ID: 1196045808

View in Genome Browser
Species Human (GRCh38)
Location X:111255142-111255164
Sequence TTTCCTACTCCCAGTGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196045808_1196045812 17 Left 1196045808 X:111255142-111255164 CCTTTCCCACTGGGAGTAGGAAA 0: 1
1: 0
2: 2
3: 15
4: 174
Right 1196045812 X:111255182-111255204 CAATTATAACACAAAGCGATAGG 0: 1
1: 0
2: 0
3: 14
4: 143
1196045808_1196045813 18 Left 1196045808 X:111255142-111255164 CCTTTCCCACTGGGAGTAGGAAA 0: 1
1: 0
2: 2
3: 15
4: 174
Right 1196045813 X:111255183-111255205 AATTATAACACAAAGCGATAGGG 0: 1
1: 0
2: 1
3: 12
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196045808 Original CRISPR TTTCCTACTCCCAGTGGGAA AGG (reversed) Intronic
903229916 1:21915302-21915324 TCCCCTTCTCCCACTGGGAATGG + Intronic
903691133 1:25174458-25174480 CTTTCGACTCCCAGTGGGAGGGG + Intergenic
904585766 1:31579738-31579760 CTTCCTCCTCCTACTGGGAATGG - Intronic
906703052 1:47873641-47873663 TTTTCCACTCCCAGTGGAGAAGG + Intronic
907397690 1:54203067-54203089 TTAGCTACTCTCAGTGGGATGGG - Intronic
908611662 1:65867837-65867859 TTTCCCAGACACAGTGGGAAGGG + Intronic
908782032 1:67699732-67699754 TTTGCTACTCACAGTGGTAAAGG + Intergenic
908783454 1:67712742-67712764 TTTCCTTGGCGCAGTGGGAAGGG - Intronic
914899051 1:151702343-151702365 TTCCCTACCCACACTGGGAAGGG - Intergenic
915940341 1:160114801-160114823 TTTCCTTCTTCCAGTGGGGAAGG - Intergenic
917282850 1:173395915-173395937 TTACCCACCCCCAGTGGGAGTGG + Intergenic
918351009 1:183655899-183655921 CTTCCAACTCTCTGTGGGAAAGG + Intronic
918930796 1:190854201-190854223 GTTCCAGCTCTCAGTGGGAATGG + Intergenic
919434560 1:197541673-197541695 ATTCCTACTCACAGTGGCAAAGG + Intronic
919483092 1:198113340-198113362 TTCCCTCCTTCCAGGGGGAAGGG - Intergenic
919857369 1:201714921-201714943 TTTTCTGCTTCTAGTGGGAAAGG + Intronic
922627623 1:227065431-227065453 TTTCATTTTCCCAGAGGGAAGGG + Intronic
923649951 1:235864975-235864997 GTTTCTACTCTCAGTGGAAAGGG - Intronic
924015748 1:239719841-239719863 CTTCCTGCTGCCTGTGGGAAAGG + Intronic
1063300887 10:4847980-4848002 TTTCCTTCTCACTGGGGGAAGGG - Exonic
1063710723 10:8475554-8475576 TTCCCTTCTCCCAGTGGGAAGGG + Intergenic
1064205820 10:13322669-13322691 TTTCCTCCTCCCGGTGGGTCTGG - Intronic
1064225544 10:13480957-13480979 TTTCCTCTTCCCATTGGGTAAGG + Exonic
1067131966 10:43573651-43573673 TTTCTTACTCCCAGAGGGGATGG + Intronic
1069729132 10:70599852-70599874 CTTCCTACTCCCAGGGGCTAGGG + Intronic
1070809665 10:79291221-79291243 CTTCCTCCTTCCAGTGGGGAGGG + Intronic
1074895392 10:117773068-117773090 TTTCCCACCTCCAGTGGGAGGGG + Intergenic
1075084796 10:119407381-119407403 TTTCCTTCTCCCACTGGGGATGG + Intronic
1075733926 10:124652639-124652661 TTTCCCACTACCTGTGGGACTGG - Intronic
1076622499 10:131800964-131800986 TTTTCTCCTCCCATTGTGAATGG - Intergenic
1077883702 11:6370306-6370328 CTTCCTAGACCCTGTGGGAAAGG - Intergenic
1082894338 11:58174098-58174120 TATCCTACTCACAGTTGGAGAGG - Intronic
1084727172 11:70949472-70949494 TTTCCTATTCTCAGTGTGAAGGG - Intronic
1085451581 11:76637306-76637328 TTCCCTACTCCTGGTGGAAAAGG + Intergenic
1087655617 11:100919257-100919279 TTCCAAACTCCCAGAGGGAAAGG + Intronic
1088422756 11:109667367-109667389 TTTCCCTCTCCCAGTGGCACAGG - Intergenic
1090766081 11:129877459-129877481 TTTCCATGTCACAGTGGGAATGG - Intronic
1092498843 12:9025760-9025782 TTTCCTTCTTCCATGGGGAAGGG - Intergenic
1093376001 12:18428923-18428945 TTTCCTATTCCAAATGGAAAGGG - Intronic
1094235030 12:28154186-28154208 TTTCTTACTCTCTGTGGAAACGG - Intronic
1095413089 12:41945815-41945837 TTACAGGCTCCCAGTGGGAAGGG - Intergenic
1096606214 12:52768378-52768400 TCTCCAACTCCCAGTAAGAAAGG + Exonic
1097241800 12:57580744-57580766 ATTCCTTCTCCCAGAGCGAAGGG - Intronic
1098340300 12:69444296-69444318 TTTCCTACTCCCAGGTTGATGGG + Intergenic
1099134000 12:78870781-78870803 TTTCCTACCCACAGTAGGCATGG - Intronic
1100158638 12:91831806-91831828 TTTCCTACACTCATGGGGAAAGG - Intergenic
1100857403 12:98769959-98769981 TTTCCTACTGCCATTACGAAAGG - Intronic
1101904917 12:108817253-108817275 TTTTTAACTCCCAGAGGGAAAGG - Intronic
1102736927 12:115170323-115170345 TTTTCTACTCCCATCAGGAAAGG - Intergenic
1103311734 12:120015128-120015150 CTTCCCACTGCAAGTGGGAAGGG - Intronic
1103311737 12:120015130-120015152 CTTCCCACTTGCAGTGGGAAGGG + Intronic
1104422797 12:128651079-128651101 TTTCTTACTCCCTGATGGAATGG - Intronic
1104647771 12:130509235-130509257 ATTCCGACTCCCAGAAGGAAAGG - Intronic
1109848001 13:68022593-68022615 TTTCCTAGTCTCTGTGGGAAGGG - Intergenic
1111189282 13:84788030-84788052 TTTCCTTCTCCCAGTTGGTTCGG + Intergenic
1111905079 13:94245971-94245993 TTTCCCACTAACAGTGGGCAAGG + Intronic
1113207507 13:107933991-107934013 TTTCCAATTCCCAGTGGGAAGGG + Intergenic
1113282189 13:108800354-108800376 ATACCTACACACAGTGGGAAGGG + Intronic
1114195546 14:20473019-20473041 ACTCCTACCCCCAGTGAGAAGGG + Intronic
1114745826 14:25145916-25145938 TTTCCTCCACCCTGAGGGAAAGG - Intergenic
1120186200 14:81396059-81396081 CATCCTGCTCCGAGTGGGAATGG + Exonic
1120511873 14:85425110-85425132 TTTCCTTCTGCCATTAGGAAAGG - Intergenic
1120551024 14:85873289-85873311 TTTCCTTCTCCCAGTGTCAATGG + Intergenic
1120562929 14:86018776-86018798 CTCCCTACTCCCAGTGGCAGTGG - Intergenic
1123024421 14:105418015-105418037 GCTCCTTCTCCCAGTGGGAGTGG - Intronic
1123213302 14:106782476-106782498 TTTCTTACTCCCAGTGTATATGG - Intergenic
1125128069 15:36248193-36248215 TTTCATACTCCAAGGGGCAATGG + Intergenic
1127781988 15:62324808-62324830 TTTCGAACTCCCTGTGGTAAAGG + Intergenic
1128772358 15:70291859-70291881 TTTCCTCCTCCCTGGGGGCAGGG - Intergenic
1131798868 15:96049003-96049025 TATCTCACTCCCCGTGGGAATGG + Intergenic
1135283490 16:21173081-21173103 ATTCCTATTCAGAGTGGGAATGG + Intronic
1136089339 16:27907152-27907174 TTAGCAACTCCCAGTGGAAAGGG - Intronic
1139480205 16:67226543-67226565 TTTCCCACTGCCAGGGAGAAGGG + Intronic
1140110262 16:71998067-71998089 CTTCCAACTCCCAGTGGGGATGG + Intronic
1140880029 16:79189781-79189803 TTACCTGCTCCCGGTGGGAGGGG + Intronic
1146134406 17:30305836-30305858 TTTCCTCCTGCCAGGGAGAAAGG + Intergenic
1147555408 17:41475963-41475985 TCCCTTAATCCCAGTGGGAAAGG - Intergenic
1150543064 17:66123384-66123406 TTTGCCACACCCACTGGGAATGG + Intronic
1152594750 17:81232704-81232726 ATTCCCACTCCCAGTGGGCCTGG + Intronic
1153771051 18:8416676-8416698 CTTCCTGCTTCCAGGGGGAAAGG + Intergenic
1153987563 18:10367101-10367123 TTTCCTTCTCCCCTTGGGAGAGG - Intergenic
1157091306 18:44640233-44640255 TTTCTTACCTGCAGTGGGAAGGG - Intergenic
1158946998 18:62455703-62455725 TTTCCTACTCCTACTGGAGAAGG - Intergenic
1163155831 19:15439508-15439530 CATCCTCCTCCCAGTGGGGATGG + Intronic
1166766755 19:45255813-45255835 CTTCCCACTCCCAGCCGGAAGGG + Intronic
1167675329 19:50880466-50880488 TGTCCCACACCCACTGGGAAAGG - Exonic
925684912 2:6459852-6459874 TTTTCTTCTCTCAGTGAGAATGG + Intergenic
928560270 2:32475987-32476009 TTTCTTACTCCCATGGGTAAGGG + Intronic
928640701 2:33295864-33295886 TTCCCTACTGCCAGTGGAAGAGG - Intronic
935092031 2:99904733-99904755 TTCCCCTCTCCCTGTGGGAAAGG - Intronic
936890196 2:117360240-117360262 TCTCCTACTCCTAGGGGAAAGGG + Intergenic
937027034 2:118707505-118707527 TTTCCCACTCCCTGAGGGAGGGG + Intergenic
938213834 2:129491354-129491376 TATTCTCCTCCCAGTTGGAACGG - Intergenic
940168997 2:150806459-150806481 TTTCCAACTCTCCCTGGGAAAGG + Intergenic
940816715 2:158305189-158305211 TTTCCTTCTCCCAGTTGTGATGG - Intronic
941122647 2:161548587-161548609 TTTCCCACTCCCAGGTTGAAAGG + Intronic
945846228 2:214948442-214948464 TTTCCTTCTGGCAGTGGCAATGG - Intronic
946519410 2:220448954-220448976 TTTTCCACTTCCAGGGGGAAGGG - Intergenic
1170715268 20:18825515-18825537 TTTCACCCTCCCAGTGGAAATGG - Intronic
1173438141 20:43050825-43050847 TGTGCTCCTTCCAGTGGGAATGG - Intronic
1173848209 20:46201258-46201280 TTTCCTCCTGCCTGTGGGAGGGG - Intronic
1173952576 20:47005074-47005096 TTTACTACTCACTGTAGGAAGGG - Exonic
1179427123 21:41290454-41290476 CCTCCTTCTCACAGTGGGAATGG - Intergenic
1183003793 22:34883395-34883417 TGTCCTACCCTCAGTGGAAAAGG + Intergenic
1183545642 22:38453805-38453827 GTCCCTCCTCCCAGTGAGAATGG + Intronic
1184023704 22:41838135-41838157 TTTCCTGATCCCAGTGGAAGAGG - Intronic
1184243476 22:43223520-43223542 GTTCCTTTCCCCAGTGGGAATGG - Intronic
1184498466 22:44857651-44857673 TTCCCTATACCCAGAGGGAAGGG - Intronic
1184722965 22:46326208-46326230 CTTCGGGCTCCCAGTGGGAATGG - Intronic
949408693 3:3741138-3741160 TCTCCGACTTCCTGTGGGAAAGG + Intronic
950169707 3:10829873-10829895 TTTCCCACTCACAGTAGGCATGG + Intronic
950534577 3:13571594-13571616 TGTCCTCCTCCACGTGGGAATGG - Exonic
951305646 3:21058021-21058043 TTTCCTATTCCCAGTGTGCATGG + Intergenic
951987806 3:28640347-28640369 TTGCCTACCCACAGTGGGGAGGG + Intergenic
954840100 3:53503955-53503977 TTCCCTTCCCACAGTGGGAAAGG - Intronic
955810726 3:62785739-62785761 TTTCCTATTTGCACTGGGAAAGG - Intronic
958519793 3:95169836-95169858 TTTGCTTTTCCCACTGGGAAAGG + Intergenic
958968655 3:100586934-100586956 TTTCCTTCTCCCAGTTGGTTTGG - Intergenic
960427390 3:117525756-117525778 TTTCATACACACACTGGGAAAGG - Intergenic
960454110 3:117849316-117849338 TTTCCTGCATCCAGTGAGAATGG - Intergenic
961293823 3:125868111-125868133 TTTCTTAGGCCCTGTGGGAAAGG - Intergenic
966407587 3:179614138-179614160 TTTCCTGTTCCCAGTGGAAAGGG + Intronic
967084242 3:186079746-186079768 TTCCCCTCTCCCAGTGAGAAAGG + Intronic
968964688 4:3763966-3763988 TGTCCTTCTTCCAGTGGGAGTGG - Intergenic
969750530 4:9107072-9107094 CTTCTTACACCCTGTGGGAAAGG - Intergenic
969846120 4:9921448-9921470 TTTCTTCCTCCCACAGGGAAAGG + Intronic
971041237 4:22754559-22754581 TTACCTGCTCTCCGTGGGAAGGG - Intergenic
972287079 4:37659477-37659499 TTTCTCACACCCAGTGGGCATGG + Intronic
972641060 4:40925211-40925233 GTTCCTACTACCAGAAGGAATGG - Intronic
973540328 4:51928638-51928660 TTTCCCACCCCCAGTGGCATTGG - Intergenic
978601907 4:110437506-110437528 CGTCCTGCTCCCAGTGGGAAAGG + Intronic
982093014 4:151896750-151896772 TTTCCCACTCCTTGGGGGAAGGG - Intergenic
984178034 4:176443670-176443692 TTTCTTACTGCCAGTGTGAATGG + Intergenic
986566112 5:9116206-9116228 TTTCATAGTCCCAGTGGGTCAGG - Intronic
992948173 5:81830168-81830190 TTTCAGACTCCCATTGGGATTGG - Intergenic
993838996 5:92852753-92852775 TTTCCTAGTCTCAGAGGAAAAGG + Intergenic
996299213 5:121961369-121961391 TTTGGTACTGCCTGTGGGAATGG - Intergenic
996919775 5:128754331-128754353 TTTCCTACTGTCCATGGGAAAGG + Intronic
997534363 5:134606146-134606168 TGTCCTAGTCCCTGTGGGATTGG - Exonic
997662499 5:135600270-135600292 TCTCCTGCTCCCTGTGGGCAGGG + Intergenic
997697057 5:135869909-135869931 TTTCCATCTTCCAGTGGGGAAGG - Intronic
998062138 5:139127086-139127108 TCTCCTCCTGCCAGTGGCAATGG + Intronic
1003491602 6:6627171-6627193 CTTCCTACTCCCACTGGCCAAGG + Intronic
1004298232 6:14433701-14433723 CTTCCCACTCCCAGTGGTAGTGG + Intergenic
1004331307 6:14724126-14724148 TTTGATACTCCCTGTGAGAAAGG - Intergenic
1005339697 6:24831583-24831605 TCACCTACTTCTAGTGGGAATGG + Intronic
1005447830 6:25943012-25943034 ATTCCTACTCTGAGTGGAAAGGG - Intergenic
1005468752 6:26141336-26141358 TTTCCCACTCCCAGAGGGGCAGG + Intergenic
1011281751 6:85685169-85685191 TTACCTATTCCTAGTTGGAAAGG + Intergenic
1011909640 6:92420795-92420817 TTTGCTGCTCCCAGTGTGAATGG + Intergenic
1014284477 6:119481065-119481087 TTTCCTACTCAAGGTAGGAAAGG - Intergenic
1018461704 6:164004860-164004882 ATTCCTACTGTCATTGGGAATGG + Intergenic
1019907373 7:4074997-4075019 TTTCCTCCTCCCAGGGAGAGGGG - Intronic
1020322449 7:6949566-6949588 CTTCTTACACCCTGTGGGAAAGG + Intergenic
1021093186 7:16506663-16506685 TTACCTACTCCCAATGGGCGTGG - Intronic
1023179476 7:37467701-37467723 TTTCTTAATGCGAGTGGGAAAGG - Intergenic
1024927966 7:54637865-54637887 TATCCAACTCCCAGTGAGAAGGG + Intergenic
1025621817 7:63180001-63180023 CATCCTGCTCCCAATGGGAAAGG + Intergenic
1026795685 7:73364553-73364575 TTTCCTACTCTCGGAGGGCAAGG - Intergenic
1027504360 7:78997016-78997038 ATTCCTACTCAAAATGGGAAAGG + Intronic
1028393363 7:90340220-90340242 TTTTCCACTCCCAATGAGAATGG + Intronic
1028584760 7:92442078-92442100 TGTCCTACTGCCAGCAGGAAGGG + Intergenic
1029089570 7:98037662-98037684 TTGCCTACTGCTGGTGGGAATGG - Intergenic
1031089727 7:117339982-117340004 TTTAGAACTCCCAGTGGGGATGG - Intergenic
1031531948 7:122886502-122886524 TTTCCTACCACCAGGGCGAAAGG + Intronic
1033035268 7:137869866-137869888 TTTCCCACTACCATTGTGAAGGG + Intergenic
1033143039 7:138844620-138844642 TCTCCTGCTCCCTGAGGGAAGGG + Intronic
1033451056 7:141462775-141462797 TTTCACACTCACAGTGTGAAGGG + Intronic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1042417652 8:68542186-68542208 ATTCCAACTTACAGTGGGAATGG + Intronic
1046046595 8:108972645-108972667 TTTCCTGCACCCAGGGGAAAGGG - Intergenic
1047664241 8:127073120-127073142 TTTCCCACTCCCATGGGGGAAGG - Intergenic
1048766221 8:137847314-137847336 TTTCCTACTTCAAGTTCGAATGG - Intergenic
1053354453 9:37434178-37434200 TGTCCTACTGCCAGCAGGAAGGG + Intronic
1055142284 9:72889235-72889257 TATCCTACCCCCAGGCGGAAAGG - Intergenic
1055627091 9:78185420-78185442 CTTCTTACACCCTGTGGGAAAGG - Intergenic
1055640093 9:78312786-78312808 CTACCTTCTCCCAGTGGGATGGG + Intronic
1056169088 9:83965495-83965517 TTTTCTGCTATCAGTGGGAATGG - Intergenic
1056273638 9:84971489-84971511 TTTCCTCTGCCCAGTGGGGAAGG - Intronic
1058919972 9:109604023-109604045 TTCCCACTTCCCAGTGGGAAGGG + Intergenic
1059253778 9:112910349-112910371 GTTCCCACACCCAGTGGTAACGG + Intergenic
1059681799 9:116592886-116592908 CTTCCTTCTCCCAGTGATAAAGG + Intronic
1060425354 9:123499975-123499997 TTTCCTTTGCCCAGTGTGAAGGG - Intronic
1062126233 9:134864471-134864493 TTTCCCAACCCCAGTGGGGATGG - Intergenic
1189509390 X:41646729-41646751 TTTCCTACTAACAGTGTGTAAGG - Intronic
1189586207 X:42464558-42464580 TGACCCACTCTCAGTGGGAAGGG + Intergenic
1193214437 X:78846494-78846516 TTGTCCACTACCAGTGGGAATGG + Intergenic
1195522379 X:105846023-105846045 TTTCCTACTCCATAAGGGAAAGG + Intronic
1196045808 X:111255142-111255164 TTTCCTACTCCCAGTGGGAAAGG - Intronic
1196477467 X:116105533-116105555 GTTTTTACTCCCAGTAGGAAGGG - Intergenic
1198985539 X:142448452-142448474 TCTCCTCCTCCCAGTGGCACTGG + Intergenic
1199975036 X:152889691-152889713 TTTCCTACATCCAGGAGGAAGGG + Intergenic