770-120587792 TGTCACCTACAGGAGATGCAGGG + Intronic
1076105232 10:127817054-127817076 TGTCCCCAAGAGGAGGAGGATGG + Intergenic
1076181906 10:128415915-128415937 TTTCACCCATAAGAGCTGGGTGG + Intergenic
1076278993 10:129229420-129229442 TGGCACCCTTAGAGGGTGGATGG + Intergenic
1076915067 10:133419359-133419381 TGTCACCCACAGGAGGTGCCTGG + Intronic
1078160784 11:8837969-8837991 TGTCACCCTTGGGATGTGGGAGG - Intronic
1078731037 11:13974298-13974320 AGTAACACATAGCAGGTGGATGG + Intronic
1079683546 11:23327663-23327685 TGTCACTCAGACGGGGTGGAGGG + Intergenic
1080513708 11:33000869-33000891 AGGCACCTATAGGAGGTGGCTGG + Intergenic
1080837154 11:35949819-35949841 TGGCACCCAGAGGAGGACGATGG + Intronic
1081721614 11:45293779-45293801 TGCCACCCGGAGGATGTGGAGGG + Intergenic
1082986249 11:59172921-59172943 TGTCACCAAGAGGTGGTGGTGGG + Intronic
1083443140 11:62690028-62690050 TCTCCCCCAGAGGAGGGGGATGG - Intergenic
1084097327 11:66920307-66920329 TGTTGCCCATAGGAGGGTGACGG - Intronic
1085253784 11:75160535-75160557 AGGCTCCCAGAGGAGGTGGAGGG - Intronic
1088579500 11:111300839-111300861 TTTCACCCATGGGGGATGGATGG - Intronic
1088580657 11:111312586-111312608 TGTCACTTGTAGGAGGAGGAGGG - Intergenic
1091278337 11:134367420-134367442 TGTAAGCCATAGGGGGTGCAAGG + Intronic
1092681493 12:10987571-10987593 TGACACCCCTAAGAGATGGAAGG + Intronic
1096024655 12:48350686-48350708 GGTCACCCATAGGGGCTGGGAGG - Exonic
1096462345 12:51829015-51829037 CGTCACCCATAGGGGAGGGAAGG + Intergenic
1097187118 12:57201958-57201980 TGGCACCCCTGGCAGGTGGAGGG + Intronic
1099140577 12:78969407-78969429 TAACATCCAGAGGAGGTGGAGGG + Intronic
1099606700 12:84811644-84811666 TGACAACCCTAGGAGGTTGAGGG + Intergenic
1101901511 12:108794315-108794337 TGTCACCCACACGGGGTGGTGGG - Intronic
1104755641 12:131267715-131267737 TGTCTCTCATGGGAGGTGGTTGG - Intergenic
1105292763 13:19062982-19063004 TGTCACCCAGAGGACAGGGAAGG + Intergenic
1107120162 13:36787436-36787458 TGTTACCCATAGGAGAAGAACGG + Intergenic
1111363441 13:87207768-87207790 TGTCAGCCAGTGGAAGTGGAAGG - Intergenic
1112336624 13:98522143-98522165 AGTTACCCAGAGGAGGGGGAGGG - Intronic
1112388684 13:98963163-98963185 TGGCCCCCATGGGAGGTGTAGGG - Intronic
1114078858 14:19184170-19184192 GGTCACCCATAGTAAGTGAAGGG + Intergenic
1114124583 14:19710014-19710036 GGTCACCCATAGTAAGTGAAGGG - Intergenic
1117324569 14:54657235-54657257 TGTCACAGATAGGTGGTAGATGG - Intronic
1118612037 14:67548969-67548991 TATAATCCATATGAGGTGGAAGG - Intronic
1118857315 14:69633867-69633889 TGTGAACCATTGGAGGTGAAAGG + Intronic
1118895033 14:69938727-69938749 TGTTCCCCAAAGGAGGTGAATGG - Intronic
1119866753 14:77980894-77980916 TGTTAACCCTAGGAGGTGGGTGG + Intergenic
1121556546 14:94842110-94842132 TAGAACCAATAGGAGGTGGATGG - Intergenic
1122324270 14:100873369-100873391 TGTGACCCATGGGTGGAGGAGGG - Intergenic
1122924079 14:104891833-104891855 TGTCACCCAGAGGTGGAGGGAGG + Intronic
1127702145 15:61512113-61512135 TGTCTCCCTCAGCAGGTGGAGGG - Intergenic
1128343703 15:66840818-66840840 TGTCACACTTAGGTGGTGCAAGG - Intergenic
1128666930 15:69545157-69545179 CCTCACCCCTAGGAGATGGAGGG + Intergenic
1128794051 15:70451965-70451987 CATCACCAAGAGGAGGTGGAGGG - Intergenic
1133982049 16:10640148-10640170 TGTCACACGGAGGAGGAGGAGGG - Intronic
1135151263 16:20008295-20008317 AGTTACCCATGGGAGGGGGATGG + Intergenic
1137474734 16:48797956-48797978 TGTGGCCAAGAGGAGGTGGAAGG - Intergenic
1137474754 16:48798105-48798127 TGTGGCCAAGAGGAGGTGGAAGG - Intergenic
1137949646 16:52771493-52771515 TGCCAGCCACAGGAGGAGGAGGG + Intergenic
1138099755 16:54243239-54243261 TGTCACCCATAGGACGAGTGTGG - Intergenic
1138543819 16:57704852-57704874 TGTCACCCAAAAGAAGAGGAAGG - Intronic
1138873596 16:60922968-60922990 TGTCTCCCAGGGGAGGTGGGGGG + Intergenic
1139819908 16:69713163-69713185 TGTCACCAAGGGGATGTGGAGGG - Intronic
1146458657 17:33026261-33026283 TGTCACCCACGGGAGCTGGCTGG - Intronic
1147671551 17:42179857-42179879 TCCCACCCATTGGAGCTGGAGGG - Intronic
1151693702 17:75703228-75703250 TGTCAGCCCCAGGAGCTGGATGG + Intronic
1153473600 18:5472720-5472742 TGTAACCTATAGAAGTTGGAAGG + Intronic
1155847070 18:30721251-30721273 TGTGACCCAGAGAAGGTAGAAGG + Intergenic
1155847101 18:30721677-30721699 TGTGACCCAGAGGAGGTAGAAGG - Intergenic
1161237953 19:3207279-3207301 TGTAACCCGTAGGGGGTGAAGGG - Intronic
1163496145 19:17647655-17647677 TGGCTCCGAGAGGAGGTGGAAGG - Intronic
1168302591 19:55414737-55414759 TGTCTCCCAAAGGATTTGGAAGG - Intergenic
925746210 2:7045760-7045782 GGTCAACCAGAGAAGGTGGACGG + Intronic
926163012 2:10501518-10501540 TGACACCCCCAGGAGGTGGTGGG + Intergenic
926828200 2:16930992-16931014 TCCCACCCTTAGGAGATGGATGG + Intergenic
931543324 2:63353687-63353709 AGACACCTGTAGGAGGTGGATGG - Intronic
934962606 2:98690213-98690235 TGACACCCATAATATGTGGATGG + Intronic
936491768 2:112978369-112978391 TGTCTCCCCTAGGAGTTCGAAGG - Intronic
937084719 2:119163421-119163443 TGTCACTGCTGGGAGGTGGAAGG + Intergenic
938553455 2:132401878-132401900 TGCCACACATAGTAGATGGAAGG + Intergenic
941045074 2:160665467-160665489 TGTAACCCATTAGAGGTAGATGG + Intergenic
945182303 2:207104450-207104472 TATCACCCATTGAAGGTGGGTGG - Intronic
1172305384 20:33876732-33876754 TCTAACCCAGAGGAGGTTGATGG - Intergenic
1174901796 20:54508432-54508454 TGTCACACATACGAGATGGCAGG + Intronic
1175077296 20:56386637-56386659 TGTCACTGATAAGAGATGGAAGG + Intronic
1178000507 21:28157641-28157663 TCTGGCCAATAGGAGGTGGAGGG - Intergenic
1179419239 21:41222616-41222638 TGAGAGCCATGGGAGGTGGAGGG + Intronic
1179642938 21:42759064-42759086 TGTCACCCTCAGGAGGTGGCTGG + Exonic
1181372565 22:22429899-22429921 TGTGACTCATAGGAGGAGTAGGG + Intergenic
1181590596 22:23882705-23882727 TGGGAGCCATGGGAGGTGGAAGG + Intronic
1182935397 22:34217371-34217393 TGTCAACCACAGGTGGTAGAAGG + Intergenic
1184234338 22:43175005-43175027 TCTGCCCCAGAGGAGGTGGAGGG + Intronic
950087867 3:10273321-10273343 TGGCACCCAAATGAGGTGAATGG + Intronic
953378981 3:42452257-42452279 TGTGACCCCCAGGAGGTGGGTGG - Intergenic
962766447 3:138568129-138568151 AGTCACCCATAGAAGGGGAAAGG - Intronic
966451314 3:180066094-180066116 TGTCCACCATACAAGGTGGAGGG - Intergenic
968921490 4:3524410-3524432 TGTCACCCAGAGGAGGAAGCAGG - Intronic
969532113 4:7735871-7735893 TGTCACAGCTAGGAGGTGGCAGG + Intronic
972933256 4:44101156-44101178 AATCACCCATAAGAGGTGAAGGG + Intergenic
974799042 4:66791688-66791710 TGTCATACCTAAGAGGTGGAGGG - Intergenic
976206706 4:82629219-82629241 TGTCACCCAAAGGAGCATGAAGG - Intergenic
977618806 4:99113536-99113558 TGTCAACAATAGGAGATGGCTGG + Intergenic
982401297 4:154970896-154970918 TGTCACCAAAATGAGGTTGAAGG - Intergenic
984715389 4:182919687-182919709 TGGCAGGCAGAGGAGGTGGAAGG - Intergenic
985702830 5:1383811-1383833 TGTCACCAACAGGAGGTGGGGGG + Intergenic
985712340 5:1436398-1436420 TGTCTCCCCAAGGAGGTGGCAGG + Intronic
985775832 5:1841260-1841282 TGTCACCCAGAGGAGATAGAGGG + Intergenic
986293157 5:6416486-6416508 TTTCACCTAGAGAAGGTGGAGGG - Intergenic
986396570 5:7336387-7336409 TGACACCAATAGGAGGGAGAGGG - Intergenic
987805834 5:22766627-22766649 TGGAACCCACAGGAGTTGGAAGG - Intronic
991468193 5:66937039-66937061 TTTCACTCATTGGAGGTGGAAGG + Intronic
992419647 5:76590126-76590148 TGTCAACCACAGGAGTTAGAAGG - Intronic
999154327 5:149447455-149447477 TGTTACCAAAAGGAGGTGAAAGG + Intergenic
999690950 5:154145420-154145442 AGTCACGCATAAGTGGTGGAGGG - Intronic
1001242374 5:170080448-170080470 TGTCACCCCCAGGAAGTGGTGGG - Intronic
1002186749 5:177458182-177458204 TGTGACCCAGAGGAAGTGGAAGG - Exonic
1002612990 5:180433486-180433508 TCTCACCCTTGGGAGGTGGGAGG + Intergenic
1004954563 6:20714637-20714659 TGTCACCCATATCAGGTGAATGG - Intronic
1006134298 6:31886672-31886694 TGTCTCCCTCAGGAGGAGGACGG - Exonic
1007219533 6:40267605-40267627 TGTCTCCCCTAGAAGCTGGAAGG + Intergenic
1012199831 6:96392166-96392188 TGGCACCCAGAGCAGGGGGAGGG - Intergenic
1018610628 6:165644536-165644558 TGTCACCCAGGGAAGGTGAAGGG + Intronic
1018862749 6:167722878-167722900 TGGGACCCAGAGGAGGTGGCAGG + Intergenic
1020401778 7:7786803-7786825 TGACAGCCATAGGAGGAGGAAGG + Intronic
1023091246 7:36619411-36619433 TGTCACCCATATAAGGAGGAAGG - Intronic
1024103948 7:46062127-46062149 TTACACCAATAGGAGGTTGATGG - Intergenic
1029505462 7:100961108-100961130 CCTCACCCTTAGGAGGTGGCTGG + Intronic
1034885948 7:154799022-154799044 TGTGACCCATTGGAGATGGATGG - Intronic
1035172190 7:157022967-157022989 TGTCACTCACAGCAGGGGGAGGG - Intergenic
1037274698 8:17165485-17165507 TGTCATTCAAAGGAGGGGGAAGG + Intronic
1038214187 8:25546568-25546590 TGTCACCAGTAGAAAGTGGATGG - Intergenic
1038982330 8:32773539-32773561 TGTCACCAATTAGATGTGGAGGG - Intergenic
1039469788 8:37806181-37806203 TTCCATTCATAGGAGGTGGAGGG - Intronic
1040537213 8:48320831-48320853 TGCCACCCATGGGAGGTGGGTGG + Intergenic
1044419578 8:91978773-91978795 TGCAGCCCATAGAAGGTGGAAGG - Intronic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1047574155 8:126134651-126134673 TGTCACCCATTGGAGAGGGGGGG + Intergenic
1047719888 8:127630031-127630053 TGTCTCCCATAGGAGGGAGGAGG - Intergenic
1049098202 8:140561058-140561080 GCTCCCCCGTAGGAGGTGGAAGG + Intronic
1051044319 9:12855269-12855291 AGTCCCAAATAGGAGGTGGAAGG - Intergenic
1053477511 9:38392957-38392979 CGTCACCCAGAGGCGGGGGATGG - Intronic
1055700400 9:78938709-78938731 TGTCACCCCTAGAATCTGGATGG + Intergenic
1061996993 9:134191129-134191151 TGTCCCCCAAAGGGGGTGGTGGG + Intergenic
1062140888 9:134958309-134958331 TGTCACCCAGGGGTGGAGGAAGG - Intergenic
1187319617 X:18227927-18227949 TGTGCCCCAGAGGTGGTGGAAGG + Intergenic
1194659324 X:96612105-96612127 TGTCAGCCAAAGGAAGTGGTAGG - Intergenic
1196034762 X:111132219-111132241 TGTCACCCATAGGAGGTGGATGG + Intronic
1199643360 X:149883323-149883345 TGTCAGCCATGGGAAGTGCAGGG + Exonic
1201718455 Y:17072272-17072294 TGTCAACCATCTGGGGTGGAGGG - Intergenic
1201719502 Y:17081177-17081199 TGTCAACCATCTGGGGTGGAGGG - Intergenic
1202378273 Y:24257115-24257137 TGTCATCCAGAGGAGAGGGAAGG + Intergenic
1202492509 Y:25413006-25413028 TGTCATCCAGAGGAGAGGGAAGG - Intergenic