ID: 1196062934

View in Genome Browser
Species Human (GRCh38)
Location X:111430799-111430821
Sequence CTGTGGTTAATTAGGAGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196062934_1196062940 17 Left 1196062934 X:111430799-111430821 CCTGATCTCCTAATTAACCACAG No data
Right 1196062940 X:111430839-111430861 ACACATAAATGGATCCCAGAGGG No data
1196062934_1196062941 24 Left 1196062934 X:111430799-111430821 CCTGATCTCCTAATTAACCACAG No data
Right 1196062941 X:111430846-111430868 AATGGATCCCAGAGGGACTTCGG No data
1196062934_1196062938 6 Left 1196062934 X:111430799-111430821 CCTGATCTCCTAATTAACCACAG No data
Right 1196062938 X:111430828-111430850 CAAGTCAGAAGACACATAAATGG No data
1196062934_1196062939 16 Left 1196062934 X:111430799-111430821 CCTGATCTCCTAATTAACCACAG No data
Right 1196062939 X:111430838-111430860 GACACATAAATGGATCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196062934 Original CRISPR CTGTGGTTAATTAGGAGATC AGG (reversed) Intergenic
No off target data available for this crispr