ID: 1196086490

View in Genome Browser
Species Human (GRCh38)
Location X:111688848-111688870
Sequence TTCTTTCTGATTAGAGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 303}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196086490 Original CRISPR TTCTTTCTGATTAGAGTGTG TGG Intronic
901399103 1:9004054-9004076 TTCTTTTTGATAATAGGGTGAGG - Intronic
902627487 1:17684967-17684989 TCATTCCTGATCAGAGTGTGGGG - Intronic
903928846 1:26850673-26850695 TCCCTTCTGATTAGAGGATGAGG - Intronic
905908671 1:41638955-41638977 TTCTTTAGGATCAGTGTGTGAGG - Intronic
906094746 1:43214953-43214975 TACTTTCTGATTGGATTGTTTGG + Intronic
909055882 1:70820593-70820615 TTCATTGTGAGTAGAATGTGGGG + Intergenic
909401732 1:75240387-75240409 GTCTTTCTCACTAGACTGTGAGG + Intronic
909537760 1:76757342-76757364 TTCTTTCTGACTGCAGTGTGGGG - Intergenic
910058891 1:83065099-83065121 TTGTTACTCATTAGACTGTGAGG - Intergenic
910204840 1:84739455-84739477 TTTTTGCTGATCTGAGTGTGAGG - Intergenic
910268355 1:85365505-85365527 TACTTTCTCATCAGAGTATGAGG + Intronic
911199420 1:95029519-95029541 TTCTTTCTGACTTAACTGTGTGG - Intronic
912100178 1:106193841-106193863 TTCTTTCTCATTTCTGTGTGTGG - Intergenic
913338871 1:117736535-117736557 TTAATTCTGAATATAGTGTGAGG + Intergenic
917065632 1:171090397-171090419 TTGTTTCTGAGTACAGTGTGTGG - Intergenic
919111549 1:193225764-193225786 TTCTTGCTAATTTGAGTTTGAGG + Intronic
919271183 1:195348341-195348363 TTCTTTCTCATTAGTTTTTGGGG - Intergenic
921636945 1:217506654-217506676 TTCTTTCTCCTAAGAGTGTTTGG - Intronic
923186869 1:231582275-231582297 TTCTTTGTGTTTATAGTATGTGG + Intronic
924257678 1:242198545-242198567 TGCTTTCTAATTAGAGAGAGAGG + Intronic
924740606 1:246792507-246792529 TTCTTTCTGCCTTGTGTGTGGGG + Intergenic
1062786233 10:267468-267490 TCCTTTCCGATTAGAATGAGGGG + Intergenic
1064436582 10:15316267-15316289 TATTTTCTGTTTAGAGTGTCAGG + Intronic
1066153146 10:32646594-32646616 TTCTTTCAGATAAAGGTGTGGGG + Intronic
1066934438 10:41808836-41808858 TTCTTTCTGATTTCTATGTGAGG + Intergenic
1070147811 10:73787379-73787401 TTCTTTCATATTTGAGTATGTGG + Intronic
1072892369 10:99335324-99335346 GTCTTTCACACTAGAGTGTGAGG + Intronic
1073115539 10:101089670-101089692 TTCTGTTTGTTTAGAGGGTGGGG + Exonic
1073305886 10:102503159-102503181 TTCCTTTTTGTTAGAGTGTGAGG - Intergenic
1073691650 10:105816027-105816049 AACTTTCTGATTATTGTGTGAGG + Intergenic
1078267071 11:9763242-9763264 TTCTTTCTGCTTAAAGTTTCAGG - Intergenic
1080367212 11:31589037-31589059 TTCTTTCTCAGTATAATGTGAGG - Intronic
1080993295 11:37568604-37568626 TTCTTCCTGATTGTAGTGTTTGG - Intergenic
1081142891 11:39524814-39524836 TTCTTTCTCTTTAGAGTGTATGG + Intergenic
1081191465 11:40107618-40107640 TTCTTTCTCATTATTGTGTATGG + Intergenic
1081229291 11:40564694-40564716 TTCTTCCAGATTAGAGGGAGTGG + Intronic
1083052152 11:59787021-59787043 GTCTTTCTGATTATAGATTGAGG + Exonic
1085426046 11:76405542-76405564 TTCTTTCTGACTGAAGTCTGAGG + Exonic
1086240081 11:84679831-84679853 TTCTTTTTCATAAGAGTCTGGGG - Intronic
1086886052 11:92206830-92206852 TTTTTCCTGATTTGTGTGTGAGG - Intergenic
1087628438 11:100622874-100622896 ATCTTGTTGTTTAGAGTGTGTGG - Intergenic
1089758238 11:120702818-120702840 TTCTATCTGAGTAGAGCTTGAGG + Intronic
1092213215 12:6661732-6661754 TTCTTCCTGCTTAGAAAGTGAGG - Intronic
1093193212 12:16099320-16099342 TTTTTTATGATTAGAGAATGTGG + Intergenic
1093298788 12:17427355-17427377 TTCTGTCTCATTAAAGTGTAGGG + Intergenic
1093857578 12:24124952-24124974 CTCTTTGTGCTTAGAGTTTGAGG - Intergenic
1094384023 12:29874044-29874066 TTCTTTAGCATTAGAGTCTGGGG + Intergenic
1098104138 12:67051752-67051774 TTCTTTCTGATCTGAGGTTGTGG - Intergenic
1099826764 12:87785776-87785798 TTTTTTCTGATGAGAGTATGTGG + Intergenic
1101032399 12:100673099-100673121 TTTTTTCTGATTTGATTCTGGGG + Intergenic
1101775940 12:107793872-107793894 TTCTTTCTAAGTAGAGTGAGAGG - Intergenic
1104417919 12:128610693-128610715 TTCAGTCTGATTAGAGTCAGCGG + Intronic
1105707900 13:22979929-22979951 ATCTATCTGTTTAGAGAGTGAGG - Intergenic
1106358791 13:29010767-29010789 GTCTTTCTAACTAAAGTGTGAGG - Intronic
1108258388 13:48632318-48632340 TTCCTGCAGATAAGAGTGTGTGG - Intergenic
1108472858 13:50784919-50784941 TTCTTACTGAAGAGAGTCTGGGG + Intronic
1109194771 13:59366495-59366517 TTCTTTAAGATTAGAGGGTTTGG - Intergenic
1109672572 13:65628402-65628424 TTCCTTCTTATTTGTGTGTGTGG - Intergenic
1109847344 13:68012722-68012744 CTCTTTCTGATTTGGGTGGGAGG - Intergenic
1111823300 13:93239290-93239312 TTCTTTCTGATTCAAGCTTGGGG + Intronic
1111840580 13:93445123-93445145 TTCTTACTGAATAGAGTTAGAGG + Intronic
1113505752 13:110814474-110814496 TTGTTTGGGATTAGTGTGTGCGG - Intergenic
1114515762 14:23299264-23299286 TGCATTCAGAATAGAGTGTGGGG - Intronic
1114691897 14:24590932-24590954 TTCTTCCTGATTTAAGTGAGTGG + Intergenic
1115096171 14:29638435-29638457 TTCTTCCATATTAGAGAGTGTGG - Intronic
1115773700 14:36692596-36692618 GTCTTTGTGATTAGGGTCTGGGG + Intronic
1116220469 14:42079565-42079587 TTCTTTCATTTTACAGTGTGAGG - Intergenic
1116367256 14:44082913-44082935 TTCTTTCTAATTTGATGGTGAGG + Intergenic
1116555752 14:46304600-46304622 TGCTTTCTGAATTGTGTGTGTGG + Intergenic
1117019872 14:51559007-51559029 TACTTTATGAGTACAGTGTGTGG + Intronic
1117826049 14:59704785-59704807 TTCTTCCTGATCACAGTGTCCGG - Intronic
1121220486 14:92281236-92281258 TTCTTTCAGATCAGGGTCTGTGG + Intergenic
1121530010 14:94645670-94645692 TTCTTTCTGCTTTGAGTGTGGGG - Intergenic
1123681268 15:22765874-22765896 TTCCTTCTGGTCAGACTGTGGGG - Intergenic
1124333480 15:28840336-28840358 TTCCTTCTGGTCAGACTGTGGGG - Intergenic
1124470333 15:29978602-29978624 CTCTGTCTGGTTTGAGTGTGTGG - Intergenic
1124616657 15:31247146-31247168 TTTATTCTCAGTAGAGTGTGAGG + Intergenic
1124673691 15:31664518-31664540 TTCTTACTGATTTGAGTTTGTGG + Intronic
1125378231 15:39057406-39057428 TTCTTGCTGATTTGAGTTTCTGG - Intergenic
1125415786 15:39450803-39450825 TTGTTTCTGTGTAGAATGTGAGG - Intergenic
1125441123 15:39704731-39704753 TTCCTTCTGCTTAGAGAATGGGG - Intronic
1127017859 15:54708539-54708561 TTCTTGCTGAGTGGAGTGGGAGG + Intergenic
1129140274 15:73591728-73591750 TTCTCTATGATTATAGTGAGGGG + Intronic
1129833202 15:78683762-78683784 ATTTTTTTAATTAGAGTGTGTGG - Intronic
1129882285 15:79015403-79015425 CTCTCTCTGATTCCAGTGTGTGG - Exonic
1131001902 15:88945663-88945685 TTCTTTGTGATTACAGTGCCTGG + Intergenic
1131605174 15:93895959-93895981 TTCTTTCTGATCAGATAGTTTGG + Intergenic
1131952936 15:97701414-97701436 AACTTTCTGATTAGAATGTGGGG + Intergenic
1131986690 15:98049348-98049370 TTCTTTTTAATTAGAGTATTTGG + Intergenic
1132070592 15:98773679-98773701 TCCCTGCTGATTACAGTGTGGGG - Intronic
1133536455 16:6706719-6706741 TTTTTTTTTAATAGAGTGTGTGG + Intronic
1134890283 16:17835507-17835529 TTGTTAATCATTAGAGTGTGTGG - Intergenic
1135487666 16:22880118-22880140 TTCTTTCCAATAAAAGTGTGGGG + Intronic
1137259239 16:46809934-46809956 TTTTTTCTTATGAGGGTGTGGGG - Intronic
1137754273 16:50889007-50889029 TTCTTTCTGCTGAGAGCCTGTGG + Intergenic
1138717634 16:59042533-59042555 TTCTTCCTGATAAGACTGAGTGG + Intergenic
1140149778 16:72351092-72351114 TTCTTCTTGATGAGAGTGAGGGG - Intergenic
1140174923 16:72648834-72648856 TTTTTTGTGATTAGACTGGGCGG - Intergenic
1141185715 16:81785634-81785656 TTCTTTAGGATAAGAGTGGGTGG + Intronic
1141341370 16:83206663-83206685 ATCTCTCTGATTAGACTCTGTGG - Intronic
1146473435 17:33142695-33142717 TTCTACCTGAGTAGAGGGTGTGG - Intronic
1147477584 17:40727542-40727564 TTCTTTCTGATTTAAGTTTGAGG + Intergenic
1148401426 17:47365285-47365307 TTCTTTCTGATTGGAAGATGTGG - Intronic
1149348552 17:55764243-55764265 TTCTTGTTGCTTAGAATGTGTGG + Intronic
1151532428 17:74715261-74715283 TCATTCCTGATTAGGGTGTGAGG - Intronic
1153486620 18:5605106-5605128 TTGTTTCTAATTAGAGTAAGAGG - Intronic
1154467930 18:14667982-14668004 TTCTATCTGATGAGAGTTTTGGG + Intergenic
1155514426 18:26610196-26610218 TACTTTCTGTATATAGTGTGAGG + Intronic
1156196814 18:34783684-34783706 TTCTTTCTGATTTCAATGTTTGG + Intronic
1156263384 18:35465411-35465433 TTCTATCTGATGGGAATGTGTGG - Intronic
1156640477 18:39089404-39089426 TTCTTATTGATTAGAGAGTAGGG - Intergenic
1156841790 18:41617637-41617659 TTGTTTCTGAATAGAGTATAAGG + Intergenic
1157183740 18:45520543-45520565 TTCTTTTTGATTAAAATGTATGG + Intronic
1159345579 18:67199387-67199409 TTCTTTCAGATGAGATTGTCAGG + Intergenic
1164330768 19:24253051-24253073 TTCTTTCTGGTTTGTGTCTGGGG + Intergenic
1164331336 19:24260643-24260665 TTCTTTCTGATTTGTATCTGGGG + Intergenic
1164362134 19:27525182-27525204 TTCTTTCTGGTTAGTATCTGGGG - Intergenic
1164376494 19:27692434-27692456 TTCTTTATAATTAGACTGTTTGG + Intergenic
1164380537 19:27733907-27733929 GTCTTTCTGATTAGAATCTCTGG + Intergenic
1164381240 19:27738549-27738571 TTCTCTATAATTAGACTGTGTGG + Intergenic
1164384230 19:27759768-27759790 TTTTTTATGATTAGACTGTTGGG + Intergenic
1165111693 19:33506187-33506209 GTGTTTGTGATGAGAGTGTGTGG - Intronic
1165286921 19:34850270-34850292 ATGTCTCTGATGAGAGTGTGAGG - Intergenic
1202646844 1_KI270706v1_random:149874-149896 CTCTATCTGATGAGAGTTTGGGG - Intergenic
925221572 2:2145930-2145952 TCCTTTCTGCTTAGAATGTGAGG + Intronic
925587573 2:5478503-5478525 TTATATCAGATTAGAGTGAGTGG + Intergenic
927320787 2:21743199-21743221 TTCTTTTTGCTTAGAATTTGTGG + Intergenic
927351087 2:22116342-22116364 TACATTTTGATAAGAGTGTGGGG - Intergenic
928018871 2:27685064-27685086 TTCATTCTCATTAGAGTTGGAGG - Exonic
929675043 2:43917960-43917982 TTCTTTCTAATAGCAGTGTGGGG - Intronic
929691467 2:44078043-44078065 GACATTCTCATTAGAGTGTGAGG - Intergenic
930567863 2:53045781-53045803 TTCTTTTTGATAAGATTGTTTGG + Intergenic
930956451 2:57208453-57208475 TTCTTTGTGGTGAAAGTGTGAGG - Intergenic
932072689 2:68636705-68636727 TTCTCTGTGATTAGATTCTGTGG - Intergenic
933920255 2:87038909-87038931 ATCTGTATGGTTAGAGTGTGGGG + Intergenic
933931369 2:87154877-87154899 ATCTGTATGGTTAGAGTGTGGGG - Intergenic
934002742 2:87730985-87731007 ATCTGTATGGTTAGAGTGTGGGG - Intergenic
934970804 2:98762630-98762652 TTCTTACAGATGAGGGTGTGTGG - Intergenic
935120526 2:100180005-100180027 TGCCTTCTGGTTAGAGGGTGGGG + Intergenic
935673239 2:105572935-105572957 TTCTCTCTGAGTAGAATGGGGGG + Intergenic
935811410 2:106801061-106801083 CGCTTTCTGTTTAGAATGTGAGG - Intergenic
936027228 2:109042376-109042398 TTGTTTCGGATTTGAATGTGTGG + Intergenic
936172783 2:110190751-110190773 TTCATTCTGATGATAGTGAGAGG - Intronic
936361752 2:111810563-111810585 ATCTGTATGGTTAGAGTGTGGGG + Intronic
937756253 2:125542440-125542462 TTATTTCTGAGTGGAGTGAGGGG - Intergenic
937921294 2:127133462-127133484 CTCTTTCTGATGGGACTGTGGGG - Intergenic
938874644 2:135519838-135519860 ATTTTTCAGATTAGAGTGTTTGG + Intronic
938973161 2:136450499-136450521 CTTTTTCTGATCATAGTGTGTGG - Intergenic
939301593 2:140348923-140348945 TTACTTATGAATAGAGTGTGTGG + Intronic
939388267 2:141530964-141530986 TTTTTTCTGAGTAAAGTGGGAGG + Intronic
940536015 2:154945122-154945144 TTCTTTCTGTTTATGGGGTGAGG + Intergenic
941389037 2:164889144-164889166 TTGTTACTGATGAGACTGTGGGG - Intergenic
941787879 2:169518449-169518471 ATCTTTCTAATTAGGATGTGGGG + Intronic
942527852 2:176874443-176874465 ATTTTTATGATTAGAGTTTGTGG + Intergenic
942763566 2:179428225-179428247 TTCCTTCTGACTTGATTGTGGGG - Intergenic
943585912 2:189739863-189739885 TTCTTTCCTATAAGAGTTTGTGG - Intronic
945060228 2:205902415-205902437 TTCATTTTGATTGGAGTGTGGGG + Intergenic
945998634 2:216462244-216462266 TTCTTTCTTATTAGGGAGTATGG + Intronic
947334323 2:229066283-229066305 GTCTTCCTGACTAGACTGTGAGG - Intronic
948684491 2:239661683-239661705 TTCTTTCTAATCAGATTCTGTGG + Intergenic
1169470375 20:5879976-5879998 TTCTTTCTGCCATGAGTGTGAGG - Intergenic
1169726324 20:8737044-8737066 TTCTTTCTGATAAGAAAGTTGGG + Exonic
1169845726 20:9989268-9989290 ATCTTTCTTCTTAGAGTTTGTGG - Intronic
1170465318 20:16617740-16617762 TACTCTCTGAATAGGGTGTGAGG + Intergenic
1173343569 20:42177470-42177492 TTCATTCTTATGAGAGTGTTAGG - Intronic
1173530273 20:43763925-43763947 TGCTTTCATATTAGAGTGTTGGG + Intergenic
1173898864 20:46572230-46572252 TGTGTTCTGATGAGAGTGTGGGG + Intronic
1174175147 20:48639878-48639900 TTCTTTCTGTTTAAACTCTGGGG + Exonic
1175407880 20:58746491-58746513 TTATTTCTGATGAAAGTGAGAGG - Intergenic
1176636593 21:9249492-9249514 TTCTTTTGGATATGAGTGTGAGG + Intergenic
1176739409 21:10586387-10586409 TGATTTCTGATTATATTGTGTGG + Intronic
1176806583 21:13489671-13489693 TTCTATCTGATGAGAGTTTTGGG - Intergenic
1176983812 21:15412912-15412934 TTCTTTCTGATTTGATACTGTGG - Intergenic
1178886312 21:36487476-36487498 TTCTTTCTAAGTAGACTATGAGG - Intronic
1180355069 22:11832592-11832614 CTCTATCTGATGAGAGTTTGGGG + Intergenic
1180383181 22:12159739-12159761 CTCTATCTGATGAGAGTTTGGGG - Intergenic
1181409176 22:22706062-22706084 TTCTTTATGTTGAGATTGTGTGG - Intergenic
1181416592 22:22763829-22763851 TTCTTTATGTTGAGATTGTGTGG - Intronic
1181561040 22:23700413-23700435 TTCATTCTAATTAGAGTGAGAGG - Intergenic
1181866911 22:25865622-25865644 ATCTTTCTGAATGGAGTCTGAGG + Intronic
1183135546 22:35883645-35883667 TTCTTGCTGCTTAAAGTATGAGG - Intronic
1183214936 22:36473519-36473541 TTCTTTCTGAAGAGAGCCTGAGG - Intronic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
1185415843 22:50709796-50709818 TTTTTTCTGAGCAGAGTCTGGGG + Intergenic
950426458 3:12927198-12927220 TTCTTTTTGTTAACAGTGTGTGG - Intronic
950515654 3:13463331-13463353 TTCTTGGGGATTAGAGAGTGTGG + Intergenic
951324941 3:21290305-21290327 TTTCTTCCTATTAGAGTGTGAGG + Intergenic
951809247 3:26681385-26681407 TTCTTTCCTAGTAGACTGTGAGG - Intronic
952111971 3:30134395-30134417 GTCTTCCTGATTTGGGTGTGAGG + Intergenic
952696542 3:36270915-36270937 GTCTTTCTCACTAGAGTGTGAGG - Intergenic
954411132 3:50371701-50371723 TCCTTTCTGATAGGACTGTGAGG + Intronic
954466513 3:50658329-50658351 GTCTTGCTGATTTGGGTGTGGGG + Intergenic
955441425 3:58959429-58959451 TTATTTTTGTTTACAGTGTGAGG + Intronic
955706547 3:61733338-61733360 CTCTATCTGTTTAGAGTGTCTGG + Intronic
955954376 3:64273736-64273758 TTCTTTGTGATTGGACTGGGTGG - Intronic
958056163 3:88415197-88415219 TTATTTTTGATTTGAGTTTGGGG - Intergenic
960237323 3:115298923-115298945 TTCTGTTTGATTACAGTGTGAGG - Intergenic
960527251 3:118723946-118723968 CTCTTTCTGTTCAGAGAGTGAGG - Intergenic
961372874 3:126441921-126441943 TTTTCTCTGAGTAGACTGTGAGG + Exonic
962902157 3:139770872-139770894 ATTGTGCTGATTAGAGTGTGAGG - Intergenic
964042719 3:152282185-152282207 TTGTTTCTAATTAGGGTCTGTGG - Intronic
964161069 3:153645888-153645910 TTCTTACTGATTTGAGTTTCTGG - Intergenic
964936322 3:162092882-162092904 ATCATTCTGATTAGCATGTGAGG + Intergenic
966130521 3:176633280-176633302 TTCTTTCTTTTTAGATTGGGAGG + Intergenic
967300311 3:188006164-188006186 TGCTTTCTAATTAGATTGTGAGG + Intergenic
970020701 4:11564821-11564843 TTCTTTCTTATTGGAGTGTAAGG + Intergenic
973255730 4:48110837-48110859 TTCTCTCTGAAAAGATTGTGGGG - Intronic
973373097 4:49268038-49268060 CTCTATCTGATGAGAGTTTGGGG - Intergenic
973387905 4:49527061-49527083 CTCTATCTGATGAGAGTTTGGGG + Intergenic
974733798 4:65901878-65901900 TTCTTTCTGATTCAAGTTTGGGG + Intergenic
974887119 4:67833373-67833395 CCCTTTCTCATTAGAATGTGGGG - Exonic
976282682 4:83340818-83340840 ATCTATCTGGTTAGAGTGTGTGG - Intergenic
976508833 4:85883391-85883413 TTCTTGATGATTCTAGTGTGCGG + Intronic
977128467 4:93200982-93201004 TTCATTCTGATTCTATTGTGTGG + Intronic
977450987 4:97197625-97197647 TTCTTTCTGAGGAGAGTTAGTGG - Intronic
977495717 4:97772751-97772773 TTCTTTTTGATTAAATTTTGAGG - Intronic
978054370 4:104245216-104245238 TTCTTTATGATTATTGTGAGTGG + Intergenic
978979404 4:114923495-114923517 TTCTTTCTGGTTTGTTTGTGAGG - Intronic
979479183 4:121195455-121195477 TTATTTCTGATTATAGAGAGTGG + Intronic
979969662 4:127118651-127118673 TTCTTTATGAACAGAGTGTGCGG - Intergenic
980924430 4:139120521-139120543 TCCTTTGAGATTAGAGTTTGAGG - Intronic
983431484 4:167656652-167656674 TTCTTTCTCATTTCTGTGTGTGG - Intergenic
983810424 4:172053684-172053706 TTCTTTCTGATTGAAGTGTATGG - Intronic
984216731 4:176922520-176922542 TTATTTAAGATTAGAGTTTGAGG - Intergenic
985351271 4:189064783-189064805 TTGTGTTTGATTAGAGTTTGGGG - Intergenic
986392258 5:7297868-7297890 TTCCTTCTGGTCAGACTGTGGGG - Intergenic
986602483 5:9486695-9486717 TTCTGTCTTATTATAGTCTGAGG - Intronic
986908437 5:12523462-12523484 TTTATTCTGACTAGAGTATGAGG + Intergenic
987136199 5:14901794-14901816 GTCTCTCTCATTAGTGTGTGAGG + Intergenic
989646510 5:43638884-43638906 TTTGGTATGATTAGAGTGTGAGG + Intronic
989973396 5:50552567-50552589 TTCCTGCTGATTGGAGGGTGAGG - Intergenic
990517681 5:56545500-56545522 TGGTTTATGATTACAGTGTGTGG - Intronic
991307561 5:65195980-65196002 TTCTTACAGATTATAATGTGTGG + Intronic
991622250 5:68556986-68557008 TTCTTTCTGATTACAAATTGTGG + Intergenic
992656799 5:78919075-78919097 TTCTCTCAGATTGGAGAGTGGGG - Intronic
993274480 5:85838584-85838606 TTGTTTCTTCTGAGAGTGTGAGG - Intergenic
993509003 5:88747812-88747834 TTCTTTCTAATCATAGTGTTTGG + Intronic
994158554 5:96530065-96530087 CTCTTTCTTATTAGATAGTGAGG - Intronic
994825703 5:104710571-104710593 TTATTTCTAATTTGAGTTTGAGG - Intergenic
995730447 5:115234673-115234695 TTCTTTTTGTTTTGAGTCTGAGG - Intronic
999597563 5:153222053-153222075 TTATTACTTATTAGAATGTGGGG - Intergenic
999707397 5:154286051-154286073 TTCTTTCAGATCAGACTGGGGGG - Intronic
1003847490 6:10188355-10188377 TTTATTGTGATTAGAGAGTGGGG - Intronic
1005491470 6:26351387-26351409 TTCCTGCTGATTGGAGTTTGTGG - Intergenic
1006035204 6:31206161-31206183 TTCTTTCTGCTTTGTGTGTCAGG + Intergenic
1008119263 6:47592323-47592345 TACTTTTTGCTTACAGTGTGGGG - Intronic
1014366053 6:120543546-120543568 TTCTTTCAAATTAAAGTGCGGGG - Intergenic
1014623092 6:123693604-123693626 TTCTTTCTGATTTTAATGAGAGG + Intergenic
1016174753 6:141067396-141067418 TGTTTTCTGATTAGAGTGACTGG - Intergenic
1016453370 6:144206841-144206863 ATCTTTCTGATGTGAGTGTTTGG + Intergenic
1016648531 6:146437856-146437878 GTCTTTTTGATGAGGGTGTGAGG + Intergenic
1017408558 6:154145971-154145993 TACTTTTTGAATACAGTGTGAGG - Intronic
1018576349 6:165264129-165264151 TTCTTTCTGATCAGATTCTTGGG + Intergenic
1019918450 7:4148281-4148303 TTGATTCTGATTAGAATGCGTGG - Intronic
1021450182 7:20777570-20777592 TTCTTTATGATAACAGTGTGGGG + Intergenic
1022307904 7:29166388-29166410 TTCTTTCTGATTTAAGTGTCTGG + Intronic
1022750029 7:33214701-33214723 ATCTTTCTGTTTTGTGTGTGTGG - Intronic
1024570673 7:50720671-50720693 TACTTTCTGATTGAAGTGTCTGG - Intronic
1024858651 7:53812038-53812060 TTCTTTCTCAAGAGACTGTGAGG - Intergenic
1029284461 7:99456259-99456281 TTCTTTCAAATTAGAGGGTGAGG - Intronic
1031751922 7:125585798-125585820 TTCTTTCTGTTTATTGTGTTTGG + Intergenic
1032346507 7:131121341-131121363 CTGTTTCTGATGAGAGTCTGGGG - Intronic
1032485504 7:132284411-132284433 TTCACTCTCATTAAAGTGTGGGG - Intronic
1032492803 7:132336640-132336662 TTCTTTGTGTATAGAGTGGGGGG - Intronic
1033030974 7:137826416-137826438 TTATGTCTGAAAAGAGTGTGTGG + Intronic
1033251628 7:139765610-139765632 TTCTGCCTGATTAAAATGTGAGG - Intronic
1035660675 8:1345294-1345316 TTCCTTCAGAGCAGAGTGTGCGG + Intergenic
1036498659 8:9293974-9293996 TTCTCTCTCCTGAGAGTGTGGGG - Intergenic
1036670766 8:10785658-10785680 ATCTTTCTTATTTGAGTTTGGGG - Intronic
1037874042 8:22529796-22529818 TTTTTTCTTATTGGTGTGTGAGG + Intronic
1038899135 8:31822346-31822368 TTCATTTTGATGAGAGTGTTTGG + Intronic
1039394712 8:37215410-37215432 GGTTTTCTGATTTGAGTGTGAGG - Intergenic
1039724318 8:40198953-40198975 TTCTTTTTGATTAGTGTGTTGGG - Intergenic
1039739211 8:40365378-40365400 TTATTTCTGTTTATGGTGTGAGG + Intergenic
1040128530 8:43766765-43766787 TTCTTTCTGGTTATAATCTGGGG - Intergenic
1041506803 8:58608131-58608153 ATCTTTCAGGTTAGATTGTGGGG + Intronic
1042439913 8:68813414-68813436 TTTATTTTGATTAGAGTGTGGGG - Intronic
1043460248 8:80452554-80452576 ACCTTTCTGATTAGAGTTTATGG + Intergenic
1044185048 8:89240656-89240678 TTGTATCTGATTAGATGGTGTGG + Intergenic
1044295393 8:90521064-90521086 TTCTTTCGGATTTGACAGTGAGG - Intergenic
1044945281 8:97383567-97383589 TTCTCTCTTATGAGAGTGAGGGG + Intergenic
1050795350 9:9533133-9533155 TTCTTTCTCTTGATAGTGTGAGG + Intronic
1050978421 9:11973249-11973271 TTCTTTCTGTCTAGTGTGGGTGG - Intergenic
1052221093 9:26023416-26023438 TTCATTCTTATGAGGGTGTGTGG + Intergenic
1053526076 9:38832414-38832436 TTCTTTGTGAATCTAGTGTGAGG + Intergenic
1053655384 9:40213965-40213987 TTCTATCTGATGAGAGTTTTGGG + Intergenic
1054198303 9:62056839-62056861 TTCTTTGTGAATCTAGTGTGAGG + Intergenic
1054367503 9:64360178-64360200 TTCTATCTGATGAGAGTTTTGGG + Intergenic
1054640051 9:67531524-67531546 TTCTTTGTGAATCTAGTGTGAGG - Intergenic
1055386241 9:75765270-75765292 TTTTTTCTGAGTTGAGTCTGTGG - Intergenic
1055973261 9:81931938-81931960 CTATTCCTGATTAGGGTGTGTGG + Intergenic
1055975014 9:81947030-81947052 CTATTCCTGATTAGGGTGTGTGG + Intergenic
1056249795 9:84735887-84735909 TTCTTTTTGAGTAGAATTTGAGG + Intronic
1057360688 9:94371242-94371264 TCCTTTCTGAGTAGAGTCTATGG - Intergenic
1057662653 9:97016881-97016903 TCCTTTCTGAGTAGAGTCTATGG + Intergenic
1059018308 9:110546005-110546027 TTATTGCTCATTAGTGTGTGGGG - Intronic
1060288089 9:122272809-122272831 TTATTTCTGAATATAATGTGAGG + Intronic
1062656980 9:137608802-137608824 TTCTTACTGAGGAGTGTGTGGGG + Intronic
1203696809 Un_GL000214v1:106043-106065 CTCTATCTGATGAGAGTTTGGGG - Intergenic
1203552404 Un_KI270743v1:174986-175008 CTCTATCTGATGAGAGTTTGGGG + Intergenic
1187214887 X:17266443-17266465 TTCTTTCTGCTTAAAGAGTAAGG + Intergenic
1187439574 X:19306014-19306036 ATGTTTTTGATTAGAGTCTGAGG + Intergenic
1188235572 X:27727015-27727037 TTACTTCTTATTAGGGTGTGTGG - Intronic
1188355949 X:29191621-29191643 TTCCTTATGATTAGAGTGTGGGG + Intronic
1188726084 X:33583827-33583849 TTCTTTCTTATCTGTGTGTGGGG - Intergenic
1189305068 X:39980787-39980809 TTGTTACAGTTTAGAGTGTGTGG - Intergenic
1189578784 X:42383785-42383807 TTCTTTCTGTTTATAGTGACGGG + Intergenic
1191043713 X:56113732-56113754 TTGTTTTTGGGTAGAGTGTGTGG + Intergenic
1191229990 X:58086199-58086221 GTCTCTCTCATTAGAATGTGTGG - Intergenic
1191246631 X:58233320-58233342 ATCTTTCTCATTAGAATGTCTGG - Intergenic
1192447524 X:71222139-71222161 TTGTTTTTTATTAGAGGGTGGGG - Intronic
1193603148 X:83533852-83533874 TTCTTCATGATTACAGAGTGAGG + Intergenic
1193964889 X:87973131-87973153 TTCTTTCTCAGTAAAATGTGGGG - Intergenic
1194320038 X:92434892-92434914 TTCTTCCTCATTTGTGTGTGTGG - Intronic
1194432409 X:93825688-93825710 TTATTTCTAATTAGGGAGTGGGG + Intergenic
1195735284 X:108006624-108006646 TTCCTTCTGACTAGTGTGAGAGG - Intergenic
1196065611 X:111461044-111461066 TACTTTCAGATAAGAATGTGGGG - Intergenic
1196086490 X:111688848-111688870 TTCTTTCTGATTAGAGTGTGTGG + Intronic
1197027839 X:121776398-121776420 TTCTTTCTGATTCAAGTTAGGGG + Intergenic
1197982610 X:132233207-132233229 TTCTTTCTAATTCTAGTCTGTGG + Intergenic
1198640105 X:138747075-138747097 TTCTTTCTGATGAGAATTGGTGG - Intronic
1199140382 X:144304703-144304725 TTCTTTCTGAATTGAATGTGTGG + Intergenic
1199572989 X:149286873-149286895 TTATTTCTGATCAGATTATGTGG - Intergenic
1200628157 Y:5548025-5548047 TTCTTCCTCATTTGTGTGTGTGG - Intronic
1201648540 Y:16261595-16261617 TCCTTTGAGATGAGAGTGTGTGG + Intergenic
1201654270 Y:16323706-16323728 TCCTTTGAGATGAGAGTGTGTGG - Intergenic
1202099827 Y:21295456-21295478 TGCATTCTGCTTAGATTGTGTGG + Intergenic
1202164409 Y:21971096-21971118 TTCTCCCTGATTAAATTGTGAGG + Intergenic
1202226947 Y:22615276-22615298 TTCTCCCTGATTAAATTGTGAGG - Intergenic
1202316175 Y:23580378-23580400 TTCTCCCTGATTAAATTGTGAGG + Intergenic
1202554589 Y:26089688-26089710 TTCTCCCTGATTAAATTGTGAGG - Intergenic