ID: 1196056540

View in Genome Browser
Species Human (GRCh38)
Location X:111362432-111362454
Sequence TGGGGGAACTGAATGGCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196056540_1196056549 2 Left 1196056540 X:111362432-111362454 CCCCAAGCCATTCAGTTCCCCCA 0: 1
1: 0
2: 0
3: 19
4: 232
Right 1196056549 X:111362457-111362479 ATCCTAGCTCCACAACTCATTGG 0: 1
1: 1
2: 2
3: 24
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196056540 Original CRISPR TGGGGGAACTGAATGGCTTG GGG (reversed) Intronic
901927897 1:12578648-12578670 TTGGCTGACTGAATGGCTTGGGG + Intronic
902734208 1:18389629-18389651 TGGGGGCACAGAATGACTTTGGG - Intergenic
903889898 1:26562426-26562448 TGGGGGAGCTGCAAGGCTTCAGG + Intronic
904294821 1:29513359-29513381 TGGGGGAAATGAAAGCCTTATGG + Intergenic
904824950 1:33268321-33268343 GGGGGGAACTGAAAGGGCTGTGG - Intronic
905674562 1:39816566-39816588 TGGGGGCACAGGATGGCTGGAGG + Intergenic
907491352 1:54810812-54810834 TGGGGTGGCTGAATGCCTTGCGG - Intronic
908146007 1:61244485-61244507 TAGGGAAACTGAAGGGCTAGGGG + Intronic
914322662 1:146580241-146580263 TGGGGGCAATGAGTGGATTGGGG + Intergenic
914949585 1:152100902-152100924 TGGGGAAACTGAGTGGATAGTGG - Intergenic
915217155 1:154348085-154348107 TGGAGCAACTGAATGGGTTGTGG + Intronic
915567149 1:156721522-156721544 AGGGGGAGTTGCATGGCTTGGGG + Intergenic
915586442 1:156846291-156846313 TGAGGGAACTGAAGGGCCTATGG - Intronic
917797940 1:178545307-178545329 TGGGGGATCTGCATAGCCTGTGG - Intronic
919345621 1:196373432-196373454 TGGGTTAAGTGATTGGCTTGGGG + Intronic
919748449 1:201022797-201022819 TGTGGGAAGTCAATGGCTTTGGG - Intronic
920124505 1:203682957-203682979 TGGGGGAACTGAGTGGAAGGTGG - Exonic
920216038 1:204362056-204362078 TGGGGGATCTGAGTAGCTTCAGG + Intronic
922466774 1:225849836-225849858 TGAGGGATCTGACTGGCTGGTGG + Intronic
923790480 1:237107059-237107081 TGGGGGAAATAAAAGGCTGGAGG + Intronic
924957736 1:248945271-248945293 TGGGGGTACTGCATGGCTTTGGG + Intergenic
1062951354 10:1506395-1506417 TGGGGGAATTGAACAGCCTGTGG - Intronic
1063478362 10:6348389-6348411 TGAGGGAGCTTATTGGCTTGGGG - Intergenic
1063724269 10:8619869-8619891 CGGGGGAACTGAAGTGCTTGTGG + Intergenic
1064668481 10:17683277-17683299 TGGGCGCAGTGAATGGCCTGAGG - Intronic
1067176142 10:43947435-43947457 TGGGTGAACTGTATGGCATATGG - Intergenic
1067183046 10:44005054-44005076 TGGAGGAACTGAAGTCCTTGTGG + Intergenic
1068607418 10:59021231-59021253 AGGGGTGACTGAATGGGTTGGGG - Intergenic
1069530845 10:69218205-69218227 TTGGGGCACTGAATGGTTTGGGG + Intergenic
1070325150 10:75384071-75384093 TGTGGGAACTGGAAGGCCTGTGG + Intergenic
1071709016 10:88030705-88030727 TGGGGAAACTTAATTGCTTTGGG + Intergenic
1072681500 10:97510636-97510658 AGGGGGAACTGTAAGGCTGGGGG - Intronic
1072881763 10:99235442-99235464 TGGGGGATAGGAAGGGCTTGAGG + Intronic
1074949910 10:118323052-118323074 TGAGGAAACTGACTGACTTGGGG + Intronic
1076495685 10:130896090-130896112 TGGAAGAACTGCATGGGTTGGGG + Intergenic
1077489647 11:2854974-2854996 TGGGAGAACTGGATGGCATTTGG - Intergenic
1077733558 11:4763534-4763556 TTGGGGTACTGAAGGGCATGTGG + Intronic
1078518364 11:12044390-12044412 TGGGGGAAGGGAATGGCTGTGGG + Intergenic
1078625905 11:12958015-12958037 TGGGGGAAGGGAATGGTTTTAGG - Intergenic
1079336162 11:19572527-19572549 TGGGGAAACAGCATGGCTTTTGG + Intronic
1081542079 11:44042548-44042570 TGAGGCAAGAGAATGGCTTGAGG - Intergenic
1082842966 11:57704260-57704282 TGGGGAAACTCACTGGGTTGTGG + Exonic
1084556137 11:69877164-69877186 TGGGCGAACTGTATGGTGTGTGG + Intergenic
1086595501 11:88566318-88566340 TGGGGGAAATCATTGGCTTCTGG + Intronic
1087209464 11:95431929-95431951 TTGGGTAACTGAAGGGCTTAGGG + Intergenic
1088636422 11:111825447-111825469 AGGGGAAATTAAATGGCTTGAGG - Intronic
1088750268 11:112836963-112836985 TGTGGGAAGAGAATGGCTGGAGG + Intergenic
1090846392 11:130533289-130533311 GTGGGAAACTGAAAGGCTTGTGG + Intergenic
1091096232 11:132824855-132824877 TGGATAAACTGAAGGGCTTGTGG - Intronic
1091750590 12:3019314-3019336 TGGGGGAAAGGAATGGGGTGTGG - Intronic
1091806224 12:3358118-3358140 AGGGGGAACCGAAAGGCTTCAGG - Intergenic
1093082972 12:14835146-14835168 TGGGGACACAGAATAGCTTGTGG + Intronic
1095728022 12:45473870-45473892 TAGGAGAACTTAATGGCTTCAGG + Intergenic
1098005061 12:65987725-65987747 TTGGCTAAATGAATGGCTTGTGG - Intergenic
1098057910 12:66527909-66527931 TGGGGGAATTGCATGTCATGGGG - Intronic
1098985317 12:77005706-77005728 TGGGGGAAATAATTGGCTTCTGG + Intergenic
1101814706 12:108136935-108136957 TTGGGTGACTGAATGGCTGGAGG + Intronic
1103240612 12:119410279-119410301 GGAGGGAAATGAATGGTTTGAGG + Intronic
1103857719 12:123985063-123985085 TGGGGGTACAGAATGGTGTGTGG + Intronic
1108308942 13:49166416-49166438 TGTGGGGACTGTAGGGCTTGTGG + Intronic
1108418037 13:50220816-50220838 TGAGGCAGCAGAATGGCTTGAGG + Intronic
1109000808 13:56802535-56802557 TAAGGGAACAGAATGTCTTGGGG + Intergenic
1110629911 13:77697197-77697219 AGGGGGAACAGAAAGGCTTTGGG - Intergenic
1110792727 13:79603034-79603056 TGGGTGAACTGAGTAGCTGGGGG - Intergenic
1113523601 13:110957056-110957078 GGAGGGAACTGATTGGTTTGGGG - Intergenic
1113701665 13:112393179-112393201 GGAGGGAACTGATTGGTTTGGGG + Intronic
1116176225 14:41473545-41473567 TGGGGGCACTGGGTGGCTTGGGG + Intergenic
1116835173 14:49763316-49763338 AGGTGGAACAGAATGGCTAGAGG + Intergenic
1116926406 14:50642568-50642590 TGGGTAAATTGCATGGCTTGGGG - Intronic
1119976252 14:79027432-79027454 CTGGGGGACTGGATGGCTTGGGG + Intronic
1121286070 14:92736940-92736962 TGGGGTCACTGAAGAGCTTGGGG - Intronic
1127678794 15:61272537-61272559 ATGGGGAAATGAATGCCTTGAGG + Intergenic
1127837088 15:62798674-62798696 TGGGGGCACTGAATGACAGGGGG - Intronic
1129825407 15:78631560-78631582 TTGTGGAACTGGATGGCTAGGGG - Intronic
1130245210 15:82241198-82241220 AGGGGGAACTGACTGACTTTAGG - Intronic
1130455470 15:84102214-84102236 AGGGGGAACTGACTGACTTTAGG + Intergenic
1130555124 15:84917334-84917356 GGAGGGAACTGAGTGCCTTGGGG - Intronic
1130576503 15:85097502-85097524 GAGGTGAACTAAATGGCTTGAGG - Intronic
1130948224 15:88565392-88565414 TGGGGGAAAAGAATAACTTGTGG + Intergenic
1131770781 15:95735132-95735154 TGGGGAAAGTGAATGGAGTGGGG + Intergenic
1132453584 16:10312-10334 TGGGGGCACTGCCTGGCTTTGGG - Intergenic
1132765737 16:1533339-1533361 GGGGGCAACTGGATGGCTGGGGG + Intronic
1134149483 16:11795335-11795357 TGGGGCATCTGAATGGGTGGTGG - Intronic
1135523508 16:23195675-23195697 GAGGGGAAGTGAATTGCTTGAGG - Intronic
1136242802 16:28954812-28954834 TGTGGGGAATGAATCGCTTGGGG + Intronic
1138193774 16:55037020-55037042 TGGGGGCACTGATGGGCTTCTGG - Intergenic
1138276304 16:55737352-55737374 TGTGGGGACAGACTGGCTTGAGG + Intergenic
1138282229 16:55780702-55780724 TGTGGGGACAGACTGGCTTGAGG + Intergenic
1138286715 16:55815932-55815954 TGTGGGGACAGACTGGCTTGAGG - Intronic
1138507862 16:57486988-57487010 TGGGAGAACTGGATGTTTTGAGG - Intronic
1138647991 16:58439058-58439080 TGGAGTTACTGATTGGCTTGGGG - Intergenic
1138770125 16:59653005-59653027 TAGGAGAACAGAATGGTTTGGGG - Intergenic
1139534918 16:67565838-67565860 TGGGACTTCTGAATGGCTTGGGG + Intronic
1139795098 16:69476393-69476415 TAGGGCAACTGAATGGCTATTGG + Intergenic
1140010962 16:71130934-71130956 TGGGGGCAATGAGTGGATTGGGG - Intronic
1141312379 16:82927020-82927042 TGGGGTAACTCAATAGCTGGAGG + Intronic
1142164571 16:88579284-88579306 TGGGGGAGCTGGTTGGGTTGAGG + Intronic
1142419275 16:89960605-89960627 TGGGGAAGCTGAGGGGCTTGGGG + Intronic
1143126431 17:4643792-4643814 TGGAGCAACTGGGTGGCTTGGGG - Intergenic
1146617947 17:34371632-34371654 TGGGGGTGCTGTATGACTTGAGG - Intergenic
1149364152 17:55924025-55924047 AGGTGGAAATGAAGGGCTTGAGG - Intergenic
1152793921 17:82297546-82297568 TGGGGGAACACAATGTCCTGTGG + Intergenic
1152853178 17:82649127-82649149 TGGGGGGGCTGAGTGACTTGGGG - Intergenic
1156182427 18:34620935-34620957 TGGAGTAACTGAATTGCTTTGGG + Intronic
1157806079 18:50658547-50658569 TGGTGGAACTGCATGTCCTGAGG - Intronic
1157850259 18:51042155-51042177 TGGGGCATCTGAAAGTCTTGTGG - Intronic
1160214291 18:76913963-76913985 TGGGTGAACTGAATGGTATATGG - Intronic
1160653364 19:246261-246283 TGGGGGCACTGCCTGGCTTTGGG - Intergenic
1162008068 19:7792583-7792605 CCAGGGAACTTAATGGCTTGGGG + Intergenic
1162009200 19:7801486-7801508 CCTGGGAACTTAATGGCTTGCGG + Intergenic
1163662269 19:18585663-18585685 TGGGGGAATTATTTGGCTTGGGG - Intronic
1163765617 19:19161723-19161745 TGGGGGACCAGCATGGATTGGGG - Intronic
1165924084 19:39316382-39316404 TAGGGGAAATCATTGGCTTGGGG - Intergenic
1167443656 19:49524902-49524924 TGGGGGCACTGACAGGCGTGAGG - Intronic
1167473753 19:49688884-49688906 TGGGGACACTGAGTGGGTTGGGG + Exonic
1168078622 19:53993515-53993537 TGGGGGTACAGGATGGCCTGGGG - Intronic
926401688 2:12503500-12503522 ATGGGGAACTTCATGGCTTGGGG - Intergenic
929904148 2:46031410-46031432 TGGATGAACTGAAGGGTTTGTGG - Intronic
929930487 2:46251870-46251892 TGTGGGAAGTGACTGGCCTGGGG - Intergenic
931771560 2:65502121-65502143 TGGTTGCACTGGATGGCTTGAGG + Intergenic
934037441 2:88100003-88100025 TGGGGGATCTGAGGGGCTGGGGG - Intronic
935058308 2:99586881-99586903 TGGGGGAAGGGCATGTCTTGGGG + Intronic
936061355 2:109297580-109297602 TGGGGGCACTGACTGGGTTGGGG - Intronic
937434121 2:121866404-121866426 GGGGGAAACTGAATGCCTGGGGG + Intergenic
938637871 2:133249040-133249062 TGGGGGAAGGGAATGGCTAAAGG - Intronic
940985363 2:160046735-160046757 TGGGGAAAATGAATGGTTTTAGG + Intronic
943221685 2:185117464-185117486 TGAGAGAACTGAAAGACTTGTGG + Intergenic
944580070 2:201124704-201124726 AGGGGGAACAGAATGGCTAGGGG + Intronic
946436845 2:219662756-219662778 TGGGGGAAAGCAATGGCTTGAGG + Intergenic
948644847 2:239398052-239398074 TGGGGGAACTGAAGGGCGAAGGG - Intronic
1169132340 20:3172826-3172848 TGGGGGCACTGCAGGGCTTTTGG + Intronic
1169304895 20:4481185-4481207 TGGATGATCTGAATAGCTTGAGG + Intergenic
1169571158 20:6907172-6907194 TGGGGAAACTGGATGTTTTGTGG + Intergenic
1170954074 20:20962430-20962452 AGGGGGATCAGAGTGGCTTGGGG + Intergenic
1171218638 20:23373239-23373261 TGGGGGGACAGAATGGTTTCAGG + Intergenic
1171326428 20:24297694-24297716 CGGGGGGACTTACTGGCTTGAGG + Intergenic
1172272917 20:33664447-33664469 TGGGGGGCCTGAATGCTTTGGGG - Intronic
1173059149 20:39645236-39645258 TGGGGGAGCTGAAGGGGTGGGGG + Intergenic
1173327676 20:42048662-42048684 TGGGAGGACTTAATGGCTAGGGG - Intergenic
1173368941 20:42417340-42417362 TGGGGGAAGAGAATGGCAGGAGG - Intronic
1174456851 20:50654975-50654997 TTGGGCAAATGGATGGCTTGAGG - Intronic
1174580990 20:51571498-51571520 GAGGAGAACTGAATGGCTTAAGG + Intergenic
1176929909 21:14796828-14796850 TGGAACAACTGAATGGCCTGGGG + Intergenic
1178429061 21:32503062-32503084 TGGGGTAACCTGATGGCTTGGGG - Intronic
1180264269 21:46699564-46699586 TGGGGGTACTGCATGGCTTTGGG + Intergenic
1180830667 22:18904436-18904458 AGGGGGCACGGAAGGGCTTGGGG - Intergenic
1181069014 22:20320860-20320882 AGGGGGCACGGAAGGGCTTGGGG + Intergenic
1181666116 22:24398767-24398789 TAGGGGAACTGGATTGTTTGAGG - Intronic
1182406895 22:30142015-30142037 TGAGGCAAGAGAATGGCTTGAGG + Intronic
1182879336 22:33720024-33720046 TGGGGGAAGGGGATGGTTTGGGG + Intronic
1183026485 22:35069408-35069430 AGAGGGAAGTGACTGGCTTGAGG - Intronic
1183477060 22:38041439-38041461 TGGGGCAAGTGGAAGGCTTGTGG + Intronic
1183498472 22:38163827-38163849 TGGGAGGACTGAATGGATGGAGG + Intronic
1185351863 22:50343651-50343673 AGGGGGAACTGACTGACTGGGGG - Intronic
1185351887 22:50343717-50343739 AGGGGGCACTGACTGACTTGGGG - Intronic
1185352642 22:50346126-50346148 AGGGGGAACTGACTGACTTGGGG - Intronic
1185430430 22:50807510-50807532 TGGGGGTACTGCATGGCTTTGGG + Intergenic
1203280757 22_KI270734v1_random:129707-129729 AGGGGGCACGGAAGGGCTTGGGG - Intergenic
950071474 3:10156238-10156260 TGAGGTTACTGAAAGGCTTGGGG + Intergenic
950719118 3:14870116-14870138 TGAGGGAACGGAATGGCATGAGG + Intronic
951131881 3:19056253-19056275 TGGGTGAACTTAATTTCTTGTGG - Intergenic
959361517 3:105399764-105399786 TGTGGGAACTGACTGGCTCTTGG - Intronic
959793132 3:110388651-110388673 TAGGGAAACTGAAAGACTTGAGG - Intergenic
961364452 3:126390452-126390474 GGGGGGATCTGAATGGATTCTGG - Intergenic
962063737 3:131957622-131957644 TGAGGGAACTGGAAGGCATGAGG - Intronic
963992921 3:151673796-151673818 AGGGGGAAATGACTGGATTGAGG + Intergenic
966786922 3:183630591-183630613 TGGGAGAAATGAGTGGCTGGTGG + Intergenic
966865229 3:184255176-184255198 TGGGGGTAATGAAGGGATTGTGG + Intronic
968112777 3:196062853-196062875 TGGTGCCACTGAATGGCTAGAGG - Exonic
970389993 4:15599213-15599235 AGGGAGTACTGAATGACTTGGGG - Intronic
971124882 4:23742615-23742637 TGGGGGAACTTCAAGGCCTGGGG + Intergenic
973915309 4:55628191-55628213 TGGGTGAATTGTATGGCTTGTGG - Intronic
975146116 4:70968853-70968875 TGAGGCAAGAGAATGGCTTGAGG - Intronic
977318260 4:95478601-95478623 TAGGCTAACTGAATTGCTTGTGG - Intronic
978018275 4:103776120-103776142 TGGGAGAACTGGATGGCTAGAGG + Intergenic
978577097 4:110198586-110198608 AGGAGGAAATGAATGCCTTGCGG + Exonic
978627824 4:110707527-110707549 AGGGGGAAATGAATAGTTTGGGG + Intergenic
979181178 4:117729419-117729441 TAGGTCAACTGAATGGCTTTTGG + Intergenic
980447795 4:132933530-132933552 TAGGTAAACTGAATGTCTTGAGG - Intergenic
981391978 4:144201752-144201774 TGGGGACACTCAATGGCTGGAGG + Intergenic
985625474 5:983077-983099 AGGGGGACCTGGATGGCTGGGGG + Intergenic
985730254 5:1543486-1543508 GGGGGGAAATGAATGGGATGGGG + Intergenic
987845280 5:23275941-23275963 TGGGGGAAGTGATTGGATTATGG + Intergenic
988646934 5:33105183-33105205 TGGGTGATCTGAATGCCTGGAGG + Intergenic
990968139 5:61471751-61471773 TGGGGGAAGGGAATGGTTTCAGG - Intronic
991349702 5:65708307-65708329 TGGAAGTACAGAATGGCTTGTGG - Intronic
992733147 5:79691901-79691923 TGGGAAAACTGAAGGGCATGGGG + Intronic
994968593 5:106706245-106706267 TGTGGGAACTGAAGGACTAGAGG + Intergenic
997259264 5:132453583-132453605 TTGAGGAGCTGAATGGCTTCAGG - Intronic
998589798 5:143464909-143464931 TAGGGGAACAGAATGGTTTCTGG - Intergenic
999041265 5:148415727-148415749 TGTGAGAACTAAATGGCCTGGGG - Intronic
999474829 5:151889002-151889024 TGGGGTATCTTAATGGCATGAGG - Intronic
999515646 5:152299038-152299060 TGGGGGTACTGAAGGGTTTTAGG - Intergenic
999779292 5:154836128-154836150 TGGGGCAGGTGAATTGCTTGAGG - Intronic
1002064419 5:176644959-176644981 GGGGGGAGCTGAGTGGCTGGGGG + Intronic
1003124715 6:3347111-3347133 TGGGGGTAGTTAATGACTTGGGG - Intronic
1003209236 6:4045242-4045264 TGGGGGAACAGAATACTTTGTGG - Intronic
1005569068 6:27127009-27127031 TGGGGGAACTGGGCGGCTGGGGG + Intronic
1007210190 6:40187430-40187452 TGTGGGTACAGAATGGCTGGGGG + Intergenic
1008412332 6:51194097-51194119 TTGAGGAAATGAATGTCTTGAGG - Intergenic
1011128054 6:84028245-84028267 TTGGGGAACTGAAGGGTTGGAGG - Intergenic
1013324314 6:109029497-109029519 TGGAGGAAAGGAGTGGCTTGAGG - Intronic
1015192258 6:130484429-130484451 TGGGGGAACAGATGGGCTTCTGG + Intergenic
1015578736 6:134701307-134701329 TGGGGGAACTCATTGCCCTGGGG - Intergenic
1017035352 6:150262287-150262309 TGTGGGCACTGAATGGCTCGTGG - Intergenic
1018024281 6:159791419-159791441 GTGAGGAACTGAAGGGCTTGTGG + Intronic
1018279804 6:162173012-162173034 CTGGGGAATTGAATGGCTTGGGG + Intronic
1018397034 6:163386135-163386157 CGGGGGAGGTGAATGGCTGGTGG - Intergenic
1023765452 7:43506538-43506560 TGATGGAAATGAAGGGCTTGTGG + Intronic
1023914582 7:44579333-44579355 TGGCTGATCTGAATGGTTTGTGG + Exonic
1025174036 7:56787741-56787763 CGGGGGAACTGACTGGGTCGGGG - Intergenic
1025698065 7:63790214-63790236 CGGGGGAACTGACTGGGTCGGGG + Intergenic
1026601997 7:71784885-71784907 TGGGGACACTGACTGGCATGGGG + Exonic
1026628740 7:72019266-72019288 TGGGGAAAATGGAAGGCTTGGGG + Intronic
1027264241 7:76485300-76485322 TGGGGCAAGAGAATTGCTTGAGG - Intronic
1027266083 7:76496006-76496028 TGTGGGAACTGAATGTCGGGTGG - Intronic
1027317461 7:76994123-76994145 TGTGGGAACTGAATGTCGGGTGG - Intergenic
1030456854 7:109785661-109785683 TGGGGTACGAGAATGGCTTGAGG - Intergenic
1032330091 7:130970549-130970571 TTGGGAAGCTGAATGGCTTATGG + Intergenic
1032355334 7:131205679-131205701 TGGAGGAACTGAGTTCCTTGTGG + Intronic
1035512887 8:205995-206017 TGGGGGCACTGCCTGGCTTTGGG - Intergenic
1038185701 8:25272877-25272899 TGGGGGTTCTGAGGGGCTTGCGG - Intronic
1038523078 8:28249919-28249941 TGTGGGAGCTGAAAGGCTGGTGG - Intergenic
1038569451 8:28647937-28647959 TGGGGGCACTAGATGGGTTGGGG + Intronic
1038957888 8:32486855-32486877 TGTGGCAAGTGAATTGCTTGAGG - Intronic
1039135731 8:34321000-34321022 TGGTGGAATTAAATGCCTTGTGG + Intergenic
1039233337 8:35473629-35473651 TGAGGGAACTGAATGGCAGAAGG + Intronic
1039784523 8:40821689-40821711 TTGGGGAAGAGAATGGCTTTTGG - Intronic
1040932566 8:52750222-52750244 TGGGGCAACTCACTGCCTTGAGG + Intergenic
1041599552 8:59700261-59700283 TGAGGTAACAGAATTGCTTGAGG - Intergenic
1041683230 8:60614848-60614870 TGGGGGAAAGGAAAGGCTAGTGG + Intronic
1046828099 8:118714126-118714148 TGAGGGAAGTGGATCGCTTGAGG + Intergenic
1048250984 8:132866744-132866766 TGGGGGAACAGAACGGGGTGGGG - Intergenic
1049882989 9:10729-10751 TGGGGCCACTGACTGGCTTTGGG - Intergenic
1051557091 9:18396094-18396116 TGGGGTCACTGACTGCCTTGTGG - Intergenic
1052990123 9:34514205-34514227 TGGGGGAAAGGAAGGGCTTGAGG - Intronic
1057163919 9:92911777-92911799 TGGAGAAACTGGGTGGCTTGGGG + Intergenic
1058814362 9:108669773-108669795 TGGGGGAACTGAGTGTCATCTGG - Intergenic
1061432586 9:130540682-130540704 TGGGGGAACTCACAGGCTAGAGG + Intergenic
1061663054 9:132143286-132143308 TGGGAGAAAGGAGTGGCTTGGGG - Intergenic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1187293769 X:17979482-17979504 AGAGGTAACTGAATGGCTGGGGG + Intergenic
1187541685 X:20202601-20202623 TGAGGTAACTGAATGGCTAGAGG + Intronic
1188946653 X:36313443-36313465 TGTGGGAACTGATTGGATTATGG - Intronic
1189867703 X:45348693-45348715 TGGGCCAACTGAATGGCTTTTGG + Intergenic
1195636368 X:107120325-107120347 TAGGGGAACTGGATGGCTGAGGG + Intergenic
1196056540 X:111362432-111362454 TGGGGGAACTGAATGGCTTGGGG - Intronic
1196771354 X:119297613-119297635 TGGGGGCAGTGAAGGGGTTGAGG - Intergenic
1197797853 X:130317372-130317394 TGAGGGAAGAGAATCGCTTGAGG + Intergenic
1200326552 X:155246716-155246738 TCAGGGAGCAGAATGGCTTGAGG - Intergenic
1200402844 X:156029607-156029629 TGGGGCCACTGACTGGCTTTGGG + Intergenic
1201152892 Y:11103445-11103467 TGGGGGCACTGACTCGCTTTGGG + Intergenic