ID: 1196065452

View in Genome Browser
Species Human (GRCh38)
Location X:111459171-111459193
Sequence TATTCAATAACAAGACGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196065444_1196065452 24 Left 1196065444 X:111459124-111459146 CCTGAGACAGCAAGAACAACCCC No data
Right 1196065452 X:111459171-111459193 TATTCAATAACAAGACGAAGAGG No data
1196065442_1196065452 29 Left 1196065442 X:111459119-111459141 CCATCCCTGAGACAGCAAGAACA No data
Right 1196065452 X:111459171-111459193 TATTCAATAACAAGACGAAGAGG No data
1196065443_1196065452 25 Left 1196065443 X:111459123-111459145 CCCTGAGACAGCAAGAACAACCC No data
Right 1196065452 X:111459171-111459193 TATTCAATAACAAGACGAAGAGG No data
1196065449_1196065452 -9 Left 1196065449 X:111459157-111459179 CCTTCTCCTCAGCCTATTCAATA No data
Right 1196065452 X:111459171-111459193 TATTCAATAACAAGACGAAGAGG No data
1196065446_1196065452 4 Left 1196065446 X:111459144-111459166 CCCTCCTCTTTCTCCTTCTCCTC No data
Right 1196065452 X:111459171-111459193 TATTCAATAACAAGACGAAGAGG No data
1196065447_1196065452 3 Left 1196065447 X:111459145-111459167 CCTCCTCTTTCTCCTTCTCCTCA No data
Right 1196065452 X:111459171-111459193 TATTCAATAACAAGACGAAGAGG No data
1196065448_1196065452 0 Left 1196065448 X:111459148-111459170 CCTCTTTCTCCTTCTCCTCAGCC No data
Right 1196065452 X:111459171-111459193 TATTCAATAACAAGACGAAGAGG No data
1196065445_1196065452 5 Left 1196065445 X:111459143-111459165 CCCCTCCTCTTTCTCCTTCTCCT No data
Right 1196065452 X:111459171-111459193 TATTCAATAACAAGACGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196065452 Original CRISPR TATTCAATAACAAGACGAAG AGG Intergenic
No off target data available for this crispr