ID: 1196039736

View in Genome Browser
Species Human (GRCh38)
Location X:111189065-111189087
Sequence GAGTGAGGAAGGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9792
Summary {0: 1, 1: 17, 2: 207, 3: 1516, 4: 8051}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196039736 Original CRISPR GAGTGAGGAAGGAGGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr