ID: 1196044851

View in Genome Browser
Species Human (GRCh38)
Location X:111246370-111246392
Sequence TACCTCCAGCAGCTGGACAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 135}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196044851_1196044859 22 Left 1196044851 X:111246370-111246392 CCCATGTCCAGCTGCTGGAGGTA 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1196044859 X:111246415-111246437 GCTACTTGGATTGGGAGGTATGG 0: 1
1: 0
2: 0
3: 8
4: 137
1196044851_1196044860 23 Left 1196044851 X:111246370-111246392 CCCATGTCCAGCTGCTGGAGGTA 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1196044860 X:111246416-111246438 CTACTTGGATTGGGAGGTATGGG 0: 1
1: 0
2: 1
3: 6
4: 124
1196044851_1196044858 17 Left 1196044851 X:111246370-111246392 CCCATGTCCAGCTGCTGGAGGTA 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1196044858 X:111246410-111246432 CAGATGCTACTTGGATTGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 135
1196044851_1196044857 14 Left 1196044851 X:111246370-111246392 CCCATGTCCAGCTGCTGGAGGTA 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1196044857 X:111246407-111246429 CTACAGATGCTACTTGGATTGGG 0: 1
1: 0
2: 2
3: 11
4: 114
1196044851_1196044861 24 Left 1196044851 X:111246370-111246392 CCCATGTCCAGCTGCTGGAGGTA 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1196044861 X:111246417-111246439 TACTTGGATTGGGAGGTATGGGG 0: 1
1: 0
2: 3
3: 12
4: 150
1196044851_1196044855 8 Left 1196044851 X:111246370-111246392 CCCATGTCCAGCTGCTGGAGGTA 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1196044855 X:111246401-111246423 ATGTAGCTACAGATGCTACTTGG 0: 1
1: 1
2: 1
3: 6
4: 99
1196044851_1196044856 13 Left 1196044851 X:111246370-111246392 CCCATGTCCAGCTGCTGGAGGTA 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1196044856 X:111246406-111246428 GCTACAGATGCTACTTGGATTGG 0: 1
1: 0
2: 1
3: 8
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196044851 Original CRISPR TACCTCCAGCAGCTGGACAT GGG (reversed) Exonic
900532057 1:3159344-3159366 TACCTCCACCATCTGGAGGTGGG + Intronic
901562670 1:10085151-10085173 AGCCTCCAGCAAGTGGACATTGG + Intronic
901819026 1:11814157-11814179 TACCCACATCAGCTGGACATTGG - Intronic
902383013 1:16061430-16061452 CACCTGAAGCAGCTGGGCATGGG - Intronic
903784237 1:25847144-25847166 TACATTTAGCAGCTGGAAATTGG - Intronic
905093890 1:35452295-35452317 TCCCTCCAGCTCCTGGACAGGGG + Intronic
905527448 1:38649746-38649768 TACCTGCAGGAGCTGGTCCTTGG + Intergenic
906501845 1:46347020-46347042 TTCCCCCAGGAGCTGCACATAGG - Exonic
908338993 1:63157080-63157102 AGCCTCCAGCAGCTGGAGAGGGG - Intergenic
909106354 1:71414333-71414355 TATCTCCTGCAGCTGCTCATGGG - Intronic
909576971 1:77186200-77186222 TTCCTCCATCAGCTGATCATAGG - Intronic
911088573 1:93999838-93999860 TTTCTCCAGCAGTTGGACACAGG + Intronic
913228977 1:116725436-116725458 GTCCTTCAGCAGCTGGACAAGGG + Intergenic
917531572 1:175840789-175840811 GACATCCAGCACCTGGACACAGG - Intergenic
918404018 1:184193543-184193565 TACCACCAGGAGCTGGCCTTTGG + Intergenic
922865509 1:228858197-228858219 TGACTCAAGCAGCTGCACATGGG + Intergenic
923340009 1:232999062-232999084 TTCCCCCAGCATCTGGACAGAGG + Intronic
1064836417 10:19536415-19536437 TTCTTCCAGCAGCTTGACTTTGG + Intronic
1067499437 10:46788771-46788793 TGCCTCCAGCATCTGCACACTGG + Intergenic
1067595192 10:47551551-47551573 TGCCTCCAGCATCTGCACACTGG - Intergenic
1067642299 10:48059634-48059656 TGCCTCCAGCATCTGCACACTGG - Intergenic
1068731402 10:60362689-60362711 TACCTCCAGCAGCTGGCTTCAGG + Intronic
1070139500 10:73728187-73728209 TGCCTCCAGCATCTGCACACTGG - Intergenic
1070886774 10:79906950-79906972 TGCCTCCAGCATCTGCACACTGG + Intergenic
1071606183 10:86992639-86992661 TGCCTCCAGCATCTGCACACTGG + Intergenic
1072698459 10:97621892-97621914 TTCCTCCACCTGCTGGACCTGGG + Intronic
1073805363 10:107091733-107091755 TGCCTCTAACAGCTGGACTTTGG + Intronic
1074383272 10:112997229-112997251 TACCTTCAGTAGATGGAGATTGG - Intronic
1076605955 10:131689949-131689971 CACCTCCAGGAGCTGGACCCTGG + Intergenic
1076876759 10:133220045-133220067 CACATCCAGCAGCTGGAGACAGG + Exonic
1077088533 11:766901-766923 TCCCTGCAGTAGCTGGGCATGGG + Intergenic
1077895277 11:6449017-6449039 TACCTCCAGTAGCTGTACAGAGG - Exonic
1079621321 11:22558717-22558739 TCCCACCAGCCGCTGGACACAGG - Intergenic
1082701160 11:56433047-56433069 TACCTCCAGCAGCAGGCCCAGGG - Intergenic
1082925419 11:58540775-58540797 TAGCTCCATTACCTGGACATGGG - Intronic
1088599172 11:111460317-111460339 AGCCTCCAGCACCTGGACAACGG - Intergenic
1090149996 11:124374123-124374145 TGCCTCTAGCAGCAGGACACGGG - Intergenic
1090231553 11:125110683-125110705 TCCCTCCAGCAGCAGCACTTAGG - Intronic
1090756004 11:129792557-129792579 TGCCTCCAGCAGCAGGAGCTTGG - Intergenic
1093304585 12:17498246-17498268 TACCTCCAGAAGCTGAAAACAGG + Intergenic
1098555128 12:71810206-71810228 AAGCTCCAGCATTTGGACATTGG + Intergenic
1099018953 12:77379797-77379819 GACCTCTAACAGCTAGACATGGG + Intergenic
1100212523 12:92412093-92412115 TACCTCAAGGATCTGGACCTGGG - Intergenic
1102634866 12:114314206-114314228 TACCTCCAGCAGCTTTGCAGAGG + Intergenic
1106316185 13:28596206-28596228 TTCCCCCAGCAGCGTGACATAGG + Intergenic
1106580705 13:31015997-31016019 TACCTCCATCTGCTGGAATTAGG + Intergenic
1106761166 13:32869303-32869325 TACCTCCAGTCACTGGACAAAGG + Intergenic
1109184311 13:59250842-59250864 CTCCTGCAGCAGCTGAACATTGG - Intergenic
1110540786 13:76704842-76704864 TACCTCCAAAAGGTGGACAGGGG + Intergenic
1118933949 14:70269028-70269050 AACCTGCAGCAGCTGGAGAATGG + Intergenic
1119069892 14:71572006-71572028 CACCAGCAGCAGCTGGACCTTGG - Intronic
1119910358 14:78344361-78344383 TACCTCCAGCAACTGCATTTAGG + Intronic
1120906858 14:89628238-89628260 TTCCCCCAGCAGCTGGGGATAGG + Intergenic
1121757812 14:96417826-96417848 TACCTCCAGAATCTGTACAAGGG + Intronic
1122200652 14:100120658-100120680 GACCTCCTGCACCTGGACACTGG - Intronic
1125193134 15:37016514-37016536 TCCCTCCAGCAGCTCGAAAAGGG + Intronic
1125477128 15:40054965-40054987 CATCCCCAGCAGCTGGACAGAGG - Intergenic
1125734406 15:41913655-41913677 TACCTCCAGCTGTTGGTCTTTGG - Intronic
1128083067 15:64867658-64867680 TAACTGCAGCAGCTGGACTGAGG + Exonic
1128110230 15:65071552-65071574 TACCTCCAGCAGCCAGACAGTGG - Intronic
1128385069 15:67141812-67141834 TACCTCCTGCAGCTGAACTTGGG + Intronic
1132905340 16:2279636-2279658 TACCTTCAGCAGCTGGTCGGGGG + Intronic
1141832966 16:86519962-86519984 CACCTCCCGCACCTGGACAGAGG - Intergenic
1143649416 17:8254271-8254293 GACCTCCAGCAGCAGGTCATTGG - Exonic
1143877125 17:10000364-10000386 TACCTCCAACACCTGGATAAAGG - Intronic
1144952877 17:19003641-19003663 TCCATCCCGCAGCTGGACCTGGG - Exonic
1148131949 17:45267405-45267427 GAACTGCAGCAGCTGGAAATAGG - Exonic
1155096320 18:22559610-22559632 GACCCGCAGCAGCAGGACATTGG - Intergenic
1160824579 19:1073770-1073792 GGCCTCCAGAAGCTGGACACAGG - Intronic
1163366657 19:16879397-16879419 CAACTCCAGCAGCTGGACTCTGG + Exonic
1163371887 19:16905773-16905795 TACCCCCAGCAGCTGCACTGGGG - Intronic
1165277908 19:34770878-34770900 TCTCTCTAGCAGGTGGACATTGG - Intronic
1166115371 19:40650302-40650324 TACCTCCAGCCTCTGGCCACAGG + Intergenic
1167440255 19:49504316-49504338 CACCTCCTGCAGCAGGTCATGGG + Intergenic
1168393952 19:56032678-56032700 CACCTGCGGCAGCTGGACCTGGG + Exonic
925414741 2:3661484-3661506 TCCCTCCAGCAGATGGTCCTGGG - Intronic
928192566 2:29186372-29186394 AACCTCCACCAGATGGACACAGG - Intronic
930463204 2:51710353-51710375 TACCTCCAGGAGCTGGACAGAGG - Intergenic
930970091 2:57385149-57385171 ACACACCAGCAGCTGGACATTGG + Intergenic
938209841 2:129458379-129458401 TAACTGCAGCAGCTGCAAATGGG + Intergenic
938767376 2:134469278-134469300 GTCCTCCAGGAGCTGGACCTCGG - Intronic
941457597 2:165728146-165728168 CAACTCCAGCAGCTTGACAGAGG + Intergenic
943198283 2:184784497-184784519 TACCTACAGCAGTAGGAAATAGG + Intronic
945033866 2:205687446-205687468 TACCTCCAGGAGCTGATCACGGG - Intronic
945119828 2:206445295-206445317 TACCTCCACCAGCTCCGCATTGG + Exonic
946184304 2:217970134-217970156 AACCTCCAGAAGCTGGAAAGAGG + Intronic
947199231 2:227599787-227599809 AACCTCCTGAAGCTGGCCATGGG + Intergenic
1170681610 20:18531009-18531031 AACCTCCACCTGCTGGACATGGG + Intronic
1171031614 20:21681815-21681837 TGCCTGCAGCAACTGCACATTGG - Intergenic
1173882855 20:46431250-46431272 GATCCCCAGCAGCTGAACATGGG + Intronic
1175818994 20:61898400-61898422 TCCCTCCAGCAGGTGAGCATGGG + Intronic
1179616108 21:42584341-42584363 TAACTCCAGCTGCTGAACACAGG + Intergenic
1180383470 22:12162735-12162757 TCCCTGCAGCAGCTGCACAGGGG - Intergenic
1182017349 22:27051946-27051968 TACCTACAGGGGCTGGACAGAGG - Intergenic
1185017419 22:48352824-48352846 TACCTCCAGCCTCTGGGGATGGG - Intergenic
1185176171 22:49328248-49328270 TTCCTCCTGCAGCTGAACACTGG - Intergenic
1185380006 22:50503917-50503939 TGCCTCCAGCTTCTGAACATCGG - Intronic
950409684 3:12827428-12827450 TCCCTCCTGCAGGTGGAGATGGG + Exonic
953205299 3:40822520-40822542 TACTCTCAGCAGCTGGATATGGG - Intergenic
953657996 3:44869205-44869227 TACTTCCAGCAGTAGCACATGGG - Intronic
954263262 3:49455209-49455231 TGACTTCAGCAGCAGGACATGGG - Intergenic
954416884 3:50397659-50397681 AACCCTCAGCAGCTGCACATAGG + Intronic
960352570 3:116611089-116611111 TACCTCCAACAACGGGACAAAGG + Intronic
961472219 3:127122694-127122716 TTCCTCCAGCAACTAGTCATAGG - Intergenic
963297450 3:143561383-143561405 TACCTCAAGAAACTGGACAAGGG + Intronic
969696806 4:8739642-8739664 TACCTCCTGCTGCTGGATTTAGG + Intergenic
970508704 4:16758796-16758818 AACCTCCAGAAGCAGAACATTGG + Intronic
971498809 4:27296623-27296645 AACCTACAGCTGCTGGACTTCGG - Intergenic
976197634 4:82548666-82548688 TAAGTGCAGCAGCTGGAAATTGG + Intronic
979803424 4:124940130-124940152 TACCTCCAGCAGTTGTTCTTAGG + Intergenic
982249317 4:153388726-153388748 TACCTCCAGCAGCAGGCCTGGGG - Intronic
982634022 4:157869331-157869353 TAACTATAGGAGCTGGACATGGG - Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
993866593 5:93203813-93203835 ATCCTCCAGCAGGTGAACATGGG - Intergenic
1000711068 5:164579467-164579489 TACTGCCAGCATCTGGATATAGG - Intergenic
1001275401 5:170347135-170347157 CAGCACCAGCAGCTGCACATTGG + Intergenic
1001774170 5:174316203-174316225 CCCCTGCTGCAGCTGGACATGGG + Intergenic
1003746495 6:9007911-9007933 TGCCCTCAGCAGCTGGACCTCGG - Intergenic
1004824251 6:19402920-19402942 TTCCTCCATCAGCTGATCATAGG + Intergenic
1005055717 6:21727098-21727120 TAGGTCCAGCAACCGGACATTGG + Intergenic
1005106754 6:22232014-22232036 CACCTGCAGCAGCTGGGCAGTGG + Intergenic
1005898549 6:30198131-30198153 GAGAACCAGCAGCTGGACATGGG + Intronic
1009858372 6:69293057-69293079 TGGCTCCAGCTGCTGGACTTTGG + Intronic
1013360350 6:109388020-109388042 GACCTCCAGGTGCTGGACAGTGG - Intergenic
1014045024 6:116875924-116875946 TACCTCCAGCAGCTAGATCCAGG - Intergenic
1018518931 6:164621979-164622001 TACATCCAGGAGGTGGAGATGGG - Intergenic
1018772417 6:166982983-166983005 TACCTCTAGAAGCTGGAAAAGGG - Intergenic
1022195883 7:28066957-28066979 TACCTCCAGCATCTTGGCACAGG + Intronic
1031173874 7:118324849-118324871 TACCTCCAGCAGCAAGTCAAGGG - Intergenic
1034115345 7:148579024-148579046 TTCCTCCATCAGTTGGTCATAGG + Intergenic
1035674207 8:1443398-1443420 TCCCTCTAGCGGCTGTACATGGG + Intergenic
1039574696 8:38613768-38613790 TTCTTCCAGCAGCTGGGGATGGG + Intergenic
1043020426 8:74992951-74992973 TAACTCCAGAAACTGGACATGGG + Intronic
1049326017 8:142022018-142022040 TTCCTCCTGCATCTGGCCATTGG + Intergenic
1049707520 8:144049771-144049793 CACCTCAAGCTGCTGGACAGCGG + Intergenic
1054737783 9:68773027-68773049 TACTTCCAGCAGTGGGACTTTGG - Intronic
1057783944 9:98072756-98072778 TACCTCCAACAGTTTGACAGAGG - Intronic
1059249011 9:112871583-112871605 TACCTCAAGCAGACAGACATAGG + Exonic
1059583136 9:115574100-115574122 TACATCCTGCAGCTGGACTCTGG + Intergenic
1061500907 9:131001364-131001386 TTCCTCCACCAGCTGGTCATAGG + Intergenic
1061805527 9:133135551-133135573 TTCCTCCTGGAGCTGGACCTGGG - Intronic
1194842219 X:98756836-98756858 TATCTCCAGCAGATTAACATGGG - Intergenic
1196044851 X:111246370-111246392 TACCTCCAGCAGCTGGACATGGG - Exonic
1199771787 X:150979847-150979869 TACCTCCAGCAGCAGCACCCAGG - Intergenic
1200366504 X:155671373-155671395 TACCCCCATCCCCTGGACATTGG - Intergenic