ID: 1196089754

View in Genome Browser
Species Human (GRCh38)
Location X:111726917-111726939
Sequence ATGCATACTGTGCTGCAGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196089754_1196089759 18 Left 1196089754 X:111726917-111726939 CCAGGCTGCAGCACAGTATGCAT 0: 1
1: 0
2: 0
3: 23
4: 173
Right 1196089759 X:111726958-111726980 ATGCACTACTCACAGACAGCTGG 0: 1
1: 0
2: 0
3: 14
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196089754 Original CRISPR ATGCATACTGTGCTGCAGCC TGG (reversed) Exonic
900140850 1:1139035-1139057 AGGCATCCTGAGCTGCATCCGGG + Intergenic
904157587 1:28497484-28497506 ATGCCTACTGCACTCCAGCCTGG + Exonic
904280287 1:29414041-29414063 TTGCATTGTGTGCTGGAGCCAGG + Intergenic
905295312 1:36950946-36950968 ATGCAGCCTCTGCTGCAGACTGG + Intronic
907206215 1:52774181-52774203 ATGCCCACTGTACTCCAGCCTGG - Intronic
908161299 1:61411149-61411171 ATACATACTCTGCTCCAGGCTGG - Intronic
908231602 1:62110913-62110935 ATGCATACTGTGCTTCTGTAAGG + Intronic
911040947 1:93590261-93590283 ATTTATAATGTGGTGCAGCCTGG + Intronic
913549822 1:119906675-119906697 AGGCATACTGTTCAGGAGCCTGG - Intergenic
915483320 1:156202443-156202465 AGGCAGTCTGTGCTGTAGCCTGG + Intronic
922964535 1:229677736-229677758 TTGCACACTGTACTCCAGCCTGG - Intergenic
922993521 1:229937710-229937732 ATGGATACTGCACTTCAGCCTGG + Intergenic
923103050 1:230832565-230832587 GTTCTTACTGTGTTGCAGCCTGG - Intergenic
1064291337 10:14036655-14036677 CTGTCTACTGTGCTCCAGCCTGG - Intronic
1066391923 10:34983894-34983916 TTGCACACTGTGATCCAGCCTGG - Intergenic
1066633055 10:37475542-37475564 TTGCACACTGTACTCCAGCCTGG + Intergenic
1068852126 10:61754903-61754925 ATTCATACTCTGCAGAAGCCTGG + Intronic
1070118359 10:73551058-73551080 TTGCATACTGCACTCCAGCCTGG + Intronic
1071094766 10:81960682-81960704 CTCCATACTGTCCTGCAGCCTGG + Intronic
1071433904 10:85628822-85628844 ATTCACTCTGGGCTGCAGCCAGG - Intronic
1071956460 10:90765982-90766004 ATGTATATTCTGCTGCTGCCAGG + Intronic
1073478454 10:103770250-103770272 TTGCACACTGTACTCCAGCCTGG - Intronic
1076337376 10:129717121-129717143 ATGAGTTCTGTGCTTCAGCCCGG + Intronic
1077343536 11:2036456-2036478 TTGCATAGGGTGCTGCAGCCTGG + Intergenic
1080890773 11:36407356-36407378 ATGCATACTGCACTCCAGCCTGG + Intronic
1081996763 11:47370356-47370378 TTGCACACTGCACTGCAGCCTGG + Intronic
1084373415 11:68759995-68760017 ATGCTTACTGCACTCCAGCCTGG + Intronic
1084419557 11:69053508-69053530 ATGAAGACTGTGCAGGAGCCAGG + Intronic
1088153493 11:106776544-106776566 ATGCCTACTGTGTTGCAGCAGGG - Exonic
1088621214 11:111685803-111685825 TTGCACACTGTACTGCACCCTGG + Intronic
1089657990 11:119965639-119965661 ATGCAGAATGTGATGCAGCTGGG - Intergenic
1090144208 11:124302107-124302129 ACGCATTTTGTGCTGGAGCCAGG + Intergenic
1202809160 11_KI270721v1_random:20262-20284 ATCCATACTGTCCTGCTGGCAGG - Intergenic
1202826522 11_KI270721v1_random:91645-91667 TTGCATAGGGTGCTGCAGCCTGG + Intergenic
1097553375 12:61104541-61104563 ATGAATACTGTCCTGGAGTCAGG + Intergenic
1098266949 12:68731172-68731194 ATGCATACTGGGCAACAGCTAGG - Exonic
1100832415 12:98528916-98528938 ATGGCTACTGTACTTCAGCCAGG + Intronic
1100841556 12:98618134-98618156 ATACCAACTGTGCTCCAGCCTGG + Intronic
1101686583 12:107029561-107029583 CTGCACACTGTACTCCAGCCTGG + Intronic
1102669465 12:114605046-114605068 GTGCATCCTGTGCTGCTCCCTGG + Intergenic
1103753691 12:123185700-123185722 ATGCCTACTGTACTCCAGCCTGG + Intronic
1106609052 13:31261034-31261056 ATCCAGACTTTGCTGCAGGCTGG + Exonic
1107499754 13:40961517-40961539 ATACCTACTGTACTTCAGCCTGG + Intronic
1108012096 13:46027147-46027169 TTGCGCACTGTGCTGCAGCCTGG - Intronic
1109085900 13:57971501-57971523 ATCCATACTGTGCTGCTGGGAGG - Intergenic
1114158917 14:20140584-20140606 ATGCTTACTGCTCTGCAGTCTGG + Intergenic
1116390079 14:44380985-44381007 ATTCTTTCTGAGCTGCAGCCAGG + Intergenic
1117962796 14:61179466-61179488 ATGCACACTTTGCTGCACCAGGG + Intergenic
1118075106 14:62289544-62289566 ATGCAAACAGTGATGTAGCCAGG - Intergenic
1118546054 14:66890365-66890387 ATGCGCACTGCGCTCCAGCCTGG + Intronic
1119791097 14:77350765-77350787 CTGCCTACCGTGCTCCAGCCTGG + Intronic
1121114923 14:91336830-91336852 ACGTGTTCTGTGCTGCAGCCGGG - Intronic
1121874234 14:97436507-97436529 AATCATAGTGTACTGCAGCCTGG - Intergenic
1121975458 14:98399328-98399350 AAACAGACTGTGCTCCAGCCGGG - Intergenic
1122059277 14:99125857-99125879 TTGCCCACAGTGCTGCAGCCAGG + Intergenic
1122404699 14:101493105-101493127 GTGCGGACTGTGCTGCAGCGTGG - Intergenic
1123767299 15:23494260-23494282 ATTAATACAATGCTGCAGCCAGG - Intergenic
1124126907 15:26944797-26944819 ATGGATAGTGGGCTGGAGCCTGG + Intronic
1125991213 15:44110225-44110247 ATATCTACTGTGCTCCAGCCTGG - Intronic
1126741053 15:51776351-51776373 CTGCATTCTGTGCTGCCTCCTGG + Intronic
1126923974 15:53561468-53561490 GTGCATACTTTGCTGCATTCTGG + Intronic
1127495866 15:59511692-59511714 AAGCACACTGCGCTCCAGCCTGG - Intronic
1129050011 15:72773195-72773217 AGGCATCCTGGGCTGCAGACTGG + Intronic
1133186799 16:4105800-4105822 CTGCACACTGTACTCCAGCCTGG + Intronic
1134798600 16:17064270-17064292 ATTCATACTGTACTAGAGCCTGG + Intergenic
1136220902 16:28827867-28827889 ATGGCCACTGTGCTCCAGCCTGG + Intronic
1138659907 16:58510747-58510769 CTGCGCAGTGTGCTGCAGCCAGG + Intronic
1139634964 16:68252927-68252949 CTCCTCACTGTGCTGCAGCCTGG + Intronic
1139975233 16:70804772-70804794 ATGCTGAGTGTGCTGCAACCTGG + Intergenic
1140146643 16:72317711-72317733 TTGCATTCTGTGCAGCAACCAGG + Intergenic
1141295403 16:82763725-82763747 TCGCACACTGTGCTCCAGCCTGG - Intronic
1141745884 16:85926013-85926035 AAGCACACTGTGCTGCACGCTGG - Intergenic
1142787310 17:2234304-2234326 TTGCAAACTATACTGCAGCCTGG - Intronic
1142787373 17:2234749-2234771 TTGCAAACTATACTGCAGCCTGG - Intronic
1144596092 17:16571380-16571402 GTGCACACTGTGGTGCTGCCAGG + Intergenic
1145998078 17:29115772-29115794 GTACCTACTGGGCTGCAGCCTGG - Exonic
1146517311 17:33499216-33499238 CTGAATCCTGTGCTTCAGCCTGG - Intronic
1146978794 17:37140455-37140477 ATGCATATTGATCTGTAGCCAGG - Intronic
1147353936 17:39875938-39875960 CTGCACACTGCACTGCAGCCTGG - Intronic
1150694004 17:67388661-67388683 ATGCACACTGCACTCCAGCCTGG - Intronic
1153804451 18:8700207-8700229 TTGCACACTCTGCTCCAGCCTGG + Intergenic
1157851223 18:51052815-51052837 ATGCATACTGTTCTGGACCTTGG + Intronic
1157872501 18:51243421-51243443 ATGCCCACTGTACTCCAGCCTGG - Intergenic
1159952024 18:74491386-74491408 GAGCATACTGTGCTCCAGCCTGG + Intergenic
1160298653 18:77659208-77659230 ATTCCCACAGTGCTGCAGCCAGG + Intergenic
1160788013 19:910633-910655 AAGCATCCTCTGCTCCAGCCTGG + Intronic
1162209722 19:9081715-9081737 ATAAACACTGTGCTCCAGCCTGG - Intergenic
1164188800 19:22896776-22896798 ATGCCCACTGCACTGCAGCCAGG - Intergenic
1164752498 19:30667075-30667097 ATGCAAACTGTGCTGTAAGCTGG + Intronic
1166659542 19:44637364-44637386 ATGGCCACTGTGCTCCAGCCTGG + Intergenic
1167612457 19:50514025-50514047 ATGCTCACTGTGCTGGACCCGGG - Intronic
925258767 2:2511774-2511796 TTTCATACTGTTCTGGAGCCTGG - Intergenic
926040582 2:9669679-9669701 ATGCCCACTGCACTGCAGCCTGG - Intergenic
927618498 2:24625319-24625341 TTGCACACTGTACTCCAGCCTGG + Intronic
928429584 2:31206283-31206305 ACGCACCCTGTGCTGGAGCCTGG - Intronic
928520625 2:32084842-32084864 ATGCCTACTGCACTCCAGCCTGG + Intronic
930824545 2:55682864-55682886 ATGCCAACTGTACTCCAGCCTGG + Intronic
931907626 2:66859469-66859491 ATGCATATTGTGCTACTGACAGG - Intergenic
933693260 2:85196023-85196045 GTGCAGACTGGGCTGCTGCCTGG - Intronic
933998413 2:87686614-87686636 AGGCACCCTGTGCAGCAGCCAGG - Intergenic
936295436 2:111264259-111264281 AGGCACCCTGTGCAGCAGCCAGG + Intergenic
939808317 2:146802520-146802542 ATGCTGAATGTGCTGCAGCTTGG + Intergenic
941576534 2:167239586-167239608 ATGCATTCTGTTCTGCAGGCTGG - Intronic
942020036 2:171858169-171858191 ATGCATACAGATCTGCAGACTGG + Intronic
942291639 2:174478273-174478295 ATGGCTACTGTACTCCAGCCTGG - Intronic
943571658 2:189581367-189581389 AGGCATTCTCTGCTGCAGGCGGG - Intronic
943761651 2:191616334-191616356 ATACATACTGTTCTGCAGCTTGG + Intergenic
948977698 2:241473558-241473580 ATGGACACTGTGCTGCACCTCGG - Intronic
1170536705 20:17347652-17347674 ATGCACGCTGTGCTCCAGCAGGG + Intronic
1172286314 20:33742982-33743004 ATAGCCACTGTGCTGCAGCCTGG + Intronic
1174228726 20:49026284-49026306 TTGCATACTGCACTGCAGCCTGG + Intronic
1176008160 20:62877327-62877349 GTGCACACTCTGCTGCAGCCTGG + Intergenic
1176899708 21:14425174-14425196 ATGGCTACTGTACTCCAGCCTGG - Intergenic
1178884667 21:36475791-36475813 AATCCTACTGTGCTCCAGCCTGG - Intronic
1179115775 21:38490639-38490661 CTGCTGACTGTGCTGCTGCCAGG - Intronic
1182967344 22:34534648-34534670 ATGCATTCTGTGCTGGAATCAGG + Intergenic
949254897 3:2034350-2034372 TTGGCTACTGTGCTCCAGCCAGG + Intergenic
952384456 3:32829970-32829992 ATGCCAACTGTACTCCAGCCTGG - Intronic
953252589 3:41260324-41260346 AAGCATCCTGAGCTGCTGCCAGG + Intronic
953488255 3:43323809-43323831 ATGCAGACTGTTTTGCAGTCTGG - Intronic
953963460 3:47283815-47283837 AGGCATGCTGTGCTGCTGCCTGG + Intronic
955832861 3:63023367-63023389 ATGCACACTGCACTTCAGCCTGG - Intergenic
958034606 3:88154900-88154922 ATGCCAACTGTACTCCAGCCTGG - Intronic
960004320 3:112766532-112766554 ATGCTTACAGTTCTGCAGGCTGG - Intronic
961958625 3:130830432-130830454 ATGCATATAGAGCAGCAGCCAGG + Intergenic
966777170 3:183553072-183553094 ATGAATACTGTCCTGGAGACAGG - Intronic
968325592 3:197812143-197812165 ACGCATACAGTGTTGCAGTCTGG - Intronic
970057219 4:11988649-11988671 AGTCATTCTCTGCTGCAGCCAGG + Intergenic
972711131 4:41596003-41596025 TTGCATACTGCACTCCAGCCTGG + Intronic
975870219 4:78771961-78771983 ATACATACTGTGATGCAACTAGG + Intergenic
976258194 4:83120446-83120468 GTGCATTCTTTGCTTCAGCCAGG + Intronic
977914348 4:102574597-102574619 CTCCTTCCTGTGCTGCAGCCTGG + Intronic
978154100 4:105470439-105470461 TTGCACACTGTGCTCCAGCTTGG + Intronic
984032660 4:174623925-174623947 ATGGCCACTGTGCTCCAGCCTGG + Intergenic
984998670 4:185463487-185463509 GTGCGTACTGTGCTTAAGCCAGG - Intronic
986524957 5:8663884-8663906 ATTTATACAGAGCTGCAGCCAGG - Intergenic
989568333 5:42923582-42923604 ATGGATACTGGGCTGAAGGCAGG - Intergenic
990695143 5:58408205-58408227 ATTCATACTCTTCTGCAGTCTGG + Intergenic
991071531 5:62487936-62487958 ATGCATACTGTACTGTTTCCTGG + Intronic
994833312 5:104814520-104814542 ATAACTACTGTGCTGCAGCCTGG - Intergenic
995294806 5:110507269-110507291 ATGCATACTGTTATGAAGCAAGG - Intronic
996541320 5:124632309-124632331 GTGCAGCCTGTGCTGGAGCCAGG - Intergenic
998062128 5:139127038-139127060 AACCGTAGTGTGCTGCAGCCAGG + Intronic
998272115 5:140716379-140716401 ATGGCTACTGTACTGCAGCCTGG - Intergenic
998272854 5:140723300-140723322 ATGGCTACTGTACTGCAGCCTGG - Intergenic
998273597 5:140730326-140730348 ATGGCTACTATACTGCAGCCTGG - Intergenic
999000915 5:147922124-147922146 TTGCTTACTTTGCTGCAGCGTGG + Intergenic
1003332193 6:5138440-5138462 ATGCCAACTGTACTTCAGCCTGG + Intronic
1003392570 6:5726374-5726396 ATGAAGACTCTGCTGCAGCATGG + Intronic
1004719749 6:18257670-18257692 TTGCACACTGTACTCCAGCCTGG + Intronic
1005051539 6:21688282-21688304 ATGCATACTGTGCAGAAGACAGG - Intergenic
1005118681 6:22366808-22366830 TTGCATACTGAGGTTCAGCCAGG + Intergenic
1006429166 6:33984562-33984584 ATGCATGCTGCGCTTCTGCCTGG - Intergenic
1010315753 6:74448134-74448156 ATGCCCACTGTGCTCCAGCCTGG + Intergenic
1013340276 6:109207202-109207224 TTGCATACTGCACTCCAGCCTGG + Intergenic
1013648342 6:112168248-112168270 ATGCTTAGTGTGATGAAGCCTGG + Intronic
1015082232 6:129240973-129240995 AAGCTTACTGTACTGCAGACTGG - Intronic
1018456572 6:163959201-163959223 TTGCACACTGTACTCCAGCCAGG - Intergenic
1018503963 6:164443848-164443870 CTGCACACTGTGCTGCACCTGGG - Intergenic
1026504631 7:70971762-70971784 TTGCACACTGAGCTCCAGCCTGG - Intergenic
1027245054 7:76361089-76361111 TTGCAGACTCTGCTGCTGCCAGG + Intergenic
1027777371 7:82483639-82483661 AAGCATACAGTTCTGCTGCCTGG - Intergenic
1029992091 7:104971880-104971902 ACACATACAGTTCTGCAGCCAGG - Intergenic
1030024513 7:105310102-105310124 ATGTTTTCTCTGCTGCAGCCTGG - Intronic
1030852528 7:114508492-114508514 AGGCATCCTGTGCTCCAGCTAGG - Intronic
1032430053 7:131853567-131853589 TTGCATGCAGTGCTGCAGGCAGG - Intergenic
1034901533 7:154910671-154910693 ATGCTGAGTGTGCTGCAGCTTGG - Intergenic
1035219920 7:157400387-157400409 ATGCTTGCTGTGCAGCAGGCCGG + Intronic
1035386261 7:158475060-158475082 TTGGAGACTGTGCTGCAGCCGGG - Intronic
1035540144 8:428265-428287 ACGTATGCTGTGGTGCAGCCTGG + Intronic
1036517935 8:9462333-9462355 ATGGATACTGGGCCCCAGCCAGG + Intergenic
1036794569 8:11746182-11746204 ATGCCCACTGCACTGCAGCCTGG + Intronic
1038394165 8:27234608-27234630 AAGCCTCCTGGGCTGCAGCCTGG + Intergenic
1039833284 8:41235183-41235205 CTGCATACTGCACTCCAGCCTGG + Intergenic
1044386684 8:91597528-91597550 AACCATACTGTGCTGCTGACTGG - Intergenic
1045215500 8:100145385-100145407 AGGCAGCGTGTGCTGCAGCCTGG + Exonic
1047955532 8:129972529-129972551 ATGTGCACTGTGCTCCAGCCTGG + Intronic
1048330190 8:133465850-133465872 AAGCCTACCGTGCTGCACCCAGG - Intronic
1049414437 8:142488860-142488882 ACGGACACAGTGCTGCAGCCAGG - Intronic
1049550884 8:143258920-143258942 CTCCAGACTGTGCTGCTGCCTGG - Intronic
1053483460 9:38433699-38433721 GTGAATACTGTGCTGAAGCCAGG + Intergenic
1056019984 9:82431158-82431180 TTGCAGACTGTGAGGCAGCCGGG + Intergenic
1056722546 9:89083980-89084002 ATGCTTAGTGTGCTGGAGCTGGG - Intronic
1056755853 9:89381682-89381704 ATGCATCCTCTGCTGCAGGGAGG - Intronic
1056988441 9:91387355-91387377 ATGGCCACTGTGCTCCAGCCTGG - Intergenic
1057376053 9:94524097-94524119 ATGCCCACTGTGCTCCAGCCTGG - Intergenic
1058689359 9:107506342-107506364 GTGCCCACTGTGCTCCAGCCTGG - Intergenic
1061153172 9:128841047-128841069 CTGCATACTGTTCTGTTGCCTGG - Intronic
1186286573 X:8050146-8050168 ATGGATACTGTGCTGGTGCCAGG + Intergenic
1187275048 X:17809810-17809832 TTGCACACTGTACTCCAGCCTGG - Intronic
1189275975 X:39786549-39786571 ATACTCACTGTGCTCCAGCCTGG - Intergenic
1190937116 X:55007310-55007332 ATGCGTACTGTGAAGAAGCCAGG + Exonic
1192344955 X:70295018-70295040 GCACACACTGTGCTGCAGCCTGG + Intronic
1193239432 X:79149613-79149635 ATTCATACTCTGCTTCAGCTAGG - Intergenic
1196089754 X:111726917-111726939 ATGCATACTGTGCTGCAGCCTGG - Exonic
1197234584 X:124045599-124045621 ATGCATACTGTGCCACAGCAGGG + Intronic
1201317021 Y:12657527-12657549 TTGCACACTGCTCTGCAGCCTGG - Intergenic