ID: 1196042652

View in Genome Browser
Species Human (GRCh38)
Location X:111222214-111222236
Sequence ACCTTGGCAAAGAAGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 0, 3: 47, 4: 332}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196042652 Original CRISPR ACCTTGGCAAAGAAGGAGAG AGG (reversed) Intronic
900690357 1:3977113-3977135 ACCTTGGCCAAGAAGTTGGGTGG + Intergenic
901314294 1:8295315-8295337 AGCTTGGGAGAGAGGGAGAGAGG + Intergenic
901337120 1:8460033-8460055 ACAATGACAAAGAGGGAGAGAGG - Intronic
902055231 1:13595358-13595380 AACTGGGCAATGAAGAAGAGGGG - Intronic
902519800 1:17009829-17009851 ACCTTGGCAAAGAGGAAAAGGGG + Intronic
904853066 1:33473637-33473659 CTCTTGGCAAAGAAGGTGAAGGG - Intronic
905209264 1:36362252-36362274 ACCTTGGCAAAGCAGGATCCGGG + Intronic
905338802 1:37264306-37264328 ACAGTGGCAAAGAAAGAGACAGG + Intergenic
905493725 1:38366214-38366236 ACCTCAACAAAGCAGGAGAGGGG - Intergenic
906516967 1:46445295-46445317 ACCTTGGTCAAGAATCAGAGGGG + Intergenic
908032776 1:60019266-60019288 ACCACGGCAAAGCAGGAGAGAGG - Intronic
908403134 1:63789489-63789511 AACATGGCAAAGAGGGACAGAGG + Intronic
909763637 1:79326033-79326055 ACCTTGGGAAAGAACTAGTGAGG - Intergenic
911145018 1:94542904-94542926 AACGTGGGAAAGAAGGAGAGAGG - Intergenic
912696343 1:111844997-111845019 ACCTGGGCTATGAAGGAAAGGGG - Intronic
913519824 1:119634205-119634227 ATCATAGCAAATAAGGAGAGAGG + Intronic
914358884 1:146913045-146913067 GCCTTTGGAAAGAAGGAGGGAGG - Intergenic
915736713 1:158089851-158089873 GCCTGGGCAAAGAAGCAGGGAGG - Intronic
919020700 1:192101409-192101431 AGCTTGGCACAGAAGGAGGAGGG - Intergenic
919860504 1:201736818-201736840 ACCCAGCCAAAGAGGGAGAGAGG - Intronic
920757753 1:208750638-208750660 ACCATGGTGAAGCAGGAGAGAGG - Intergenic
920997665 1:211010704-211010726 ACCTTGGCAGAGAATGTGAGGGG - Intronic
921883026 1:220275486-220275508 CCCTTGGAAAAGAAGTAGTGTGG + Intergenic
921956849 1:220993767-220993789 ACCTTGTCAAGGAAGGGGAAAGG - Intergenic
923235716 1:232031099-232031121 ACACTGCCAAAGAAGGAGGGAGG + Intronic
924235055 1:241993624-241993646 ACCCTGGCAGAGAAGGTGGGGGG + Intergenic
1063222234 10:3979838-3979860 AGCTTGGAAAAGAAGCAGAATGG + Intergenic
1063303374 10:4874104-4874126 AAGTAGGCAAAGAAGGACAGAGG + Intergenic
1064120334 10:12612625-12612647 ACCTTTGCAAAGAGAGAAAGTGG + Intronic
1064633844 10:17344168-17344190 ACCATGGCAAAGATGCACAGAGG + Intronic
1064687684 10:17880883-17880905 AACTTTGCAAAGAAAGTGAGTGG + Intronic
1065268531 10:24002436-24002458 ATTTTTGTAAAGAAGGAGAGAGG - Intronic
1065708093 10:28489559-28489581 ACCTTGAGAAGGAAGGAGAGAGG - Intergenic
1065772072 10:29087011-29087033 ACATGGGCACAGAAGGAGAAAGG - Intergenic
1065999876 10:31094633-31094655 ATCTTGGCTATGAAGGAAAGAGG - Intergenic
1066096557 10:32077783-32077805 AGCTTGGCAGACAAGGAGAATGG - Intergenic
1067432852 10:46255368-46255390 ACCTTGTCAAGGAGGGAAAGAGG + Intergenic
1067440407 10:46306068-46306090 ACCTTGTCAAGGAGGGAAAGAGG - Intronic
1067933958 10:50592357-50592379 ACCTAGGCAAGCAAGGACAGGGG - Intronic
1068106887 10:52629197-52629219 ACCTTATCAAAGAAGTAGAGAGG + Intergenic
1068509302 10:57944073-57944095 ACATTGACAAAGTAGGAGACAGG - Intergenic
1069484443 10:68812542-68812564 ACCTTGGCTAGGAAGTAGAAGGG + Intergenic
1069807333 10:71134123-71134145 ACGTGGGGAAAGAAGCAGAGAGG - Intergenic
1071635693 10:87251457-87251479 ACCTTGACAAACAAGCAAAGCGG - Intergenic
1071659549 10:87486519-87486541 ACCTTGACAAACAAGCAAAGCGG + Intergenic
1073114386 10:101083086-101083108 ACCTGGGCTAAGACGGAGAATGG + Intergenic
1073127403 10:101159907-101159929 CACTTGGCAGAGATGGAGAGTGG - Intergenic
1073382487 10:103090128-103090150 AAATTGGAAAAGATGGAGAGGGG + Exonic
1074160997 10:110836275-110836297 TCCTTGGCACATAAGGAGGGAGG - Exonic
1074318426 10:112379448-112379470 ACCTTTGCACAGAAGTGGAGGGG + Intronic
1077633433 11:3826192-3826214 ACCTTTGCAAAGGAGGGGAGGGG - Exonic
1078496214 11:11819897-11819919 AACTAGGCAAAGAAGGTGTGTGG + Intergenic
1079015852 11:16868049-16868071 ACCTGGGCAAAGACTTAGAGGGG - Intronic
1079150443 11:17894266-17894288 TCCTTGAGAAGGAAGGAGAGAGG + Intronic
1079162190 11:18005603-18005625 ACCGTGGCAAAGAGGGAGCCTGG + Intronic
1079313171 11:19384598-19384620 ACTTTTGCAAGGAAGGTGAGGGG - Intronic
1080268039 11:30422121-30422143 ACCTGAGCAATGAATGAGAGTGG + Intronic
1080976975 11:37354934-37354956 AACTTGGGAGAAAAGGAGAGTGG + Intergenic
1082865270 11:57894441-57894463 ACCATGGCACAGCGGGAGAGGGG + Intergenic
1083210489 11:61181909-61181931 ACCTTTGCAGAGAGGCAGAGAGG + Intergenic
1083233878 11:61339713-61339735 ACCAAGGCAAAGCAGGAGGGCGG - Intronic
1083736005 11:64681860-64681882 ACCATGCCAGAGAGGGAGAGAGG + Intronic
1084188477 11:67488059-67488081 ATCTTGGCTAAGAAGGGGAATGG - Intronic
1086581703 11:88407644-88407666 ACTTTGGCAGAGAAAGAGATGGG - Intergenic
1087077726 11:94141274-94141296 ACATTGGTAAAGAAGTAGGGCGG - Intronic
1088362372 11:109004412-109004434 ATTTTGGAAAAGAAGAAGAGAGG - Intergenic
1088529503 11:110793321-110793343 ACCTTGTCAAAGAGTGAGAGAGG - Intergenic
1089124854 11:116169685-116169707 AGCTTTGCAGAGATGGAGAGGGG - Intergenic
1089192014 11:116660226-116660248 GCTTTGGCAGAGAAGCAGAGAGG - Intergenic
1089700348 11:120240566-120240588 ACCCTGGAAAAGAATGAGGGTGG + Intronic
1090085393 11:123645815-123645837 ACATTGGAGAAGAAGGAGGGAGG + Intronic
1090186684 11:124743640-124743662 ACCTTGGGAAACATGGCGAGGGG + Intronic
1090324393 11:125872043-125872065 ACCTGAACAAAGAAGGAGAAGGG + Intergenic
1091300630 11:134505008-134505030 ACTTTGGGAAAGATGGAGAGTGG - Intergenic
1091357003 11:134944843-134944865 AGGTTGGGAAAGAAAGAGAGAGG + Intergenic
1091652949 12:2323393-2323415 ACCTTGGCAAAGACCAAGGGAGG + Intronic
1091964128 12:4723603-4723625 ATCTTTGCAAAAAAGGAAAGAGG - Intronic
1092279104 12:7086301-7086323 ACCTGGGCCAAGAAAGAAAGAGG - Intronic
1094745624 12:33341351-33341373 AGTGTGGCACAGAAGGAGAGAGG - Intergenic
1095094837 12:38141196-38141218 CCCTAGGCAGCGAAGGAGAGAGG - Intergenic
1095803961 12:46297658-46297680 AGATTGGCAGGGAAGGAGAGGGG - Intergenic
1095949638 12:47774864-47774886 ACCTTGACAAACATGGAGGGTGG - Intronic
1096487146 12:51990965-51990987 AACTTGTCACAGAAGGACAGAGG - Intronic
1096790835 12:54043792-54043814 AGCTTGGAACAGAAGGAGAGGGG - Intronic
1097068761 12:56339540-56339562 GGCTGGGCAATGAAGGAGAGGGG + Intronic
1099365085 12:81758699-81758721 CCATTGTCAAAGGAGGAGAGGGG + Intronic
1100239398 12:92696206-92696228 ACCTTGGAAAGTAAGGAGATGGG - Intergenic
1101453906 12:104809377-104809399 ACCTTTACCAGGAAGGAGAGTGG + Intronic
1107134930 13:36933415-36933437 AATTTGGCAGAGAGGGAGAGTGG - Intergenic
1107407871 13:40131651-40131673 GCCTTGGCTAAGAAAGAGATAGG + Intergenic
1110148351 13:72221346-72221368 TCCAGGCCAAAGAAGGAGAGGGG - Intergenic
1110701935 13:78559109-78559131 ATCTTGGCAAATCAAGAGAGAGG + Intergenic
1111431476 13:88152286-88152308 GCCTTGGTGAAGCAGGAGAGAGG - Intergenic
1112118328 13:96382158-96382180 ACCTTGTCAATGGAGCAGAGTGG + Intronic
1112571272 13:100595620-100595642 ACCTCGGCAAACAAGGTGACAGG - Intergenic
1113045002 13:106146184-106146206 GGCTTGGGGAAGAAGGAGAGGGG + Intergenic
1113495305 13:110723601-110723623 TCCTTGGCATATATGGAGAGAGG + Intergenic
1113992886 14:16042321-16042343 CCCTAGGCAACGAGGGAGAGAGG - Intergenic
1114598744 14:23936455-23936477 AGCTTGGCTTAGATGGAGAGAGG - Intergenic
1114649209 14:24272829-24272851 ACTGTGGCAAAGGAGGAGTGTGG - Intergenic
1115876250 14:37865126-37865148 CACTTGGCAGAGGAGGAGAGAGG - Intronic
1115962226 14:38848230-38848252 GCCTTTTCAAAGAAGGACAGAGG - Intergenic
1115974788 14:38984814-38984836 ACCTAGACAAAGAAGGGGATGGG + Intergenic
1118616955 14:67580531-67580553 ACATTGGCAAAGAAGGTATGTGG - Intronic
1119135195 14:72211857-72211879 ACCTTGGAAAATAAGGGAAGGGG + Intronic
1119380863 14:74227410-74227432 ACCTAGGTCAAGAAGTAGAGTGG + Intergenic
1119739900 14:77007617-77007639 TCCTTGGCAGGGAAGAAGAGAGG + Intergenic
1124696470 15:31868680-31868702 AGCTTGGTGGAGAAGGAGAGGGG - Intronic
1125265582 15:37876545-37876567 ACCATTGCAGAGGAGGAGAGAGG - Intergenic
1125747237 15:42005274-42005296 CCCTTGGGAAGGCAGGAGAGCGG - Intronic
1126103783 15:45135040-45135062 ACCTAGGGTAAGAAGGAAAGTGG + Intronic
1126351191 15:47746463-47746485 ACCCTGGCAAAGAAGGACTGAGG - Intronic
1127709677 15:61583934-61583956 ACCTTGGGCAAGAGGGAGAGTGG + Intergenic
1128680680 15:69649187-69649209 GCTCTGGCAGAGAAGGAGAGAGG + Intergenic
1128768668 15:70266233-70266255 ACACTGGCAGAGATGGAGAGGGG - Intergenic
1128973274 15:72128083-72128105 ACGTTTTCAAAGAAAGAGAGAGG + Intronic
1129516836 15:76162192-76162214 ACCTTGTCAAAGATGGTGAGGGG + Intronic
1130067156 15:80614249-80614271 TCCTTGGGAAAGATGGAAAGTGG + Intergenic
1130195006 15:81771384-81771406 ACCTAGGGAGGGAAGGAGAGAGG + Intergenic
1131888080 15:96941412-96941434 ACCTTCGCTAAGAAGAAGACAGG - Intergenic
1131987649 15:98061221-98061243 ACTTGAGCAAAGAAGGAGATTGG - Intergenic
1133115515 16:3576090-3576112 ACCCTGGGACAGAAGAAGAGGGG + Intronic
1133481065 16:6171173-6171195 ATATAGACAAAGAAGGAGAGAGG - Intronic
1133485289 16:6214165-6214187 ACAGTGGGAGAGAAGGAGAGAGG - Intronic
1133519544 16:6543662-6543684 ACCTTGGCAGGGGAGGAGAGAGG + Intronic
1133989040 16:10690710-10690732 ACCTGGGCAGAGCAGAAGAGAGG + Intronic
1135206277 16:20486961-20486983 AAGTAGGGAAAGAAGGAGAGAGG + Exonic
1136909609 16:34135083-34135105 ACCTTGGAAGAGATGGAGGGAGG - Intergenic
1136912254 16:34154073-34154095 CCCTAGGCAACGAGGGAGAGAGG - Intergenic
1138512406 16:57516237-57516259 ACCTTGGCCAGGGAGGAGTGGGG - Intronic
1140986252 16:80160597-80160619 ACGTTGGAAAAGAAGAAGGGAGG + Intergenic
1141302392 16:82829245-82829267 ACCCTGGGGTAGAAGGAGAGGGG - Intronic
1141408205 16:83813097-83813119 CCCAAGGCAAAGCAGGAGAGGGG + Exonic
1144006004 17:11100186-11100208 ACCTTGGCAAAGAAGGGTGTTGG - Intergenic
1144074325 17:11703156-11703178 AACTTGGCTACGAAGAAGAGAGG + Intronic
1144482374 17:15638691-15638713 TCCCTGGCAAGGAAGGAGAGAGG + Intronic
1144916309 17:18726341-18726363 TCCCTGGCAAGGAAGGAGAGAGG - Intronic
1146720148 17:35118467-35118489 TACTTGGGGAAGAAGGAGAGAGG - Intronic
1146951554 17:36910163-36910185 GCATGGGCAAAGAAGGAGAAAGG + Intergenic
1147535472 17:41318414-41318436 ACTTTTGCAATGCAGGAGAGTGG + Intergenic
1147605735 17:41772785-41772807 ACCTTTGCAGAGAGAGAGAGGGG - Intronic
1148234914 17:45962300-45962322 ACCTGGGGAAAGAAGAGGAGAGG - Exonic
1148566767 17:48637521-48637543 ATTTGGGCCAAGAAGGAGAGTGG - Intergenic
1148628435 17:49088311-49088333 ACCATGGCAGAGCAGGAGAGAGG + Intergenic
1148707590 17:49649291-49649313 ACTTTGGGAACCAAGGAGAGCGG + Intronic
1149493960 17:57105420-57105442 ACCTGGGGAGAGCAGGAGAGCGG - Exonic
1149623949 17:58066500-58066522 ACCATGGGAAAGGAGGAGAATGG + Intergenic
1149911779 17:60573450-60573472 ACCTTGCCAAAGAGGTAAAGAGG - Intronic
1150408390 17:64921720-64921742 ACTTTGGGAAAGAAGGAGCCGGG + Intergenic
1150994153 17:70296821-70296843 AGCTTGGGAAGGGAGGAGAGAGG + Intergenic
1152253669 17:79225182-79225204 AACTTTCCAAAGAGGGAGAGAGG - Intronic
1152347008 17:79759186-79759208 ACTCTGACAAAGAAAGAGAGAGG + Intergenic
1154497669 18:14974456-14974478 AGGTTGGGAAAGAAAGAGAGAGG - Intergenic
1155393531 18:25362528-25362550 GGCTTGGCAAAGAAGGAAAATGG + Intergenic
1157325951 18:46668986-46669008 GCCTGAGCAAAGCAGGAGAGCGG - Intronic
1157476570 18:48027804-48027826 AACTTGGCAAGAAAAGAGAGGGG + Exonic
1158147833 18:54335769-54335791 ACCATGGCAGAACAGGAGAGAGG - Intronic
1158489677 18:57898643-57898665 CCCTGGGCAGAGAAGGAGAGAGG - Intergenic
1159882256 18:73869242-73869264 AAGCTGGCAAAGTAGGAGAGGGG - Intergenic
1160097602 18:75889707-75889729 AGTCTGCCAAAGAAGGAGAGAGG - Intergenic
1161342324 19:3750117-3750139 ACCTTGGAGGAGAGGGAGAGAGG - Exonic
1161496773 19:4590863-4590885 ACCTTGGGAATGAAGGAGGACGG - Intergenic
1162797672 19:13095196-13095218 GCCTTGGCAGAGAGGGAGGGAGG - Exonic
1163149742 19:15403925-15403947 ACCTTGGCCAAGCAGGGCAGTGG + Intronic
1164640484 19:29821614-29821636 ACCCTGGCATGGAAAGAGAGAGG - Intronic
1164892276 19:31834537-31834559 ACCTTGGCAGAGAGAGGGAGGGG - Intergenic
1165080938 19:33305631-33305653 ACTCTGGCCAAGACGGAGAGGGG + Intergenic
1167505776 19:49870290-49870312 TCCTAGGCCAAGAAGGGGAGAGG - Intronic
1168171246 19:54591231-54591253 ACCATGTCAAAGCAGGAGAGGGG - Intronic
1168655491 19:58124658-58124680 ACCATGGCAGAGCAGGAAAGAGG + Intergenic
925243904 2:2362090-2362112 GCGTGAGCAAAGAAGGAGAGGGG + Intergenic
925653085 2:6113229-6113251 ACCATGGGAATGAATGAGAGGGG + Intergenic
926780795 2:16469974-16469996 ACCTGGGCAAAGAGAGAGAATGG + Intergenic
927271515 2:21215176-21215198 ACGATGGCATAGAAGGAGAGGGG - Intergenic
927276066 2:21263473-21263495 ACCTTGGAGAAGAAGGGGAGGGG + Intergenic
927642977 2:24857136-24857158 ACCCTGCCAGAGCAGGAGAGGGG + Intronic
929326059 2:40612401-40612423 ACCTTTTCAAAGTAGTAGAGGGG - Intergenic
929414673 2:41735320-41735342 AAGCTGGCAAAGTAGGAGAGAGG - Intergenic
929945366 2:46367531-46367553 ACCTTGGCAAAGGTGGAGACTGG - Intronic
931157586 2:59652953-59652975 ACTTAGGCAGAAAAGGAGAGTGG - Intergenic
932036790 2:68253225-68253247 ACCTGGGCAAACGAGGAGAAGGG + Intronic
933204941 2:79495947-79495969 ACTATGGCTAAGAAGGGGAGGGG + Intronic
933357781 2:81235072-81235094 ACCTTTGGAGAGAAGGAGAAGGG + Intergenic
933427416 2:82130211-82130233 ACCTGGGTAAAGAATGAGATTGG + Intergenic
935093166 2:99916535-99916557 AGACTGGCAAAGATGGAGAGAGG + Intronic
935487866 2:103680082-103680104 ACCATGGCAGAGCAGGAGAGAGG - Intergenic
937049822 2:118879279-118879301 ACCTTTGAAAAGCAGAAGAGGGG + Intergenic
937504999 2:122526988-122527010 ACCTGGGCATAGAAGGAGGAGGG - Intergenic
938538815 2:132268560-132268582 CCCTAGGCAACGAGGGAGAGAGG + Intergenic
938868387 2:135448758-135448780 AACTTTGTAAAGAAGGGGAGAGG + Intronic
938982760 2:136542202-136542224 ACCTTGGGAAAGAGGAAGAATGG + Intergenic
939994655 2:148908497-148908519 ACCTTAGCGTAGTAGGAGAGGGG + Intronic
940009885 2:149041463-149041485 TCATTGGCAAAGGAGAAGAGGGG + Intronic
942223383 2:173792911-173792933 AACTTGGAGAAGAAGGAGAATGG + Intergenic
942753034 2:179309311-179309333 ACCATGGCAGAGCAGGGGAGAGG + Intergenic
942944211 2:181656218-181656240 ACAATGGCAAGGAAGGTGAGGGG + Intronic
942951288 2:181724953-181724975 ATCTTGGCAAATAAGGAGGCTGG - Intergenic
943878822 2:193111527-193111549 ACCTTAGAAAAAAAGGGGAGAGG - Intergenic
945061225 2:205910588-205910610 AGCTTGGCTAAGGAGGAAAGTGG - Intergenic
945415120 2:209561282-209561304 AACTTGGCAAAGAAGGTGATTGG + Intronic
946180902 2:217948385-217948407 ATCTTGGGAAGGAAGCAGAGCGG - Intronic
946212519 2:218158523-218158545 ACTTTGGAAGACAAGGAGAGGGG + Intergenic
946238302 2:218339038-218339060 ACCTTGGGAGGGAAGGAGAGAGG - Intronic
947226149 2:227842277-227842299 CCCTTGGCCAATCAGGAGAGAGG + Intergenic
947479549 2:230486171-230486193 ACCATGGCAACCCAGGAGAGAGG + Intronic
947679866 2:232020630-232020652 ACCGTGGCAAACAGAGAGAGAGG + Intronic
948343164 2:237271252-237271274 GCCTTGGGAAAGAAGGACGGGGG + Intergenic
1168893219 20:1307573-1307595 ACCTTGGCAGATAACCAGAGTGG - Exonic
1170021782 20:11844688-11844710 ACAATGGCAAAGAAAGAGAGAGG + Intergenic
1171267432 20:23783057-23783079 ACCATGAAAAAGAAGGAGATGGG - Intergenic
1171280289 20:23890368-23890390 ACCATGAAAAAGAAGGAGATGGG - Intergenic
1171402987 20:24891614-24891636 ACCTAGGCAAAGGGGGAGTGTGG + Intergenic
1171771428 20:29325674-29325696 ACCTTGGAAGGGAAGGAGGGAGG + Intergenic
1171812139 20:29753454-29753476 CCCTAGGCAACGAGGGAGAGAGG + Intergenic
1171907545 20:30912223-30912245 CCCTAGGCAACGAGGGAGAGAGG - Intergenic
1172765498 20:37348589-37348611 CACTTGGCAAAGAAGGGGAGAGG + Intronic
1172820065 20:37724755-37724777 ACATTGACAAATAAAGAGAGGGG - Intronic
1172824718 20:37771585-37771607 ACCTTTGCAGAGCAGGAGATAGG - Intronic
1172917934 20:38457866-38457888 AACTGAGCAAAGGAGGAGAGTGG + Intergenic
1174747232 20:53075537-53075559 ACCTTGGCAAACACAGAGAGGGG + Intronic
1175055104 20:56190874-56190896 ACCCTTACAAAGCAGGAGAGGGG + Intergenic
1175719704 20:61278685-61278707 ACTTTGGGAGAGAAGGGGAGTGG + Intronic
1175746794 20:61462672-61462694 ACCTAGGGAAGGAGGGAGAGGGG - Intronic
1176552718 21:8235989-8236011 CCCTAGGCAACGAGGGAGAGAGG - Intergenic
1176571616 21:8418392-8418414 CCCTAGGCAACGAGGGAGAGAGG - Intergenic
1176579528 21:8462955-8462977 CCCTAGGCAACGAGGGAGAGAGG - Intergenic
1178126881 21:29525894-29525916 CACATGGCAAAGCAGGAGAGAGG + Intronic
1179398107 21:41059795-41059817 TCCTTGGAGAAGAAGGACAGAGG - Intergenic
1179433041 21:41338151-41338173 AAATAAGCAAAGAAGGAGAGGGG - Intronic
1180314384 22:11265198-11265220 CCCTAGGCAACGAGGGAGAGAGG + Intergenic
1180340975 22:11618353-11618375 CCCTAGGCAAAGAGTGAGAGAGG - Intergenic
1181849820 22:25742100-25742122 ACATTGGCCCAGAAGGAGGGTGG + Intergenic
1183455819 22:37922513-37922535 ACAATGGCACAGATGGAGAGGGG - Intronic
1184080553 22:42216524-42216546 ACCTGGGAATTGAAGGAGAGTGG - Intronic
1184855003 22:47142063-47142085 ACCTTGGCAAAGAGCCACAGGGG - Intronic
1203257697 22_KI270733v1_random:152391-152413 CCCTAGGCAACGAGGGAGAGAGG - Intergenic
949356233 3:3183127-3183149 TTCTTGGCAAGGAAGGAAAGAGG - Intergenic
949542829 3:5047370-5047392 ACTCTGGAAAAGAAGGAGATGGG - Intergenic
950150774 3:10685572-10685594 TCCTGGGCAGAGAAGAAGAGGGG + Intronic
951230359 3:20171693-20171715 ACCTTGGTATTGAAAGAGAGAGG - Intronic
952507292 3:34018551-34018573 ACATTGTGAAGGAAGGAGAGAGG + Intergenic
952529860 3:34252368-34252390 AGCTTGGCATAGAAGAAGTGAGG - Intergenic
953137752 3:40197869-40197891 ATATTGGCAAACAATGAGAGTGG - Intronic
953422612 3:42766098-42766120 AACTATGCAGAGAAGGAGAGGGG + Intronic
953660121 3:44885710-44885732 TCCTTGGCTAAGCAGGGGAGGGG + Intronic
954277179 3:49550117-49550139 CCCTTGGTAAAGCAGGAGAAAGG - Intergenic
954461614 3:50630056-50630078 GCCTTGGCCTAGAAGGGGAGTGG + Intronic
954637325 3:52078182-52078204 ACCTTGGCAGAGAAGGAACAGGG - Intronic
958506036 3:94978227-94978249 AACTTAGCAAAGAAGGTGAAAGG - Intergenic
960607983 3:119527985-119528007 CCCTTGGCAAAGAGGTAAAGAGG - Intronic
960722999 3:120642892-120642914 ATCATGGCAAAGAGGGAGAATGG + Intronic
960986567 3:123284835-123284857 CCCCTGACACAGAAGGAGAGGGG + Intronic
961830683 3:129621568-129621590 ACAGTGGCACAGAAGGAGTGTGG - Intergenic
962279354 3:134038624-134038646 ACCTGGGCAAATAAAGAGAGGGG - Intronic
962685648 3:137845193-137845215 ACCCTGCCTATGAAGGAGAGGGG + Intergenic
963012304 3:140782082-140782104 GTCTTGCCAGAGAAGGAGAGAGG - Intergenic
963128066 3:141833496-141833518 ACCTTATCAAAGCAGGAGATGGG - Intergenic
963231001 3:142908819-142908841 ACCATAGCAAAGGAAGAGAGGGG - Intergenic
964419352 3:156485365-156485387 ACAATGGCAAAGAACAAGAGAGG - Intronic
965810352 3:172585372-172585394 ATGTTAGCAAAGAAGGAGAAAGG - Intergenic
966270394 3:178097784-178097806 AACTTGGCATGAAAGGAGAGAGG + Intergenic
966877075 3:184328566-184328588 ACGTTGCCCCAGAAGGAGAGTGG + Intronic
967595831 3:191326105-191326127 ACCTTGGCAAAACAGGAAAGGGG - Intronic
968757203 4:2423042-2423064 ACCCTGGCGAAGATGGGGAGTGG + Intronic
969184576 4:5465785-5465807 GACCTGGCCAAGAAGGAGAGAGG - Intronic
969681670 4:8646588-8646610 ACCTTGGCAAAAACGCACAGAGG - Intergenic
970833293 4:20369122-20369144 ATCTTGGGAAAGAAAGAGAAAGG - Intronic
971582291 4:28357262-28357284 AGATGGGCAAAGAAGGAGATGGG + Intergenic
972710319 4:41588853-41588875 AACTTAGCAAAGAAGGAGGGAGG + Intronic
972837719 4:42893914-42893936 TCCTTAGCAAAGAAGTAGACAGG - Intronic
974186544 4:58454585-58454607 AGCATGGCAAAGAAAGAGAGAGG - Intergenic
974274490 4:59700297-59700319 ACCTGGTCAAAGAAGGTAAGTGG + Intergenic
975681664 4:76883411-76883433 ACCATGGCAGAGCAGGAGAGAGG - Intergenic
976301970 4:83523843-83523865 ACCGTGGAAGAGATGGAGAGGGG + Intergenic
976696919 4:87926780-87926802 ACCTAGGCAAAGGATGAGAGTGG + Intergenic
977783300 4:101004770-101004792 ACCATGGCAGAGCAGGAGAGAGG - Intergenic
978570165 4:110128156-110128178 AGCCTGGCAAAGAAAGTGAGAGG + Intronic
979306908 4:119156203-119156225 ACCATGGTAATGACGGAGAGGGG + Intronic
981330470 4:143502633-143502655 CTCTTGGCAAAGTAGGACAGTGG - Intergenic
981592231 4:146376499-146376521 AGCATGGTAAAGAAGGAGAGAGG + Intronic
981826476 4:148947798-148947820 ATCTTAGTAAGGAAGGAGAGAGG - Intergenic
982155841 4:152520092-152520114 GAATTGGCAAGGAAGGAGAGGGG - Intronic
982929603 4:161386608-161386630 ACCTAGAGAAAGAAGGAGAGTGG - Intronic
983468567 4:168126626-168126648 ACCTTGGAGAAGAAGGTGTGGGG - Intronic
983810924 4:172061299-172061321 CCCTTGCCAGAGAAGGAGACTGG - Intronic
984166014 4:176303956-176303978 AACTTGGAAAAAAAAGAGAGAGG + Intergenic
985655739 5:1130598-1130620 ACCCTGGCTAAGGAGGTGAGGGG - Intergenic
990365753 5:55068866-55068888 AGCAGGGCAAAGAAGGAGAGAGG + Intergenic
990515958 5:56531004-56531026 ACCTAGCCAAGGAAGAAGAGTGG - Intronic
990966651 5:61455597-61455619 ACTTCCGCAAGGAAGGAGAGAGG + Intronic
991042492 5:62190378-62190400 ATCATGGCAGAGCAGGAGAGAGG - Intergenic
991314309 5:65282849-65282871 ACCTTGGCCAAGAAGGAAGGTGG + Intronic
992920437 5:81511111-81511133 ACTTAGGCAAAGGAAGAGAGGGG - Intronic
995015764 5:107306906-107306928 ACGTTGGCAGAGATGGAGGGAGG + Intergenic
995889299 5:116933149-116933171 ACCTTGGGAAAGAGGTTGAGGGG - Intergenic
996497770 5:124181419-124181441 ACCTTGGTAGGGAAAGAGAGTGG - Intergenic
996589735 5:125133074-125133096 ACCTTGGCAATGAATGAGGTGGG - Intergenic
997574483 5:134963699-134963721 ACTTTAGCAAAGAAGGAAACAGG - Intronic
998386968 5:141762666-141762688 TTGTTGGCAAAGAAGGAGAAGGG + Intergenic
998669632 5:144339386-144339408 ACATGGGGAAAAAAGGAGAGAGG - Intronic
998806520 5:145922284-145922306 AGCTTGGTAAAGAAAGGGAGGGG - Intergenic
999087319 5:148904365-148904387 ACCTGGACCAAGAAAGAGAGAGG - Intergenic
999651399 5:153770980-153771002 AGTTTGGTAAAGAAGCAGAGTGG + Intronic
1001097178 5:168784708-168784730 ACAAGAGCAAAGAAGGAGAGAGG - Intronic
1001922419 5:175611034-175611056 AGCTTGGCAGAGATGGTGAGGGG - Intergenic
1001974384 5:175984965-175984987 AGATTGGCAAAAAGGGAGAGAGG - Intronic
1002243050 5:177858814-177858836 AGATTGGCAAAAAGGGAGAGAGG + Intergenic
1003156960 6:3605063-3605085 AGCTTGGAAGAGGAGGAGAGGGG - Intergenic
1003850663 6:10219146-10219168 TCCATGGAAAAGATGGAGAGAGG - Intergenic
1005502031 6:26437142-26437164 AGCTTGGCAATGGAGGAGAGGGG - Intergenic
1007554738 6:42756419-42756441 AGCTTGCCAAAGGAGGTGAGAGG - Intronic
1010388043 6:75304961-75304983 ACCTGGGCATGGAAGGAGACTGG + Intronic
1010776576 6:79893478-79893500 AGCATGGCAAAGAAGCAGAAAGG + Intergenic
1010980477 6:82364602-82364624 ACCTGGGACAAGCAGGAGAGAGG - Exonic
1011672175 6:89693898-89693920 GCCTTGTGAAAGGAGGAGAGGGG - Intronic
1011775361 6:90724449-90724471 ACCTTGGGAAAAAAGGTGAGTGG + Intergenic
1012133772 6:95529385-95529407 ACCTTGGAAATGATTGAGAGAGG + Intergenic
1014929371 6:127315958-127315980 ACCTAGGTAAAGAAGCAAAGAGG - Intronic
1016357301 6:143232524-143232546 ATCTTGGCAAAGAAGGTGTTTGG - Intronic
1017057070 6:150446578-150446600 ACCTGTGCAAAGAAGGAAAGAGG + Intergenic
1019690630 7:2409187-2409209 ACCTGGGCAGAGAAGGTGTGGGG + Intronic
1020383193 7:7567668-7567690 ACCGTGGCAAATTACGAGAGCGG - Exonic
1021594699 7:22302583-22302605 ACCTTGGCAGAGGAGGACAGGGG - Intronic
1021759702 7:23891644-23891666 ACCTTGACCAGGAAGAAGAGAGG + Intergenic
1023146021 7:37151844-37151866 CCCTTGACAGAGAAAGAGAGTGG - Intronic
1023270414 7:38456129-38456151 ACCAGGCCAAAGAGGGAGAGGGG + Intronic
1025208815 7:57009207-57009229 ACCATGGCAGTGATGGAGAGGGG - Intergenic
1025663136 7:63567663-63567685 ACCATGGCAGTGATGGAGAGGGG + Intergenic
1026674900 7:72420225-72420247 ACTTGGGAAAAGAAGGACAGAGG + Intronic
1026805833 7:73429305-73429327 ACCTTTGTAAAGAGGGAGATCGG + Intergenic
1026977341 7:74506706-74506728 CCCTGGGTCAAGAAGGAGAGGGG + Intronic
1029451493 7:100643727-100643749 TCCTTGGGAAAGAGGGAGACTGG - Intronic
1029993055 7:104979605-104979627 ACCTTGACAAAGCAGGAGGGGGG - Intergenic
1030220221 7:107090582-107090604 CCTTTGGCAAAGAAAGACAGAGG - Intronic
1031007932 7:116495843-116495865 AGCCTGGGAAAGAAGGAGAAAGG + Intronic
1031963973 7:128014012-128014034 CCCCAGGCAAGGAAGGAGAGAGG - Intronic
1032026463 7:128446397-128446419 ATCTTAGCCAAGAAGGACAGTGG - Intergenic
1032849570 7:135782590-135782612 GCCTTGGCAAGGAAGGAAGGGGG - Intergenic
1034284554 7:149875893-149875915 ACCTGGGCAAGGAAGGAGGCAGG + Intronic
1034338642 7:150338879-150338901 AGCTTGGCCAAGCAGGAGGGAGG - Intronic
1034459621 7:151191304-151191326 GCCTTGGGAATGCAGGAGAGAGG - Intronic
1034760145 7:153664739-153664761 ACGATGAGAAAGAAGGAGAGTGG + Intergenic
1034776122 7:153828272-153828294 ACTGTGGCATAGCAGGAGAGAGG + Intergenic
1035679432 8:1477219-1477241 ACCTAGGCAAAGAGGGTGGGTGG - Intergenic
1037638310 8:20720218-20720240 ATCTTGGAAAAGAAGGGCAGAGG - Intergenic
1038032401 8:23654062-23654084 TCTTTGGCAAAGGAGGAGAAAGG - Intergenic
1038676365 8:29626132-29626154 ACTTTGGCAAAGAAGGATCCTGG + Intergenic
1040906467 8:52474221-52474243 ATCTTAGCAAAGAAACAGAGGGG + Intergenic
1042118623 8:65459803-65459825 ACTTTGGCAAATAAGGAGAAAGG + Intergenic
1044264493 8:90166018-90166040 ACCTGGGCAATGAAGGAGCTGGG - Intergenic
1044465519 8:92499193-92499215 ACTATGGAAAAGAAAGAGAGAGG - Intergenic
1046925940 8:119788637-119788659 ACTTTGTCAAAGAAGGGAAGAGG - Intronic
1049069977 8:140349032-140349054 ACCTTGGCAAGGGAGAGGAGAGG + Intronic
1049489480 8:142887377-142887399 ACCGTGGCAGAGCAGGAGGGCGG + Intronic
1052308832 9:27041839-27041861 ACTATTGCTAAGAAGGAGAGTGG - Intronic
1054651222 9:67625621-67625643 ACCTTGGGAAAGGTGGAGACAGG + Intergenic
1054897190 9:70327963-70327985 ACCATGGCAGAGTAGGAGAGAGG + Intronic
1056519776 9:87389476-87389498 GTCTTGGGAAAGAAGGGGAGAGG + Intergenic
1057597134 9:96424087-96424109 ACCTTTCCACAGATGGAGAGAGG - Intergenic
1058561626 9:106235082-106235104 ACCTAGGCAGAGAATAAGAGAGG + Intergenic
1059382925 9:113942335-113942357 ACCATGGAAAAAAAGAAGAGAGG - Intronic
1203473889 Un_GL000220v1:134413-134435 CCCTAGGCAACGAGGGAGAGAGG - Intergenic
1203362691 Un_KI270442v1:231319-231341 CCCTAGGCAACGAGGGAGAGAGG + Intergenic
1185845817 X:3436473-3436495 CCCTTAGCAAAGATGGTGAGTGG + Intergenic
1187364494 X:18655425-18655447 AACTTTGTAAAGGAGGAGAGAGG - Intronic
1187598574 X:20801551-20801573 ACCATGCTAAAGATGGAGAGAGG - Intergenic
1187649024 X:21379758-21379780 ACTTAGGCAAAGACAGAGAGAGG + Intronic
1187995655 X:24923761-24923783 TCCTTTGCAAAGAAGTACAGTGG + Intronic
1189449635 X:41116815-41116837 ACCTGGAAAAAGAATGAGAGAGG + Intronic
1189564748 X:42230118-42230140 ATCTTGTAAAAGAGGGAGAGCGG - Intergenic
1192171849 X:68860643-68860665 CACTTGGCAAGGAAGGAGAAGGG + Intergenic
1192855174 X:75001279-75001301 ATCTTGTCAAACAAGGAAAGTGG - Intergenic
1193222781 X:78946377-78946399 ATCTTAGCTCAGAAGGAGAGAGG - Intronic
1193256612 X:79355925-79355947 ACCATGGCAGAGCAGGAGAGTGG - Intergenic
1196042652 X:111222214-111222236 ACCTTGGCAAAGAAGGAGAGAGG - Intronic
1196197629 X:112852697-112852719 ACCTTGGAAGAGAAGGTGATAGG - Intergenic
1199335601 X:146615776-146615798 ACTCTAGCACAGAAGGAGAGGGG - Intergenic
1200413004 Y:2879920-2879942 AAGTAGGCAAAGAGGGAGAGGGG + Intronic
1200818612 Y:7559818-7559840 CCCTTAGCAAAGATGGTGAGTGG - Intergenic
1202117596 Y:21486279-21486301 AAGTTGGGACAGAAGGAGAGGGG - Intergenic