ID: 1196061434

View in Genome Browser
Species Human (GRCh38)
Location X:111411823-111411845
Sequence GTGGGGTCTCTTACCACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196061434_1196061441 10 Left 1196061434 X:111411823-111411845 CCTGCAGTGGTAAGAGACCCCAC 0: 1
1: 1
2: 0
3: 4
4: 98
Right 1196061441 X:111411856-111411878 CAAGCAGCAAACATTTCCCCAGG 0: 1
1: 0
2: 1
3: 8
4: 225
1196061434_1196061442 23 Left 1196061434 X:111411823-111411845 CCTGCAGTGGTAAGAGACCCCAC 0: 1
1: 1
2: 0
3: 4
4: 98
Right 1196061442 X:111411869-111411891 TTTCCCCAGGCATGCCAGTAAGG 0: 1
1: 0
2: 0
3: 19
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196061434 Original CRISPR GTGGGGTCTCTTACCACTGC AGG (reversed) Intronic
901887177 1:12230863-12230885 GTGGGGTCTCTGTCCCCTGGAGG + Intronic
903990137 1:27261704-27261726 CTGGGGATTCTTACCAGTGCTGG - Intronic
905010205 1:34742069-34742091 GTGGAGTCTCTGACCAGAGCTGG - Intronic
905207103 1:36349236-36349258 GTGGAGTCACTCACCTCTGCTGG - Intronic
908323836 1:63004146-63004168 GACAGGTTTCTTACCACTGCTGG + Intergenic
909468755 1:76003125-76003147 CTGAGGTCTCCTACCACTGGGGG - Intergenic
911198147 1:95016834-95016856 CTGTGGTCTCTTACCTCTGGTGG - Intronic
915981223 1:160420989-160421011 GTGGCCTCTCTTCCCACTCCAGG - Intronic
916474229 1:165153326-165153348 GTGGGGCCTCTCAGCCCTGCAGG + Intergenic
918830053 1:189384176-189384198 CTGGGGTCTATGACCCCTGCGGG + Intergenic
919740224 1:200976893-200976915 GCTGGGCCTCTTCCCACTGCAGG - Exonic
921594757 1:217042533-217042555 GTGTGTTCTCTTACTGCTGCAGG - Intronic
922313345 1:224417511-224417533 ATGGGGTCTCTTGCCCCAGCTGG - Intronic
922979475 1:229813515-229813537 GTGGATTCTGTGACCACTGCAGG - Intergenic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1062969647 10:1636567-1636589 GTGGTATCTCTTGCAACTGCTGG - Intronic
1064304244 10:14151117-14151139 GTAGGGTATCTGTCCACTGCAGG + Intronic
1064463674 10:15558652-15558674 GTGGGGTCTTTGACCACATCAGG - Intronic
1069944559 10:71976932-71976954 GTGTGGTCTCTTTCCCATGCCGG + Intronic
1084540108 11:69781175-69781197 CTGGCGTCTCTCACCACTGAGGG + Intergenic
1085767435 11:79295421-79295443 CGGGGGTCACTTACTACTGCAGG - Intronic
1087156798 11:94912815-94912837 TGGGGATCTCTTACTACTGCAGG - Intergenic
1093490363 12:19698407-19698429 GTGGGGAGTATTACCCCTGCAGG + Intronic
1098917421 12:76272111-76272133 GTGGGGTCTGTTCCCACTGGGGG - Intergenic
1103918199 12:124386606-124386628 GGAGGGTCTCTTCCCACAGCAGG - Intronic
1104749657 12:131230187-131230209 CTGGGGCCTCTTATCACTGAGGG + Intergenic
1104766511 12:131333589-131333611 GTGGGGTCTCTGACCACATATGG + Intergenic
1104809177 12:131610347-131610369 GTGGGATCTGGGACCACTGCGGG - Intergenic
1104812901 12:131629054-131629076 GTGGGGTCTCTGACCACAAATGG - Intergenic
1111134713 13:84026062-84026084 GTGGGCTTTCTTTCCCCTGCTGG + Intergenic
1117151557 14:52893298-52893320 GAGGGGCCTCTTATCACTCCTGG - Exonic
1117297474 14:54393179-54393201 GCTGGGTCTCCTAGCACTGCCGG - Intergenic
1120577606 14:86202964-86202986 GTGGGGTATCTTGCCTCTGTTGG - Intergenic
1202918787 14_KI270723v1_random:11922-11944 TAGGGGTCTCTGACCTCTGCTGG - Intergenic
1202925849 14_KI270724v1_random:23132-23154 TAGGGGTCTCTGACCTCTGCTGG + Intergenic
1124418120 15:29491071-29491093 GCTGGGTCTCCTAGCACTGCTGG - Intronic
1124932970 15:34141100-34141122 TTGGGGTTTAATACCACTGCTGG - Exonic
1128544264 15:68556685-68556707 GTGGACTTTCTTACCAGTGCAGG - Intergenic
1139282275 16:65781021-65781043 GTGGGATCTCTAATCCCTGCAGG + Intergenic
1139693808 16:68658289-68658311 ATTAGGTCTCTTCCCACTGCTGG - Intronic
1141191960 16:81831579-81831601 GCTGGGTCTCTGACCAGTGCTGG + Intronic
1142215841 16:88829459-88829481 GTGGGGTCTCTTCCACCTTCAGG + Intronic
1143371572 17:6444037-6444059 GAGGGGTCTCTGCCCGCTGCCGG + Intergenic
1143381438 17:6498656-6498678 GGTGGGTCTCATAGCACTGCTGG + Intronic
1144217422 17:13068647-13068669 GTGGGGTCTCTGCCAACTCCAGG - Intergenic
1146017542 17:29245895-29245917 GGGGGGTCTCTTTCCTCTCCTGG + Intergenic
1146032694 17:29379887-29379909 GTTGGGTCTCTTAGCAGTGATGG + Intergenic
1149340187 17:55677662-55677684 TTGGAGTCTCTTACTGCTGCAGG + Intergenic
1152758213 17:82095950-82095972 CTGGGGTCTCTCACCCATGCAGG - Intronic
1164578997 19:29422817-29422839 GGGGGGTCCCTTACCAAGGCTGG - Intergenic
925338141 2:3113887-3113909 TGGGGGTCTCTTTCCTCTGCTGG - Intergenic
929196384 2:39189081-39189103 GTGGGGTAGATTACCACTGCAGG - Intronic
931915555 2:66951268-66951290 TTAGGGTCTGTTCCCACTGCTGG - Intergenic
940912375 2:159219898-159219920 CTGGGGTTTCTTTCCAATGCAGG - Intronic
948965053 2:241372748-241372770 CTGGGCTCTCTTGCCTCTGCTGG + Intronic
1171945986 20:31378049-31378071 GCGGGGACTATTATCACTGCTGG + Intronic
1179884859 21:44309550-44309572 GTGGGGTCTCTGGGGACTGCTGG + Intronic
1180801349 22:18633578-18633600 GTGGGGTCCATGACCACTCCTGG + Intergenic
1180852585 22:19029118-19029140 GTGGGGTCCATGACCACTCCTGG + Intergenic
1181220372 22:21361683-21361705 GTGGGGTCCATGACCACTCCTGG - Intergenic
1183949323 22:41343880-41343902 CTGGCTTCTCTTACCACTGTAGG + Intronic
1184301895 22:43566298-43566320 GTGGGATCTCTTACCACACAAGG + Intronic
1185029904 22:48436729-48436751 GTGGGGTCTGTCACCACCACGGG - Intergenic
949420428 3:3859310-3859332 TAAGGGTCTCATACCACTGCAGG - Intronic
950017720 3:9765963-9765985 ATGGGTTCTGTGACCACTGCTGG + Exonic
953002576 3:38949192-38949214 GTGGGGTTTCCAACCTCTGCTGG + Intronic
953618030 3:44509634-44509656 GTGGGGGCTCTTTGCATTGCAGG - Intronic
954841875 3:53518456-53518478 GTGGTCTCTCTTTCCAATGCAGG + Intronic
957812209 3:85238428-85238450 GTGTGGTCTCAGACCACTGAAGG + Intronic
963902234 3:150743687-150743709 GTGTGGTCTTTTGCCACGGCAGG - Intronic
967231196 3:187338902-187338924 GTGAGGTCTCCCACCACTTCTGG + Intergenic
968585275 4:1413478-1413500 GTGGTGTCCCTGGCCACTGCAGG + Intergenic
969316654 4:6385539-6385561 GTGGTCTCTCCTACAACTGCAGG + Intronic
974742390 4:66022972-66022994 GTGGGGACTCTTACAATTCCAGG + Intergenic
981054219 4:140343428-140343450 CTTGGGTCTCCTACCACTTCCGG + Intronic
984866273 4:184283452-184283474 GTGGGGCCTATAACCAATGCTGG + Intergenic
988482373 5:31640589-31640611 GTGGGGTCTCTGAACACTGGAGG + Intronic
988651978 5:33162506-33162528 GTGGGACATCTTACCACTGTCGG - Intergenic
991728299 5:69559151-69559173 TTGGGGTCTTTGACGACTGCAGG - Intergenic
991804728 5:70414298-70414320 TTGGGGTCTTTGACGACTGCAGG - Intergenic
991866656 5:71068724-71068746 TTGGGGTCTTTGACGACTGCAGG + Intergenic
997663031 5:135603884-135603906 GTGAGGTCTCTAACCTCTACCGG + Intergenic
999092832 5:148952525-148952547 GTTGAGTGTCTCACCACTGCAGG + Intronic
1003557576 6:7154676-7154698 GTCAGGCCACTTACCACTGCTGG + Intronic
1013115724 6:107102462-107102484 CTGGGGTTTCTGCCCACTGCAGG - Intronic
1018964062 6:168469741-168469763 GTGGGACCTCTTGGCACTGCTGG - Intronic
1019143889 6:169964572-169964594 CTGGGGTCTCTTCCAAATGCTGG - Intergenic
1019295528 7:272108-272130 GTGGCGTCTCAGACCCCTGCAGG + Intergenic
1023955271 7:44881465-44881487 ATGGCCTCTCTTCCCACTGCAGG - Exonic
1035048734 7:155985977-155985999 CTGGGCTCTCTTGCCACTGTTGG + Intergenic
1037693702 8:21205780-21205802 GTGGGGTCTCTGGCCATTGTAGG + Intergenic
1039432863 8:37539236-37539258 GTGTGGCCTCTTACTGCTGCTGG - Intergenic
1039533474 8:38286180-38286202 GTAGTGTCTCTCACCCCTGCTGG + Intronic
1049209118 8:141377186-141377208 GTGGGGCCTCCTATCACTGCGGG + Intergenic
1049250911 8:141588600-141588622 GCTGGGTCTCCTACCACCGCTGG + Intergenic
1056805684 9:89726943-89726965 GTGGGGATTATTACCACTGAAGG + Intergenic
1056931268 9:90880144-90880166 GTGGGGTCTCTGACCACTGCAGG - Intronic
1059420307 9:114186511-114186533 GTGGGGTCTCCGAGCACTCCGGG - Intronic
1059951012 9:119462469-119462491 GAGGGGATGCTTACCACTGCAGG - Intergenic
1060797628 9:126523197-126523219 GTGGGATCTGTTACGGCTGCAGG - Intergenic
1186454932 X:9703452-9703474 CTCCGGTCTCTTTCCACTGCGGG - Intronic
1195488069 X:105433200-105433222 GTGGGGTTTTTTCCCACTCCGGG - Intronic
1196061434 X:111411823-111411845 GTGGGGTCTCTTACCACTGCAGG - Intronic
1200792220 Y:7309683-7309705 GTGGGTTATCGTAACACTGCAGG - Intergenic