ID: 1196065446

View in Genome Browser
Species Human (GRCh38)
Location X:111459144-111459166
Sequence GAGGAGAAGGAGAAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196065446_1196065452 4 Left 1196065446 X:111459144-111459166 CCCTCCTCTTTCTCCTTCTCCTC No data
Right 1196065452 X:111459171-111459193 TATTCAATAACAAGACGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196065446 Original CRISPR GAGGAGAAGGAGAAAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr