ID: 1196071152

View in Genome Browser
Species Human (GRCh38)
Location X:111523682-111523704
Sequence CATTTATTCTAGAGGGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196071152_1196071155 -5 Left 1196071152 X:111523682-111523704 CCATTTGCCCTCTAGAATAAATG No data
Right 1196071155 X:111523700-111523722 AAATGCTATGACATTAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196071152 Original CRISPR CATTTATTCTAGAGGGCAAA TGG (reversed) Intergenic
No off target data available for this crispr