ID: 1196068182

View in Genome Browser
Species Human (GRCh38)
Location X:111488980-111489002
Sequence AGCTGTTGCAAGAGAGACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196068178_1196068182 25 Left 1196068178 X:111488932-111488954 CCCATTCATTCACTTGCTGTCTG No data
Right 1196068182 X:111488980-111489002 AGCTGTTGCAAGAGAGACTATGG No data
1196068177_1196068182 30 Left 1196068177 X:111488927-111488949 CCACACCCATTCATTCACTTGCT No data
Right 1196068182 X:111488980-111489002 AGCTGTTGCAAGAGAGACTATGG No data
1196068181_1196068182 -1 Left 1196068181 X:111488958-111488980 CCACTTTTGCACTACATGGCAGA No data
Right 1196068182 X:111488980-111489002 AGCTGTTGCAAGAGAGACTATGG No data
1196068179_1196068182 24 Left 1196068179 X:111488933-111488955 CCATTCATTCACTTGCTGTCTGT No data
Right 1196068182 X:111488980-111489002 AGCTGTTGCAAGAGAGACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196068182 Original CRISPR AGCTGTTGCAAGAGAGACTA TGG Intergenic
No off target data available for this crispr