ID: 1196078555

View in Genome Browser
Species Human (GRCh38)
Location X:111605749-111605771
Sequence TTTTATGAAAAACAACTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196078555_1196078556 14 Left 1196078555 X:111605749-111605771 CCTTAAAGTTGTTTTTCATAAAA No data
Right 1196078556 X:111605786-111605808 TACAAACCTGTTCACCAAAGAGG No data
1196078555_1196078559 20 Left 1196078555 X:111605749-111605771 CCTTAAAGTTGTTTTTCATAAAA No data
Right 1196078559 X:111605792-111605814 CCTGTTCACCAAAGAGGGAATGG No data
1196078555_1196078557 15 Left 1196078555 X:111605749-111605771 CCTTAAAGTTGTTTTTCATAAAA No data
Right 1196078557 X:111605787-111605809 ACAAACCTGTTCACCAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196078555 Original CRISPR TTTTATGAAAAACAACTTTA AGG (reversed) Intergenic
No off target data available for this crispr