ID: 1196046054

View in Genome Browser
Species Human (GRCh38)
Location X:111257706-111257728
Sequence GCTGAGATGCAGAGTGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 387}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196046053_1196046054 25 Left 1196046053 X:111257658-111257680 CCTGTTGGGGTTAAGGATGTAAG 0: 1
1: 0
2: 1
3: 4
4: 72
Right 1196046054 X:111257706-111257728 GCTGAGATGCAGAGTGCAGATGG 0: 1
1: 0
2: 2
3: 39
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196046054 Original CRISPR GCTGAGATGCAGAGTGCAGA TGG Intronic
900387374 1:2416750-2416772 ACAGGGGTGCAGAGTGCAGAGGG + Intergenic
900610898 1:3544262-3544284 GCTGTGATGCTGAGGGGAGAGGG - Intronic
900717867 1:4156765-4156787 GCTGAGATGCAGACTGACCAGGG - Intergenic
900987923 1:6083739-6083761 GCTGAGAGGCAGCTTGCAGGGGG + Intronic
901083208 1:6595226-6595248 GCTGTGAGCCAGAGAGCAGAAGG - Intronic
902210924 1:14903922-14903944 GATGAGAAGCAGACTGCGGAAGG + Intronic
902688633 1:18095639-18095661 GCTGGGATGCAGCTTTCAGAGGG + Intergenic
902866916 1:19285788-19285810 GCTGCTATGCAGAGGGCACAGGG + Intronic
902921298 1:19667276-19667298 ACAGGGATGGAGAGTGCAGATGG - Intronic
903295116 1:22338807-22338829 AATGAGATGCAGTGTGCATAGGG + Intergenic
904198101 1:28801143-28801165 GCTGAAATTCAGAGTGATGAAGG - Intergenic
904263447 1:29304396-29304418 GATGAGATCCAGAGTTCAAATGG - Intronic
904439526 1:30521406-30521428 GATCAGATGCAGAGGGCAGAGGG - Intergenic
906119589 1:43380094-43380116 GCTGAGCTGCAGATTCCTGATGG - Intergenic
906524613 1:46487002-46487024 GCTGAGATGGAAAGTCCGGAGGG - Intergenic
906686453 1:47766277-47766299 GCTGAGCTCCAGAGTCCACACGG + Intronic
906715576 1:47965991-47966013 GCTGTGATGTGGAGTGCAGCTGG - Intronic
907628852 1:56060119-56060141 TCTGAGATACAGAGTCAAGAGGG + Intergenic
909437689 1:75662342-75662364 GCTGAAAAGGAGAGTGGAGAGGG + Intergenic
910074274 1:83259009-83259031 CCAGAGATGCAAAGTGCAGCTGG - Intergenic
912370530 1:109170746-109170768 GCTGGGCTGCAGCATGCAGAGGG + Intronic
913224187 1:116684436-116684458 GCTGACTTACAGAGTGCGGAGGG + Intergenic
913517952 1:119621243-119621265 GCTGAGCTGGAGAATGCAAAAGG + Exonic
914695086 1:150069983-150070005 ATTAAGATGCAGAGTGCAAAAGG - Intronic
915215819 1:154340261-154340283 GCTGAGGTGCTGACTCCAGAGGG - Intronic
916118245 1:161506312-161506334 GCTGAGGGGCAGAGTGGAAAGGG - Exonic
916563866 1:165956271-165956293 GCTAAGAGGCTGGGTGCAGAGGG + Intergenic
920048117 1:203146717-203146739 TCTGAGATGGAGAGTGCTGTGGG + Intronic
920058035 1:203206744-203206766 TCTGAGATGCAGAATGAAAAAGG - Intergenic
920114078 1:203607589-203607611 GCTGAGACCCAGAGAGCTGAAGG - Intergenic
920339474 1:205267049-205267071 TCTGAGAAGCAGAGTCCTGAAGG + Intronic
920363217 1:205433640-205433662 GCTGGGCTGCAGACAGCAGAGGG + Intronic
920560687 1:206936338-206936360 GCTGAGATCCAGAGAGAAGCAGG + Intronic
921967598 1:221107158-221107180 GGGGAGATGAAGAGTGGAGAGGG - Intergenic
922489118 1:226000968-226000990 GCTGGGGAGCAGACTGCAGAGGG - Intergenic
922702706 1:227771129-227771151 GCTGAGAGCCTGAGTGGAGAAGG - Intronic
923087831 1:230714504-230714526 CCGGAGGTGCAGAGGGCAGAGGG + Intergenic
923214026 1:231832648-231832670 GCTGGGATGAAGGGTGCAAAGGG + Intronic
923860337 1:237886506-237886528 GCTGAAATGTAGAATGGAGAAGG + Intronic
1063613523 10:7583264-7583286 GCTAAGATGCAGAGCCCAAATGG + Intronic
1063720237 10:8573342-8573364 GCAGAGATCCAGAGTGCTCATGG - Intergenic
1064227846 10:13503323-13503345 GCTGAAAGGAAGAGGGCAGAAGG + Intronic
1064488133 10:15819069-15819091 GTTGAGAGGGAGAGTGCAGGAGG + Intronic
1067057805 10:43062436-43062458 GCTGAGATGAAGAGGAGAGAGGG + Intergenic
1067146795 10:43700222-43700244 GCAGAGATGCAGACAGCAGCAGG - Intergenic
1067431861 10:46250512-46250534 GGTGAGAAGCACAGTGGAGAGGG - Intergenic
1067523642 10:47026010-47026032 GCAGGGAGGCAGAGGGCAGATGG - Intergenic
1067578255 10:47421126-47421148 GGTGAGAAGCACAGTGGAGAGGG + Intergenic
1067747480 10:48946953-48946975 GCTCACCTGCAGAGCGCAGAAGG - Exonic
1068703159 10:60041831-60041853 ACTGGTATGCAGAGTGCTGAGGG - Intronic
1069736266 10:70656726-70656748 GCTGGGATGCAGAGAGCGGAAGG + Intergenic
1069950155 10:72013108-72013130 GCTGAGATGGAGACTTCAGGGGG - Exonic
1070664834 10:78335744-78335766 GCTCAGCTGCAGGGTGCAGGTGG + Intergenic
1071146117 10:82574376-82574398 GCTGGGAAGCATAGGGCAGAAGG + Intronic
1071230858 10:83582902-83582924 GGTGAGATGAAGAAGGCAGAGGG + Intergenic
1071469731 10:85975301-85975323 GCTGAGGTGCAGGGTGGACAGGG + Intronic
1071954027 10:90737258-90737280 GAGGTGATGCAGAGTGAAGAGGG - Intergenic
1072455077 10:95568397-95568419 GTGGAGATGCAGAGTGCTGGGGG + Intergenic
1072550731 10:96475401-96475423 GCTGAGAACAAGAGTGCAGGTGG - Intronic
1072670647 10:97426577-97426599 GTTGAGAAGATGAGTGCAGAGGG + Intronic
1072756519 10:98025096-98025118 ACTGAGATCCAGAGAGGAGAGGG - Intronic
1073056223 10:100704438-100704460 GAGGAGATGGAGAGGGCAGAGGG - Intergenic
1073267540 10:102236958-102236980 GCTGAACTGCAGTGTGCAAATGG + Intronic
1073442361 10:103559629-103559651 GCTGAGATGCAGACAGATGAAGG - Intronic
1075167695 10:120084110-120084132 TCTGAATTCCAGAGTGCAGAGGG - Intergenic
1075846516 10:125549295-125549317 GATGAGATACAGTGTGCAGTTGG - Intergenic
1076302715 10:129440199-129440221 GCTGGGATGCTGAGTTCTGATGG - Intergenic
1076624578 10:131813720-131813742 GCAGATATGCAGGATGCAGAGGG - Intergenic
1077140468 11:1022059-1022081 GCGGGGCTGCAGAGGGCAGAGGG - Intronic
1077140476 11:1022096-1022118 GCGGGGCTGCAGAGGGCAGAGGG - Intronic
1077873298 11:6281455-6281477 GCTGAAATGCAGGGAGCAGCCGG + Intergenic
1079106111 11:17573424-17573446 GCAGAGATGGAGGGTGCAGGAGG - Intronic
1080455147 11:32412004-32412026 CCTGAGATGCAAAGTGAAGGTGG - Intronic
1080986809 11:37477510-37477532 GCTGACAGGCAGAGGGCATAGGG - Intergenic
1081719197 11:45274577-45274599 TCTGAGAAGCAGGGTGCAGGGGG + Intronic
1084229861 11:67743750-67743772 GCTGAGATGCAGCCACCAGATGG + Intergenic
1084359899 11:68662447-68662469 GCTGAGATCCAGAGGGAAGTGGG + Intergenic
1085400372 11:76232425-76232447 GCTGTGATGCAGAGAGGAGAGGG - Intergenic
1085730647 11:78995746-78995768 GATGAGATGCAGAGTGAGGGTGG + Intronic
1086575115 11:88330982-88331004 GGTGAGATGCAGGATGCTGAGGG + Intronic
1087099809 11:94352900-94352922 GCTGGGATGAAGGGTGCAAAGGG - Intergenic
1088732602 11:112696388-112696410 GCTGACATGAAGACTGGAGAAGG - Intergenic
1088986939 11:114917581-114917603 GCTGAGCAGCAGAGAGCAGGGGG - Intergenic
1090075205 11:123576247-123576269 GCTGGGATGCAGCCTGCAGGGGG + Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1092559072 12:9590678-9590700 GTTGAGATACAGAGTGCAGTTGG + Intergenic
1093082861 12:14833474-14833496 GCTGAGATTCAGAGAGCTTAAGG - Intronic
1095823498 12:46507220-46507242 GCTGAGCTGGAGAGTGGAGTGGG + Intergenic
1095858391 12:46887206-46887228 GCTGAAGTGCAGAGGGCACAAGG + Intergenic
1096037040 12:48481689-48481711 GCAGAAATGCAGAGTGGAGAAGG - Intergenic
1096235210 12:49921751-49921773 GCAGAGATCCTGAGTGCAGTTGG + Intergenic
1100258387 12:92907382-92907404 TCTGAGATGGAGAATGTAGATGG - Intronic
1101915478 12:108892601-108892623 GATGAGATTCAGAGTAGAGAAGG - Intronic
1103828486 12:123760524-123760546 GCAGAGATCCAGAGCACAGATGG + Exonic
1104592477 12:130095763-130095785 GCTGAAATGCAGAGACCTGAAGG - Intergenic
1104804921 12:131581618-131581640 ACAGACAGGCAGAGTGCAGAGGG - Intergenic
1106582113 13:31027549-31027571 GGGTAGATGCAAAGTGCAGAGGG - Intergenic
1107075756 13:36319713-36319735 GCTGGGATGAAGGGTGCAAAGGG - Intronic
1107220124 13:37971616-37971638 GCTGGGATGAAGGGTGCAAAGGG + Intergenic
1108868926 13:54958567-54958589 ACAGAGATGCAGAGAGCAGCAGG + Intergenic
1109353084 13:61208072-61208094 GCTGGGATGAAGGGTGCAAAGGG - Intergenic
1109462985 13:62687896-62687918 GCTGAGATTCAAACAGCAGATGG - Intergenic
1110616449 13:77547459-77547481 GCTTTGATGCTGAGTGCAGAAGG + Intronic
1112520565 13:100091086-100091108 GCTCTGATGCAGAGAGTAGATGG + Intronic
1113901993 13:113802684-113802706 GCTGAGAAGCAGATGGCAGGAGG - Intronic
1114270323 14:21097174-21097196 GGTGAGCTGCAGAGTGGAGCGGG - Intronic
1114994188 14:28327251-28327273 GATGATATGCAAAGTGCTGAAGG - Intergenic
1115857987 14:37651842-37651864 GGTGGGATGCAGAGTCTAGAGGG + Intronic
1116040477 14:39680166-39680188 GCTGACATGTAGAGGGCCGAAGG - Intergenic
1117201871 14:53398620-53398642 CCTGAGATGGGGAGTGCAGAAGG + Intergenic
1117355825 14:54922982-54923004 GCTGAAATGCCTAGTGCAAAAGG + Intergenic
1118054923 14:62069886-62069908 TCTCAGATGCAGAGTGCAGAGGG - Intronic
1119878961 14:78085045-78085067 GCTGAGATGCAGAGAGAGTAAGG - Intergenic
1119947996 14:78714974-78714996 GCAGAGATGCAGAATGCTGCGGG + Exonic
1120478847 14:85023705-85023727 TCTGAGATGAAGATTCCAGAGGG - Intergenic
1120838782 14:89064677-89064699 ACAGGGCTGCAGAGTGCAGAAGG + Intergenic
1121298201 14:92847352-92847374 TCTGAGCTGCAGACTGCAGGAGG + Intergenic
1121616255 14:95315637-95315659 TCTGGGTTGCACAGTGCAGAAGG - Intronic
1121816376 14:96932093-96932115 GCTGGGATTCAGAGTGCACGGGG + Intergenic
1121957012 14:98223447-98223469 GGAGGAATGCAGAGTGCAGAGGG + Intergenic
1122637215 14:103135792-103135814 CCTGGGCTGCAGAGGGCAGATGG - Exonic
1122808016 14:104270435-104270457 GCTAAGCTGCAGTGTGCAGGGGG + Intergenic
1122875422 14:104662140-104662162 GCTAAGCTGCAGTGTGCAGGGGG - Intergenic
1122940628 14:104979457-104979479 GGTGAGGATCAGAGTGCAGAGGG + Intergenic
1123882323 15:24688022-24688044 GCTGGGATGAAGGGTGCAAAGGG + Intergenic
1124080191 15:26486981-26487003 GCTGAGGTGCAGCGAGAAGATGG + Intergenic
1124882945 15:33659108-33659130 GCTGATGTGCAGTGGGCAGAGGG + Intronic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1125766938 15:42142374-42142396 GCTGAGACCCAGGGAGCAGAGGG + Intronic
1128729883 15:70014025-70014047 GTTGAGAGGAAGAGTGCAGGAGG - Intergenic
1129185297 15:73902467-73902489 GCTGAGAGGCAGAGAAAAGAGGG - Intergenic
1130238885 15:82166224-82166246 CCAGGGATGCAGACTGCAGATGG + Intronic
1130815378 15:87426579-87426601 GCTGATATGCAGATGGCAGAAGG - Intergenic
1130855276 15:87834538-87834560 GCTGGGATGAAGGGTGCAAAGGG - Intergenic
1131398497 15:92105754-92105776 GCTGGGATGCAGAAGGGAGATGG + Intronic
1131436910 15:92430310-92430332 GCAGAGATGGAAAATGCAGATGG + Intronic
1132707666 16:1253571-1253593 GCTGAAAAGCAAAGCGCAGACGG - Intergenic
1132716100 16:1290553-1290575 GCTGAGGGGCAGAAGGCAGAAGG + Intergenic
1132725330 16:1335926-1335948 TCTGAGATGCAGGGAGCAAAGGG + Intronic
1133104852 16:3500855-3500877 CCTGAGACGCCGAGGGCAGAGGG - Intergenic
1133157470 16:3885232-3885254 GATGAGATGGAGGGTGCACAGGG + Intergenic
1133555581 16:6903749-6903771 GGTGAGAGGCAGAGGGCTGAGGG + Intronic
1135042653 16:19129890-19129912 GCTGAGGGGCAGAAGGCAGAAGG - Intronic
1135247784 16:20871974-20871996 ACGGAGATGAAGAGTGCAGCAGG - Intronic
1135645519 16:24158140-24158162 CCTGAGATGCCAAGTGCAGTTGG + Intronic
1137043502 16:35636502-35636524 GCTGAGAAGCCGAGTGCAACAGG + Intergenic
1137322086 16:47394796-47394818 TCTGAGATCCTGAGTGCAAAGGG + Intronic
1137384702 16:48030604-48030626 TCTGAGATGCCCAATGCAGAGGG - Intergenic
1137523525 16:49213664-49213686 AGTGAGATGCAGAGTGCAGTGGG - Intergenic
1137737856 16:50738327-50738349 ACTAAGATGGGGAGTGCAGAGGG + Intergenic
1138295919 16:55885087-55885109 GCTAAGCTGCACACTGCAGAAGG - Intronic
1138969739 16:62130336-62130358 GCTGAGAATCAGAGTGTGGACGG + Intergenic
1139356341 16:66369048-66369070 ACTGAGGTGCAGGCTGCAGAGGG - Intronic
1139483489 16:67243866-67243888 GCTGAGCTGCAGACTGGTGAGGG - Intronic
1139672437 16:68500943-68500965 GCTGGGATGCAGAGTCCCCATGG + Intergenic
1139853248 16:69962882-69962904 CCTGAGATGCAGGGTCCTGATGG + Intronic
1139882219 16:70185790-70185812 CCTGAGATGCAGGGTCCTGATGG + Intronic
1140370291 16:74409714-74409736 CCTGAGATGCAGGGTCCTGATGG - Intronic
1140616073 16:76665841-76665863 ACTGAGCTGCAGACTGCAGAAGG - Intergenic
1141205320 16:81928959-81928981 GCTGAAATGCAGCGTGGAGTTGG + Intronic
1141936751 16:87244892-87244914 GCTGACATCCTGAGCGCAGAGGG - Intronic
1142161321 16:88559080-88559102 GCTGGGAAGCAGGGTGCTGATGG - Intergenic
1142212506 16:88815170-88815192 GCTGAGAGGCCGAGTCAAGAGGG - Intronic
1142338433 16:89505620-89505642 CCTGACGTGCAGAGTTCAGAGGG + Intronic
1143123844 17:4628072-4628094 GCTCTGATGCAGAGTGTAGGAGG + Intergenic
1143426299 17:6841810-6841832 GCTCTGATGCAGAGTGTAGGAGG - Intergenic
1143735728 17:8910955-8910977 GCAGAGCTGCAGAGAGCAGGAGG - Intronic
1144186613 17:12802553-12802575 GAGGAGAGGCAGAGTGCAAAAGG + Intronic
1147453376 17:40519802-40519824 GCTGGGATGCAGGGGGCAGGTGG - Intergenic
1148682149 17:49480458-49480480 GCTGGGAAGCAGAGGGGAGAAGG + Intergenic
1148765177 17:50034676-50034698 GGTGAGAGGCAGAGGGCAGTGGG + Intergenic
1148996485 17:51714702-51714724 GCTCAGATGGAGAGAGAAGAAGG + Intronic
1149468494 17:56897896-56897918 GCTGGGATGCCTGGTGCAGATGG - Intronic
1150601365 17:66653681-66653703 GGGGAGATGCAGAATGCAAACGG - Intronic
1152468482 17:80478106-80478128 GCTGAGATGCTGAACGCAGACGG - Intergenic
1152895497 17:82908671-82908693 GCATGGCTGCAGAGTGCAGACGG + Intronic
1155368363 18:25071961-25071983 GCTGAGAACCAGAGGGCAGAAGG + Intronic
1156964364 18:43072695-43072717 GATGAAATGCAGAGTACAGACGG - Intronic
1158825649 18:61215735-61215757 GCAGAGAGGCAGGGTGGAGATGG + Intergenic
1160167600 18:76527918-76527940 GCAAAGATGCAGGGTGCAGAGGG - Intergenic
1160534062 18:79581914-79581936 GCTCACATGCACAGTGCACACGG + Intergenic
1160588160 18:79924178-79924200 GCTGAGATGCGTGGTGCAGGTGG + Intronic
1162529809 19:11229297-11229319 GCTGAGACCCACTGTGCAGAAGG - Intronic
1162706010 19:12555433-12555455 GGTGAGACGCAGAGTGCGGCCGG + Intronic
1163302649 19:16457597-16457619 GCAGCCATGCAGAGGGCAGAAGG + Intronic
1163430340 19:17263514-17263536 GCTGAGAAACAGAGTGAAGTTGG + Intronic
1164824530 19:31274665-31274687 GGTTAGATGCTCAGTGCAGAAGG - Intergenic
924976209 2:178021-178043 GCTGGAGAGCAGAGTGCAGAAGG + Intergenic
926225117 2:10961675-10961697 GCTGTGATGCAGAGTAGAGGGGG - Intergenic
926589928 2:14729793-14729815 GCAAGGATGCAGAGTGCAGCAGG + Intergenic
926712648 2:15894290-15894312 GCTGAGGTGCAGACTGGGGAGGG - Intergenic
927180095 2:20439604-20439626 GTGGAGATGCAGTGAGCAGAAGG - Intergenic
927995196 2:27480186-27480208 GCTGAGCTAAAGAGTGCAAATGG + Intronic
928767079 2:34660154-34660176 TCTGGGAGGCAGAGTTCAGATGG + Intergenic
929400535 2:41575777-41575799 GCAGAGATCCAAAGTGCCGAAGG - Intergenic
929538770 2:42803406-42803428 GCGGAGATGAATAGTGGAGATGG + Intergenic
930750164 2:54926808-54926830 GATGAGATTCAGGTTGCAGAGGG - Intronic
933065132 2:77782469-77782491 GATGAGATGCCAGGTGCAGAAGG + Intergenic
933069187 2:77836332-77836354 GCTGAGGGGCATAGGGCAGAGGG - Intergenic
934901769 2:98165526-98165548 ACAGAGGTGCAGAGGGCAGAGGG + Intronic
934935072 2:98459413-98459435 GCTGGCGTGCAGAGTGCTGAGGG + Intronic
937115626 2:119403156-119403178 GCGGTGATGCAGACAGCAGAGGG + Intergenic
937460180 2:122078724-122078746 GCTAAGATCCAGAGTCCAGAAGG - Intergenic
940718626 2:157257653-157257675 GTTGAGTTACAGCGTGCAGACGG + Exonic
941684282 2:168431828-168431850 GCTCATGTGCAGATTGCAGATGG + Intergenic
943736723 2:191364672-191364694 GCTGTGATGTGGAGAGCAGAGGG + Intronic
944034909 2:195282896-195282918 CCTGAGATGAGGAGTGCTGAAGG + Intergenic
946325471 2:218982622-218982644 GCTGAGATGGAGAGTGGCGGCGG - Intronic
946474224 2:219992213-219992235 GCAGGGCTCCAGAGTGCAGAGGG + Intergenic
947166241 2:227264768-227264790 GCTGACATACAGAGTTCACAGGG + Intronic
948014509 2:234677084-234677106 ACTCAGATGCAGACTGCAGATGG - Intergenic
1168799087 20:633240-633262 GCTGAGACTCAGAGTGGGGAAGG + Intergenic
1168892020 20:1300825-1300847 GCTGGGAAGGAGAGAGCAGACGG - Intronic
1169854774 20:10090787-10090809 GCTGAGAGGCTGAGTTCTGAGGG - Intergenic
1170119260 20:12894135-12894157 GCTGATATGCAGAGTGCTGAGGG - Intergenic
1170431468 20:16280464-16280486 GATGTGAAGCAGAATGCAGAGGG + Intronic
1173234642 20:41233590-41233612 TCTGAGATTCACAGTGCAGTAGG + Intronic
1173560817 20:44004164-44004186 GCTGAGATGTAGAGGACACAGGG + Intronic
1175166102 20:57045832-57045854 GTTAAAACGCAGAGTGCAGAGGG - Intergenic
1176123207 20:63463487-63463509 GCTGGGACTCAGGGTGCAGAGGG - Intronic
1176285633 21:5017845-5017867 ACTGAGACTCAGACTGCAGAGGG - Intergenic
1178724630 21:35040175-35040197 GCCCAGATGCAGCCTGCAGATGG + Intronic
1178859145 21:36274624-36274646 GCTGAGAAGCAAAGTGCAACAGG + Intronic
1179050415 21:37884394-37884416 GCTGAGATGCAGAGAGAAGCTGG - Intronic
1179162294 21:38908575-38908597 GCTGAGAGGCATAAGGCAGATGG - Intergenic
1179289435 21:40005910-40005932 GCTGGGATCCAGAGTGTGGATGG + Intergenic
1179317803 21:40260394-40260416 GCTGAACTGCAAAGAGCAGATGG + Intronic
1179520332 21:41939544-41939566 GCTGAGGTGCAGAGAGCCGTGGG - Intronic
1179871548 21:44245630-44245652 ACTGAGACTCAGACTGCAGAGGG + Intergenic
1180614243 22:17117554-17117576 GCACAGCTGCAGAGTGCACAGGG - Exonic
1180854620 22:19038171-19038193 GCTGGGCTGCAGAGCCCAGATGG + Exonic
1180920710 22:19520163-19520185 GCTGAGCAGCAGAGTGCCGAGGG + Intronic
1181000982 22:19987573-19987595 GCTGCGATGCACAGAGCACAAGG + Intronic
1181032326 22:20154586-20154608 TCAGAGATGCAGAGAGCAGGGGG - Intergenic
1181504902 22:23346896-23346918 GCTGAGATGCAGACTGCTCAAGG - Intergenic
1181656016 22:24299517-24299539 GCTGAGATGCAGACTGTTCAAGG - Intronic
1181709890 22:24677143-24677165 GCTGAGATGCAGACTGCTCAAGG - Intergenic
1181782397 22:25202565-25202587 GGAGAGATGCAGAAAGCAGAGGG + Intronic
1182285883 22:29246680-29246702 ACTTAGATCCGGAGTGCAGAGGG + Intronic
1182674899 22:32031512-32031534 GCTGAGAAGCAGAGAGGGGAGGG - Intergenic
1183064391 22:35353262-35353284 GCAGAAAAGCAGAGTGCAAAGGG - Intergenic
1183708028 22:39487075-39487097 GCGGAGAAGCAGGCTGCAGAGGG + Intronic
1183814776 22:40290581-40290603 GCAGAGAAGCAGAGAGCTGAAGG - Intronic
1184251926 22:43265553-43265575 GGTGAGAGGCAGCGTGCAGGGGG - Intronic
1184606776 22:45578916-45578938 GCTGAGATGCAAAGTCCTCAGGG - Intronic
1184636035 22:45832363-45832385 GCTGAGGAGGAGGGTGCAGATGG - Intronic
1184747384 22:46464302-46464324 GGTGACACGCAGGGTGCAGAAGG + Exonic
1184787721 22:46679971-46679993 GCTGAGAAGCAGAGTCCTGTTGG + Intergenic
1185074461 22:48675882-48675904 GCTGTGATGCACAGGGCAGTGGG - Intronic
1185147710 22:49148267-49148289 GCTGAGGTGGAGGGTGCACACGG + Intergenic
949191076 3:1249877-1249899 GCTGAGAGGCAGCTGGCAGAGGG - Intronic
949653451 3:6188647-6188669 GCTGATATGCTGATTGGAGATGG + Intergenic
950211588 3:11127222-11127244 GCTGCGGTGCAGAGAACAGAGGG + Intergenic
950252264 3:11475594-11475616 GCTGATCTGCAGACTGCAGAGGG - Intronic
950706311 3:14784568-14784590 GCTGAGATGCAGAATACCAAGGG - Intergenic
952332455 3:32376764-32376786 GCTGAGCTCCAGAGGGAAGACGG - Intergenic
952901379 3:38114167-38114189 GCTGGGAGGGAGAGTGGAGATGG + Intronic
952918890 3:38270999-38271021 GCTCAGTTCCAGAGTGCAGCTGG + Intronic
953842398 3:46399629-46399651 AATGAGATCCAGAGTGCAGGGGG + Intergenic
954570718 3:51638542-51638564 GCTGAGTTGCACACTGCAGGGGG - Intronic
956480067 3:69664453-69664475 AGAGAGATTCAGAGTGCAGAAGG - Intergenic
956890967 3:73613731-73613753 CCTGGGATGCAGGGTGCAGAAGG + Intronic
958175731 3:89993800-89993822 GCTGAGAAGAATAGTGCAGGGGG + Intergenic
958255891 3:91324468-91324490 TCTGATGTGCAAAGTGCAGAAGG + Intergenic
958566677 3:95821233-95821255 GGAGAGATGCAGAGTGAACAGGG + Intergenic
959894951 3:111594960-111594982 GCTGGGATGCACAGAGGAGAAGG + Exonic
960079468 3:113525878-113525900 TGTGAGATGGAGAGTGCAGCTGG + Intergenic
965070496 3:163910831-163910853 GCTGGGATGAAGGGTGCAAAGGG - Intergenic
965505812 3:169513430-169513452 GATGAGCTGCATAGTTCAGAAGG + Intronic
965661352 3:171045435-171045457 GCTGATTTGCAGGGTGCTGAGGG + Intergenic
967828380 3:193897390-193897412 TCTGAGATGCAGATTCCCGAGGG + Intergenic
968282106 3:197484946-197484968 GCTGAGGGCCAGAGAGCAGAGGG - Intergenic
968491308 4:892014-892036 GCTGGGAAGCCCAGTGCAGACGG - Intronic
969943539 4:10759504-10759526 GCTAAGATGCAGGGAGAAGATGG + Intergenic
970019797 4:11555231-11555253 TCTGGGATGCAGAGCTCAGAGGG - Intergenic
971837235 4:31783491-31783513 GCTGACATGCAGAGATCACATGG + Intergenic
972977363 4:44652983-44653005 GTTAAGATGGAGAGTGCAAAGGG + Intronic
975393188 4:73844191-73844213 GATGAGAAGCACAGTACAGAGGG - Intronic
978223110 4:106301390-106301412 GTTTAGAAGCAGAGTGAAGATGG - Intronic
978253712 4:106666834-106666856 GCTAAGATCCAGAATCCAGAAGG - Intergenic
982321675 4:154083283-154083305 AGTGAAGTGCAGAGTGCAGATGG + Intergenic
983060011 4:163149093-163149115 ACTGAGATGCAGTTTGCAGGTGG - Intronic
983950695 4:173637557-173637579 GCAGAGATACAGAGAGGAGAGGG - Intergenic
984480674 4:180297410-180297432 GCTGTGTTCCAGAGAGCAGAGGG + Intergenic
984712618 4:182898264-182898286 GCAGAGGTGGAGAGTACAGAGGG - Intronic
985269887 4:188183913-188183935 GCAGAGCGGCAGAGTGGAGAAGG + Intergenic
985779680 5:1863737-1863759 ACTGAGAGGCAGAAGGCAGAAGG + Intergenic
985929851 5:3048416-3048438 GCTGGGATACACAGTGCTGATGG - Intergenic
985989011 5:3539767-3539789 CCTGAGATGCAGAGCAGAGAAGG - Intergenic
987156527 5:15095197-15095219 GCAGAGAGGCAGAGCCCAGATGG - Intergenic
987246199 5:16051463-16051485 GCTGAGATGAAAAGAGCACATGG + Intergenic
987594226 5:19974815-19974837 GCTGGGATCCAGGGTGCAGGGGG + Intronic
990021650 5:51135126-51135148 GGTGGGATTCAGAGTGCAGAAGG - Intergenic
990048790 5:51469033-51469055 GCTGAGGTCCAGGGTGCCGAAGG + Intergenic
991089760 5:62682813-62682835 GCTGAGATGGAGGTTGCAGGAGG + Intergenic
992728346 5:79632103-79632125 CCAGAGAAACAGAGTGCAGAAGG + Intronic
992914672 5:81435899-81435921 CCTGAGATGCTGGGTGCAGTGGG + Intronic
993703469 5:91144212-91144234 GCGGAGATGCTGGCTGCAGAAGG - Intronic
994533338 5:100994124-100994146 GCTGAGATGGAGAGAAAAGAAGG + Intergenic
996523533 5:124452762-124452784 CCTGGTTTGCAGAGTGCAGAGGG + Intergenic
996576630 5:124983184-124983206 GCTGAGATTTAGGGTACAGATGG + Intergenic
996836788 5:127802448-127802470 GCAGAGATGCAGGGTGCACTTGG - Intergenic
996893585 5:128453716-128453738 GCTGAAATGCAGAGTGGGGAAGG + Intronic
997442133 5:133916252-133916274 GCTGAGATGCATAGGGATGAGGG + Intergenic
998166111 5:139845016-139845038 TTTGAGAGGCAGAGTGGAGAAGG + Intergenic
998251242 5:140554538-140554560 GCTAGGATGCAGAGTACAGCTGG - Intronic
998334642 5:141360676-141360698 GCTGAGAAACAGACTCCAGATGG + Exonic
999468417 5:151829169-151829191 GCTGAGAAGCAGACAGCAGTGGG - Intronic
999577914 5:153000783-153000805 GCTGAAATGTAGAATGGAGAAGG - Intergenic
1000038185 5:157464690-157464712 CTTGAGATGAAGAGTGTAGAAGG + Intronic
1002184831 5:177449482-177449504 GGTAACATGCAGAGTGCCGAGGG - Intronic
1002700219 5:181118875-181118897 GCAGCGAGGCAGAGTCCAGATGG + Intergenic
1002908714 6:1471846-1471868 GCTGAGAGGCACAGTCCTGAAGG - Intergenic
1003011775 6:2433665-2433687 GCTGAGATACAGAGGGCAGCGGG - Intergenic
1003044128 6:2717382-2717404 GCAGACATGCAGAATGCAGCAGG + Intronic
1003334796 6:5160295-5160317 GCTGAGAAGTGGAGAGCAGAAGG + Intronic
1004028900 6:11846827-11846849 GCCAAGATGCAAAGTGCAGATGG - Intergenic
1004516091 6:16323475-16323497 GCTGGAGTGCAGAGTGCAGTGGG - Intronic
1005385759 6:25282510-25282532 GCTGAGATAAAGAGTGAAAACGG - Intronic
1005877596 6:30024401-30024423 GCTGAGATACAGAGTTCCTAGGG - Intergenic
1006341214 6:33448170-33448192 CCTGAGATGCAGAGAGGAGTGGG - Intronic
1006628036 6:35411311-35411333 GCAGAGTAGCAGAGTGCTGAAGG + Intronic
1006764611 6:36493753-36493775 ACTTAGAGGCAGAGTGCTGATGG - Intergenic
1006781767 6:36637080-36637102 GGGGAGAGGCAGAGAGCAGAAGG + Intergenic
1006797002 6:36738145-36738167 ACTGAGACCCAGAGGGCAGATGG + Intergenic
1007306205 6:40907307-40907329 GCTGGGATGGAGATTCCAGATGG + Intergenic
1007702510 6:43773067-43773089 GCTGAGGTGCAGAATCCAGGGGG + Intronic
1007776499 6:44227120-44227142 CCTGAGGGGCAGGGTGCAGAGGG + Intronic
1008169882 6:48190747-48190769 GCTGAAATGTAGAGTGCATATGG - Intergenic
1008703735 6:54132390-54132412 GCTGTGATTCAGAGTACACAAGG + Intronic
1008999450 6:57696705-57696727 TCTGATGTGCAAAGTGCAGAAGG - Intergenic
1009187936 6:60596109-60596131 TCTGATGTGCAAAGTGCAGAAGG - Intergenic
1010103112 6:72133475-72133497 TCTGACATGCACAGTGCAGCTGG + Intronic
1011806013 6:91073327-91073349 CCTGAGATCCAGAGAGCTGATGG + Intergenic
1013026597 6:106279784-106279806 CCTTAGATGGACAGTGCAGAAGG + Exonic
1013608942 6:111776002-111776024 GCTGAGATGAAGAGTGAAAATGG - Intronic
1014639977 6:123897563-123897585 GCTGAGATGCAGTGTGCACTGGG + Intronic
1014966713 6:127762489-127762511 GCAGAGAGCCAGAGTGCATAAGG - Intronic
1015174676 6:130293923-130293945 GCTAAGATGCTGTGTGCATAAGG - Intronic
1015914902 6:138205919-138205941 GCAGAGCTGCAGAGTGGACAGGG + Intronic
1017677293 6:156827295-156827317 AATGAGATGGAGTGTGCAGAGGG - Intronic
1017759961 6:157561033-157561055 ATTTAAATGCAGAGTGCAGAAGG + Intronic
1018846696 6:167561828-167561850 AATGGGATCCAGAGTGCAGAGGG - Intergenic
1019010357 6:168839769-168839791 TCTGAGATGGGGAGTGGAGAGGG + Intergenic
1019010370 6:168839815-168839837 TCTGAGATGGGGAGTGGAGAGGG + Intergenic
1019607902 7:1919198-1919220 GCTGAGATGCAGAGAGAAAAGGG + Intronic
1020540974 7:9461002-9461024 GCTGGGATGAAGGGTGCAAAGGG + Intergenic
1020847095 7:13299848-13299870 GCAGAGATGAAGAGTAAAGAAGG - Intergenic
1021387586 7:20050798-20050820 GCTGAGAGGCAGACTGTAGAAGG - Intergenic
1021645149 7:22782397-22782419 CCTGACAGGCAGAGTGTAGAAGG - Intergenic
1022250827 7:28606538-28606560 ACTGAGAGGCAGAGGGAAGATGG - Intronic
1023652714 7:42388443-42388465 GCTGAGACCCTGAGGGCAGAGGG - Intergenic
1024343487 7:48290245-48290267 GCTGAGTTGGAGAATGCAGCTGG + Intronic
1024677615 7:51651378-51651400 GCAGAGTTGCAGAGTGGAGAAGG - Intergenic
1027291971 7:76723871-76723893 CCAGAGATGCAAAGTGCAGCTGG - Intergenic
1027457878 7:78416299-78416321 GCTGAGATAAAAAATGCAGAAGG + Intronic
1027736588 7:81939962-81939984 CCTGAGATACAGAGGGCAAAAGG + Intergenic
1027868692 7:83678780-83678802 GCTGAGATGCAGAAAGCAGTAGG + Intergenic
1029282929 7:99448302-99448324 GCTGAGAACCAGGGTGCAGAGGG + Intronic
1031106642 7:117551811-117551833 GCTGTGATGCAGACAACAGAAGG - Intronic
1034265341 7:149777920-149777942 GAGGAGATGCAGAGTGGAAAAGG - Intergenic
1034732720 7:153401820-153401842 GCAGAGATGCACAGGGCAGATGG - Intergenic
1034785747 7:153924575-153924597 GCTGTGATCCAGAAAGCAGAAGG - Intronic
1035037340 7:155903845-155903867 GCTGGGGAGCAGAGTGCACATGG - Intergenic
1035147153 7:156830647-156830669 GCTGAGATGAAGACTTAAGATGG - Intronic
1035692804 8:1571192-1571214 GATGAGATGGAGAGGGGAGAGGG + Intronic
1035692879 8:1571562-1571584 GATGAGATGGAGAGGGGAGAGGG + Intronic
1037605430 8:20433999-20434021 GGTGAGATGCAGGGTGGAGGTGG - Intergenic
1039033487 8:33333868-33333890 GCTGAAATACAGAGTGAGGAAGG + Intergenic
1039743494 8:40403115-40403137 GAAGAGATACAAAGTGCAGAAGG - Intergenic
1040049449 8:42998113-42998135 ACAGAGATGCAGAGTGCTGGGGG - Intronic
1040336592 8:46419177-46419199 GTGGAGATGCAGAGTGGAGTGGG + Intergenic
1040945075 8:52875618-52875640 GAAGAGTTGCTGAGTGCAGAGGG + Intergenic
1042348336 8:67750433-67750455 GCTGTGATGCAAAGTTAAGAGGG + Intergenic
1043364579 8:79517798-79517820 GCTGAGAAGGAGAAGGCAGAGGG + Intergenic
1043526505 8:81103440-81103462 ACTGAGATACAGGGTTCAGATGG - Intronic
1043837899 8:85066240-85066262 GCTGGGATGAAGGGTGCAAAGGG - Intergenic
1043890007 8:85644139-85644161 GCTGAGATGCGGACTCCCGAGGG + Intergenic
1043891547 8:85656053-85656075 GCTGAGATGCGGACTCCCGAGGG + Intergenic
1043892619 8:85662890-85662912 GCTGAGATGCGGACTCCCGAGGG + Intergenic
1043892938 8:85714445-85714467 GCTGAGATGCGGACTCCCGAGGG - Intergenic
1043895625 8:85735899-85735921 GCTGAGATGCGGACTCCCGAGGG - Intergenic
1043897054 8:85745909-85745931 GCTGAGATGCGGACTCCCGAGGG + Intergenic
1043899380 8:85764277-85764299 GCTGAGATGCGGACTCCCGAGGG + Intergenic
1043900988 8:85776470-85776492 GCTGAGATGCGGACTCCCGAGGG + Intergenic
1043902952 8:85791745-85791767 GCTGAGATGCGGACTCCCGAGGG + Intergenic
1043904562 8:85803938-85803960 GCTGAGATGCGGACTCCCGAGGG + Intergenic
1043906174 8:85816129-85816151 GCTGAGATGCGGACTCCCGAGGG + Intergenic
1043907782 8:85828319-85828341 GCTGAGATGCGGACTCCCGAGGG + Intergenic
1045009154 8:97942965-97942987 CCTGCGATTCAGAGTCCAGAGGG - Intronic
1046644595 8:116771813-116771835 TCTGAGAAGCAGAATGCAGAAGG + Exonic
1047250600 8:123179369-123179391 TATGGGATGCACAGTGCAGAAGG + Exonic
1047555316 8:125923165-125923187 GCTGAGATTCAGAGAGGACATGG + Intergenic
1047856546 8:128917682-128917704 GCTGGGATGAAGGGTGCAAAGGG - Intergenic
1048266624 8:132992811-132992833 GAAGGGATGGAGAGTGCAGAAGG - Intronic
1048986039 8:139735548-139735570 GGGGAGATGGAGAGAGCAGATGG + Intronic
1049052026 8:140205766-140205788 GCTGAGATGGAGACTGTAGGAGG - Intronic
1049196020 8:141316090-141316112 GCTGGGATGCAGATTCCAGGAGG - Intergenic
1049292523 8:141812216-141812238 GCTAAGATGAAGAATGGAGAAGG - Intergenic
1049499510 8:142954185-142954207 GAGGAGTTGCAGAGTGCAGAGGG + Intergenic
1049562841 8:143320682-143320704 GCAGAGATGCAGGGAGAAGATGG + Intronic
1050253156 9:3767157-3767179 GCAGAGGGGCAGAGAGCAGATGG + Intergenic
1050683857 9:8145347-8145369 GTGGAGATGCAGAGAGAAGAGGG + Intergenic
1051535289 9:18150758-18150780 GATGGAATTCAGAGTGCAGATGG + Intergenic
1051572698 9:18578366-18578388 TCTGAGATGCAGGGTGAAGAGGG - Intronic
1052721197 9:32173103-32173125 GCTTAGATCCAAAGTGCAAAAGG - Intergenic
1052824806 9:33167065-33167087 GCCAAGGTGCAGAGCGCAGACGG + Exonic
1053218539 9:36292792-36292814 GCTGACCTGCAGAGGGCAGGAGG - Intronic
1053418775 9:37963652-37963674 GCTGAGGTGGAGAGCCCAGAAGG + Intronic
1056316560 9:85395997-85396019 GCTGAGAAGGAGACTGCAGGTGG + Intergenic
1056778921 9:89534693-89534715 GCTGAGATGCTGACAGCAGGGGG + Intergenic
1057743995 9:97737135-97737157 GCTGAGACACAGAGGGCTGAGGG - Intergenic
1061318768 9:129814712-129814734 GCAGAGAGGCAGAGTGGGGAAGG + Intronic
1062232157 9:135487647-135487669 GCAGAGATGCAGTGTGGAGGGGG + Exonic
1062317170 9:135973503-135973525 GGTGTGGAGCAGAGTGCAGAAGG + Intergenic
1186947102 X:14580756-14580778 GCTGAGATGCTCTGGGCAGAAGG - Intronic
1190984047 X:55484671-55484693 TCTTAGATGCTCAGTGCAGAGGG + Exonic
1192048379 X:67700330-67700352 GCTCAGGTGCAGAGGGCAGGAGG + Intronic
1192133535 X:68575304-68575326 GCTGAGATGGGGAGGGCAGAGGG + Intergenic
1192205243 X:69091477-69091499 GCTGAGAACCAGAGTGGGGAAGG - Intergenic
1192832695 X:74767265-74767287 GCTGAGATGCAGTATGCTGGGGG + Intronic
1196046054 X:111257706-111257728 GCTGAGATGCAGAGTGCAGATGG + Intronic
1196132442 X:112171972-112171994 TCTGATATCCAGAGTGTAGAAGG + Intergenic
1197708832 X:129652302-129652324 GATGAGAGGCAGCGTGGAGAGGG + Intronic
1197851469 X:130865392-130865414 GTTGAAATGCACAGTGAAGATGG - Intronic
1198039086 X:132831546-132831568 ACTGAGAGGCAGTGTCCAGAAGG - Intronic
1199095365 X:143732350-143732372 ACTGAGATGTGGAGAGCAGAAGG + Intergenic
1199510276 X:148613857-148613879 ACAGAGATACAGAGTGCAGCAGG - Intronic
1199657299 X:150008908-150008930 GCTGAGAGGGAGAGAGCAAAAGG - Intergenic