ID: 1196093789

View in Genome Browser
Species Human (GRCh38)
Location X:111776569-111776591
Sequence AGATATTCTCAGATGGAGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 381}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196093789 Original CRISPR AGATATTCTCAGATGGAGAA AGG (reversed) Exonic
900282384 1:1879152-1879174 AGAAGTTCTCAGCTGGAGACAGG - Intronic
904397649 1:30233106-30233128 AAATATTCTCAAATACAGAAAGG - Intergenic
904794638 1:33050188-33050210 AGATATTTTCAGAGAGATAAAGG - Intronic
905983242 1:42251386-42251408 AGATATTTTCAGAGGAACAAAGG + Intronic
906353827 1:45085725-45085747 AGATGGTCTCAGATGAAGATGGG - Intronic
906580871 1:46934356-46934378 CGGTCTTCCCAGATGGAGAATGG - Exonic
906602852 1:47144538-47144560 CGGTCTTCCCAGATGGAGAATGG + Exonic
906884000 1:49624802-49624824 TTATTTTCTCACATGGAGAAAGG - Intronic
907389996 1:54151906-54151928 AGATGTTCTCAGGTGGAAAAAGG + Intronic
907837400 1:58123355-58123377 AGATGCTTTCAGATGGAGTAAGG - Intronic
908704170 1:66932238-66932260 ATATTTTATCAGTTGGAGAATGG + Intronic
909095946 1:71289645-71289667 AAATATTCTCAAATGAAGATTGG + Intergenic
909244897 1:73269151-73269173 AGGTGGTCTCAGATGGAGATGGG + Intergenic
909350830 1:74651539-74651561 AGATATTCTGAGATTTAGAAAGG - Intronic
909523953 1:76601371-76601393 AGTTATTTTCAGATGAATAAAGG + Intronic
910066733 1:83162458-83162480 AGGTTTACTCAGAGGGAGAAAGG - Intergenic
910113045 1:83702231-83702253 AGAGATTCCAAGATGGAGGAAGG - Intergenic
910113220 1:83703707-83703729 AGAGATTCCAAGATGGAGGAAGG + Intergenic
911582806 1:99653747-99653769 AGCTGTTCTCAAATGGAAAAGGG - Intronic
912405592 1:109434965-109434987 AGGTGGTCTCAGATGGAGATGGG - Intergenic
912989259 1:114467912-114467934 ATATATTTTCAGATAGAGAGGGG + Intronic
913393794 1:118343828-118343850 AGAGATTAGCAGAGGGAGAAGGG + Intergenic
913448285 1:118973025-118973047 GAATATTCTAAGATGGAAAAGGG + Intronic
915602587 1:156931601-156931623 TGATATTGTCAGATGAAGACGGG - Intronic
915658985 1:157385975-157385997 GTATATTCACAGATGCAGAAAGG + Intergenic
916659227 1:166905849-166905871 AGAGATTCTGAGATAGAGTATGG - Intergenic
916994008 1:170276116-170276138 AAATATTCTCACATAGAAAAGGG - Intergenic
918003829 1:180523516-180523538 AGAGGTCCTCAGATGGACAATGG - Intergenic
919308860 1:195879146-195879168 AGATGGTCCCAGATGGAGATGGG - Intergenic
922320267 1:224480725-224480747 AGGTGGTCTCAGATGGAGATGGG - Intronic
922579084 1:226683744-226683766 CCATTTTCTCAGATGAAGAAAGG - Intronic
923284826 1:232483631-232483653 AGATTTCCTCAGATGAACAAAGG - Intronic
923869619 1:237976770-237976792 AGTTATTCTCAGTTGGAGGCCGG + Intergenic
923906178 1:238387559-238387581 AGCTATTTTCATATCGAGAATGG - Intergenic
923932757 1:238721483-238721505 AGGTGGTCTCAGATGGAGATGGG + Intergenic
1062851436 10:745796-745818 AGATAGTCTCAGCAGAAGAATGG + Intergenic
1064617030 10:17169383-17169405 ATATATTATCAAATGGAAAAGGG + Intronic
1067481481 10:46602245-46602267 AGAGATTGCAAGATGGAGAAAGG + Intergenic
1067563371 10:47319744-47319766 GGATTTTCTCAGATGGACCAGGG + Intergenic
1067613271 10:47739484-47739506 AGAGATTGCAAGATGGAGAAAGG - Intergenic
1067661789 10:48241494-48241516 ATATAGTCTCAGCTGGAGACAGG - Intronic
1068000031 10:51322149-51322171 AGATGATCTCAGCTGGAAAAAGG + Intronic
1068487480 10:57678406-57678428 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1068653911 10:59554881-59554903 AGACATTCTCACATGGGGAGGGG - Intergenic
1069014647 10:63415308-63415330 AGGTTTTATTAGATGGAGAAGGG - Intronic
1069367706 10:67711423-67711445 AGGTGGTCTCAGATGGAGATAGG + Intergenic
1069578477 10:69547486-69547508 AGACATTTTCTGATGGAAAAGGG - Intergenic
1069914157 10:71776903-71776925 ACATCTTCCCAGGTGGAGAAAGG + Intronic
1070478783 10:76858564-76858586 AGAAAATCTCAGATTGGGAAAGG - Intergenic
1070907190 10:80083548-80083570 AGATAATATCAGATGGTGACTGG - Intronic
1071025267 10:81105502-81105524 AAATATTTTAAGCTGGAGAAGGG - Intergenic
1071035834 10:81244108-81244130 CTATATTCTCACATGCAGAAAGG - Intergenic
1071628681 10:87199589-87199611 AGAGATTGCAAGATGGAGAAAGG - Intergenic
1072747687 10:97952899-97952921 ATATATTCACAGATGTGGAAGGG - Intronic
1073922203 10:108471574-108471596 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1074718188 10:116240003-116240025 AGCAATTCACAGAGGGAGAAAGG + Intronic
1075219277 10:120570353-120570375 TGATCTTCTCTGAGGGAGAAAGG - Intronic
1075987625 10:126801127-126801149 AGATGTTCCAAGATGGACAAAGG + Intergenic
1076414553 10:130276445-130276467 AGACATTCTCAGAGGGAGGGAGG + Intergenic
1077905780 11:6532403-6532425 AGAAAGTCTCAGGTGGATAAGGG - Intronic
1078954659 11:16177964-16177986 AGATAAGCACAGATAGAGAAGGG + Intronic
1079010182 11:16821629-16821651 ATATATTTTCAAATGGAAAATGG + Intronic
1079485969 11:20936194-20936216 AGTTGTCCTCAGTTGGAGAAAGG + Intronic
1079514730 11:21253881-21253903 GGATATACTCCAATGGAGAAAGG + Intronic
1079974415 11:27074493-27074515 AGGTAGTCTCAGATGGAGATGGG + Intronic
1081120129 11:39256021-39256043 AGGTGGTCTCAGATGGAGAGAGG - Intergenic
1082251674 11:49988949-49988971 CCATAATCTCAGATGGTGAAAGG - Intergenic
1082556806 11:54572500-54572522 CCATAATCTCAGATGGTGAAAGG + Intergenic
1084680845 11:70665433-70665455 GAAAATTCTCAGATGGAGCAGGG - Intronic
1085584956 11:77693528-77693550 TGATCATCCCAGATGGAGAATGG - Exonic
1086322584 11:85665545-85665567 AGATGTCCTCAGTTGGATAATGG + Intronic
1086460758 11:87003307-87003329 AGAGATTCTCAGAATGGGAAGGG + Intergenic
1086502512 11:87467849-87467871 AGATATTGTCAGATGGTAATGGG + Intergenic
1088207010 11:107404095-107404117 AGACAGTCTCACATGGAGAAAGG - Intronic
1090825887 11:130385687-130385709 AGTTATTCTCAGGTCCAGAAGGG + Intergenic
1091024510 11:132130113-132130135 AAATATTCTCAGAAGGAGAAGGG + Intronic
1091870431 12:3885588-3885610 AGATATTCTAGGGTGCAGAAAGG + Intergenic
1092662748 12:10756184-10756206 AGATGGTCTCAGATGGAGATGGG - Intergenic
1093133814 12:15424720-15424742 GAATATTCCCAGATGAAGAAAGG + Intronic
1094250679 12:28356710-28356732 AAATATTATCTGATTGAGAAAGG - Intronic
1095308105 12:40662022-40662044 AGGTGGTCTCAGATGGAGATAGG + Intergenic
1097502858 12:60427702-60427724 AGAAATTGCCAGTTGGAGAATGG - Intergenic
1098836280 12:75428197-75428219 AGGTGGTCTCAGATGGAGATGGG + Intronic
1099289921 12:80763801-80763823 AAATATAGTCAGATGGAAAATGG + Intergenic
1099606063 12:84802498-84802520 AAATGTTCTCATATGGAGATAGG - Intergenic
1099841062 12:87967956-87967978 AGAGTATTTCAGATGGAGAATGG - Intergenic
1100093981 12:91008538-91008560 ACAGTTTCTCAGATGCAGAATGG - Intergenic
1100144122 12:91656456-91656478 GAATGTTCTTAGATGGAGAATGG - Intergenic
1100148425 12:91706226-91706248 AGATCTTCTGATGTGGAGAATGG - Intergenic
1101845393 12:108359244-108359266 AGATATTTTCAGATAAAAAAAGG - Intergenic
1103116441 12:118337513-118337535 AGATATTCTTTAATGGATAAAGG + Intronic
1103841606 12:123869725-123869747 AGATAAACTCAGATGGAGCGAGG - Intronic
1103894232 12:124262477-124262499 AGAGATTCTGAGGTGGAGGAGGG - Intronic
1105955622 13:25279626-25279648 AGATAAGTTCAAATGGAGAAAGG + Intronic
1106877242 13:34087621-34087643 AGGTGGTCTCAGATGGAGATGGG + Intergenic
1108555497 13:51587769-51587791 AGAGAATTTCAGATGAAGAATGG + Intronic
1108617822 13:52151690-52151712 ATGTGTTCTCAGATGGAAAACGG - Intronic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1109509195 13:63346845-63346867 AAATATTCTGAGAGGAAGAAGGG + Intergenic
1109829527 13:67769467-67769489 AGAGATTTTCAGCTGGCGAAGGG - Intergenic
1110521169 13:76478541-76478563 AGTTGTTCACACATGGAGAAAGG - Intergenic
1111287354 13:86112277-86112299 ATATATTTGCAAATGGAGAAAGG - Intergenic
1111395697 13:87666509-87666531 AGATTTTTTCAGATGGAGAAAGG + Intergenic
1111693403 13:91592928-91592950 AGACATTCTCAGAGGGAGATGGG + Intronic
1112744122 13:102508104-102508126 AGGTGGTCTCAGATGGAGATGGG + Intergenic
1113133178 13:107060690-107060712 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1113667971 13:112154074-112154096 GAAGCTTCTCAGATGGAGAAAGG - Intergenic
1114947277 14:27699431-27699453 AGACATTCTGAGATGGAGATGGG + Intergenic
1115130453 14:30047408-30047430 AGGTGGTCTCAGATGGAGATGGG - Intronic
1117143891 14:52817336-52817358 AGATAGTCCGAGATGCAGAAAGG - Intergenic
1117211525 14:53505744-53505766 AGATTTTCTCAGCAAGAGAAAGG - Intergenic
1117884306 14:60343609-60343631 GGATCTTCACAGATGGAGATGGG - Intergenic
1119305974 14:73608442-73608464 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1120413719 14:84193365-84193387 AGGTGATCTCAAATGGAGAAGGG + Intergenic
1121471088 14:94154996-94155018 AGGTGGTCTCAGATGGAGATAGG + Intronic
1121724297 14:96135322-96135344 AGATATCCTGAGATGGAAATGGG - Intergenic
1122893362 14:104743160-104743182 AGATATGCTCACATGGTCAACGG + Exonic
1126266256 15:46756909-46756931 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1126269226 15:46793429-46793451 AGATGTTCTCAAAAGGGGAATGG + Intergenic
1126332137 15:47544631-47544653 AGATAAACTATGATGGAGAAAGG + Intronic
1126547589 15:49889858-49889880 AGATGTTTTCAGCTGAAGAAAGG + Intronic
1126674113 15:51144501-51144523 AGATATTCTCAGTGGGAGGTTGG + Intergenic
1127599286 15:60518945-60518967 AGATATTTTGAGAGAGAGAAGGG + Intronic
1127627067 15:60790029-60790051 ATAGGTTCTCAGATGGAGGAAGG - Intronic
1127829560 15:62738337-62738359 AGAGGTTCTTAGATTGAGAAAGG + Intronic
1128133158 15:65244075-65244097 AGATCTTACCAGATGGAGAAAGG - Intronic
1128446206 15:67763424-67763446 ACATGTTATCAGAAGGAGAAAGG - Intronic
1128851436 15:70961499-70961521 AGATGTCCTCAGAAGGTGAATGG + Intronic
1130047057 15:80453737-80453759 CCACATTCTCAGATGGAAAAGGG - Intronic
1133385241 16:5364576-5364598 AGAGATTTTTAGATAGAGAATGG - Intergenic
1135275091 16:21105283-21105305 AGGTATTTTCAGATAGAAAATGG + Intronic
1135484726 16:22854093-22854115 AGATATTCTCAGATATTTAAGGG - Intronic
1137859881 16:51835858-51835880 TGATTTTCTCAGAAGGTGAAGGG - Intergenic
1137899156 16:52246194-52246216 AGAGCTTCTCAGAGGGAGATGGG - Intergenic
1138780639 16:59780901-59780923 AGATACTCTCAGATAGATCAAGG - Intergenic
1139314803 16:66059114-66059136 AGAGATGATCAGCTGGAGAAAGG - Intergenic
1140624322 16:76773189-76773211 AGATTTACTCAGCTGGAAAAGGG - Intergenic
1140711541 16:77682834-77682856 TGGAATCCTCAGATGGAGAAAGG + Intergenic
1144301577 17:13926377-13926399 AGATTTCCTCAGTTGGAGCACGG - Intergenic
1144317335 17:14075027-14075049 GCATTTTCTCAGATGGAAAAGGG + Intronic
1144759423 17:17698996-17699018 AGAGCTTCTCTGATGGAGACAGG + Intronic
1146592416 17:34138822-34138844 ATTAATTCTCAGATGGACAAGGG - Intronic
1146625182 17:34430015-34430037 AGAGTTGCTCTGATGGAGAATGG + Intergenic
1146641465 17:34544762-34544784 GGAAATCCTCAGATGGAAAAAGG + Intergenic
1147468723 17:40635972-40635994 AGACAATCTCGCATGGAGAAAGG - Exonic
1147641290 17:42002255-42002277 AGATCTTCTCTGATGGAGTTTGG - Intronic
1149306027 17:55347321-55347343 AGAAATTGTCACATGGTGAAAGG - Intergenic
1149900544 17:60473440-60473462 AAATATTTTTAGATGGAAAATGG - Intronic
1150252420 17:63714401-63714423 TGAAATTCTCACTTGGAGAAGGG + Intronic
1150687307 17:67331086-67331108 AGGTGGTCTCAGATGGAGATGGG + Intergenic
1151069240 17:71189479-71189501 AGAAATTTTCAGAAGCAGAAGGG - Intergenic
1151647648 17:75444343-75444365 AGTATTTCTAAGATGGAGAAGGG + Intronic
1154075877 18:11201221-11201243 AGATATTCTCAGTTTGTCAAAGG - Intergenic
1154086922 18:11314454-11314476 AAATACTCAGAGATGGAGAAGGG + Intergenic
1154109586 18:11554583-11554605 AGATATTTTGAGAGAGAGAAAGG - Intergenic
1154509826 18:15086050-15086072 AGATGTTCTTAGATTGAAAATGG + Intergenic
1155029474 18:21971724-21971746 AGATATCCTCAGGTGGACAAGGG - Intergenic
1156207980 18:34906662-34906684 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1156233716 18:35180561-35180583 AGTAAGTCTCAGATGGGGAAAGG - Intergenic
1158320444 18:56256372-56256394 CGATTTTCTCAGCTGGAAAATGG + Intergenic
1158998791 18:62951710-62951732 AGTTTTACTCAGATTGAGAAGGG - Intronic
1159034188 18:63261415-63261437 AGATATTCACTGAAGGAGTAAGG + Intronic
1160625105 18:80198735-80198757 AAGTATTCACATATGGAGAATGG + Intronic
1161733346 19:5975979-5976001 AGAAGTTCTCAGATGGGTAAGGG + Intronic
1165587897 19:36936968-36936990 ACATATAGTCACATGGAGAAAGG - Intronic
1166165016 19:40981315-40981337 AGGTGGTTTCAGATGGAGAAGGG - Intergenic
1167900104 19:52614958-52614980 AGATATTTTCTAATAGAGAAAGG + Intronic
1167945879 19:52988339-52988361 AGATTTTGTCTGATGGATAATGG + Intergenic
925616228 2:5746912-5746934 GGATATACTCAGATGAAGAAGGG - Intergenic
925747549 2:7056533-7056555 AGATACCCTCAGATTGAGAATGG - Intronic
926246460 2:11125165-11125187 AGAAATTCCCTGATGGATAATGG - Intergenic
926666665 2:15531899-15531921 AAATAATCAGAGATGGAGAATGG - Intronic
927432028 2:23034901-23034923 GGATATTCTCAGCTGGGGGAAGG - Intergenic
927443437 2:23136693-23136715 AGACAGTCTCAGTTTGAGAAGGG + Intergenic
927483960 2:23476163-23476185 AGAGATTCTCTGATGGGGCACGG - Intronic
927974570 2:27328301-27328323 ATATATGCTCAGATGCAGTACGG + Intronic
928686716 2:33757497-33757519 AAATACTCTCAGAAGAAGAATGG + Intergenic
928742941 2:34376989-34377011 AGGTATCCTCACATGGTGAAAGG - Intergenic
929634811 2:43507988-43508010 ACATATTCTCATATGCAGAGAGG + Intronic
932505731 2:72229526-72229548 AGGTATTATCAGAGGGAGACAGG + Intronic
932804302 2:74769605-74769627 AGATCTTCTCTGCTGGAGGATGG + Intergenic
933082447 2:78007946-78007968 AGATATTTTCAGACGTGGAATGG + Intergenic
933331306 2:80896216-80896238 AGATATTCTTAAATGGAGTTGGG + Intergenic
933828387 2:86185371-86185393 ATAGATTCTCAAATAGAGAAGGG + Intronic
934017049 2:87899144-87899166 AGGTGATCTCAGATGGAGATGGG + Intergenic
935033005 2:99340174-99340196 AGATATTGGGAGATGGGGAATGG + Intronic
935149491 2:100420935-100420957 AAATATTTTCAGATGGAGACTGG + Intergenic
936895154 2:117419309-117419331 ATATATTATCAGATGGAAGATGG - Intergenic
940391658 2:153139576-153139598 AGATATGAACAGATGGAGATGGG + Intergenic
940493808 2:154399475-154399497 ATATATCCTCACATGGACAAAGG + Intronic
940635983 2:156297371-156297393 ACCTATTTTCACATGGAGAAAGG - Intergenic
940724308 2:157318208-157318230 GCATATTTTCAAATGGAGAACGG - Intergenic
941462615 2:165789269-165789291 AGGTATCCTCACATGGAGGAAGG + Intronic
942283301 2:174389334-174389356 AGGTGGTCTCAGATGGAGATGGG + Intronic
943502116 2:188705247-188705269 AGACTTTCTCAGATTTAGAAAGG + Intergenic
943563929 2:189495558-189495580 AGGTGGTCTCAGATGGAGATGGG + Intergenic
943712982 2:191118687-191118709 AGAAATTCTCACATAGATAAAGG - Intronic
943997774 2:194793673-194793695 AGATATTATCAGAGATAGAAAGG - Intergenic
944020342 2:195095283-195095305 AGAGAGTCTCAGCTGCAGAATGG + Intergenic
944027430 2:195188085-195188107 AGATATTTTCAGAAAGTGAAGGG + Intergenic
944371275 2:198986218-198986240 AGGTGGTCTCAGATGGAGATTGG - Intergenic
945164907 2:206932964-206932986 GGACATTCTCACATGGAGGAAGG + Intergenic
945852732 2:215029192-215029214 AGATATTCTGTGATGGGGATGGG - Intronic
946387295 2:219392176-219392198 AGATTTTCTCAGAAGGCCAAGGG - Intronic
947048826 2:226019300-226019322 AGGTGGTCTCAGATGGAGATGGG - Intergenic
948331879 2:237175121-237175143 ATATATTCTCCGATGGCAAAAGG - Intergenic
948878832 2:240845301-240845323 AGGTGATCTCAGATGGAGATGGG + Intergenic
1169163699 20:3405252-3405274 TCATTTTCACAGATGGAGAATGG - Intronic
1169826038 20:9769815-9769837 AGGTCATATCAGATGGAGAATGG - Intronic
1170655033 20:18278502-18278524 GGATATTCTCATCTCGAGAAGGG + Intergenic
1170735831 20:19013450-19013472 AGATATTTTAAGATGGAGGGTGG + Intergenic
1173090426 20:39965388-39965410 AAATAATTTCAAATGGAGAAAGG - Intergenic
1173303846 20:41829085-41829107 AGAGATTTTCAGCTGGGGAAGGG + Intergenic
1173690329 20:44955975-44955997 AGATTGTCTCAGAAGGAGAAAGG - Intronic
1174551617 20:51366534-51366556 AAATCGACTCAGATGGAGAAAGG + Intergenic
1176336853 21:5606923-5606945 AGAAAGTCTCAAATGGAGAGAGG + Intergenic
1176390904 21:6214025-6214047 AGAAAGTCTCAAATGGAGAGAGG - Intergenic
1176470515 21:7102149-7102171 AGAAAGTCTCAAATGGAGAGAGG + Intergenic
1176494076 21:7483927-7483949 AGAAAGTCTCAAATGGAGAGAGG + Intergenic
1176506566 21:7654456-7654478 AGAAAGTCTCAAATGGAGAGAGG - Intergenic
1176788241 21:13285735-13285757 AGATGTTCTTAGATTGAAAATGG - Intergenic
1177604551 21:23360764-23360786 AGGCAGTCTCAGATGGAGATGGG - Intergenic
1177938882 21:27384791-27384813 GCAGATTGTCAGATGGAGAAAGG - Intergenic
1177987390 21:27993934-27993956 AGATGTTCTTAGATTGAAAATGG - Intergenic
1179077587 21:38137526-38137548 ATATAATCTCAGATTGAGATAGG - Intronic
1180249733 21:46575492-46575514 ATATAATCTCATATGTAGAAAGG + Intergenic
1182182273 22:28362687-28362709 AGGTGGTCTCAGATGGAGATGGG + Intronic
1182503550 22:30765858-30765880 AGAAAGTCTCTGATGAAGAAAGG - Intronic
1182727044 22:32456003-32456025 GGATTTTCTCATATGGAAAATGG - Intronic
1183168527 22:36166367-36166389 ATATACTCTCAGAGGGAGAGCGG - Intergenic
1183669657 22:39264911-39264933 AGATTTGGTCAGATGGAGGAGGG - Intergenic
950430851 3:12950144-12950166 CCATTTTCTCATATGGAGAATGG - Intronic
950812915 3:15666814-15666836 AGATTTGAACAGATGGAGAAGGG - Intergenic
951633956 3:24752663-24752685 AGAGTTTCTCCAATGGAGAATGG - Intergenic
952038143 3:29229096-29229118 AAATATTCTTAAATAGAGAAAGG - Intergenic
953146490 3:40280894-40280916 TGAGATTCTCAGAAGGGGAATGG - Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953368649 3:42368518-42368540 AAGTATTCTCAGATTGTGAAAGG - Intergenic
954252036 3:49375383-49375405 AAATATTCTAACATGGAAAATGG + Intronic
954484705 3:50836978-50837000 AGGTGGTCTCAGATGGAGAAGGG - Intronic
957442537 3:80268469-80268491 AGAGATTCTCAGATAGAAAAAGG + Intergenic
957546711 3:81647382-81647404 AAACATATTCAGATGGAGAAAGG - Intronic
958466264 3:94463163-94463185 AGATGTACTCAGATGGGTAATGG + Intergenic
958634125 3:96721000-96721022 AAATCTTCAGAGATGGAGAAAGG + Intergenic
958736436 3:98015127-98015149 AAATCTTTTCAGATGGAAAATGG + Intronic
959600543 3:108179027-108179049 ACATATACTCAGATGCAGGAAGG + Intronic
961207941 3:125102215-125102237 AGAGTTTTCCAGATGGAGAAGGG + Intronic
963549667 3:146703271-146703293 AGAACTTCTCAGAGGGAGATGGG + Intergenic
964291325 3:155184266-155184288 AGATCTTCTCAGTTGTACAAAGG + Intergenic
964897131 3:161612182-161612204 AGGTGGTCTCAGATGGAGATAGG + Intergenic
965503701 3:169487115-169487137 AGATATTTTCAGACAGACAAAGG + Intronic
965685746 3:171300410-171300432 AAATTTTCTCAGAAAGAGAAAGG + Intronic
965889087 3:173488488-173488510 AGATATTTTCAGATAGACATAGG - Intronic
967734109 3:192934035-192934057 AGATATTTACAGAAGGAGTATGG + Intergenic
968383581 4:115891-115913 AGATGTTCACAGATGTAAAAAGG - Intergenic
970306180 4:14734730-14734752 AGGTGGTCTCAGATGGAGATGGG - Intergenic
970846734 4:20548412-20548434 AGTGATTCTTAGAAGGAGAAGGG - Intronic
971214811 4:24653008-24653030 AAATATTCTCAGAATGAGAAGGG + Intergenic
971917071 4:32885029-32885051 AGCTATTATCATATGGAGAAAGG - Intergenic
972260294 4:37401269-37401291 AGATCTTCTCAGGTGGAGATGGG - Intronic
973718517 4:53701059-53701081 AGGTGGTCTCAGATGGAGATGGG - Intronic
974215459 4:58841352-58841374 AGGTGGTCTCAGATGGAGATGGG + Intergenic
974325480 4:60408899-60408921 AGATATTCTGAGAGAGAGAGAGG + Intergenic
974716798 4:65678366-65678388 AGGTGGTCTCAGATGGAGAAGGG + Intergenic
974966427 4:68766108-68766130 AGATATTCTTATAAGGAGAAAGG - Intergenic
975332887 4:73139364-73139386 AGAAGTTCTCAGATGGATACAGG - Intronic
977129676 4:93219823-93219845 AATTTTTCTTAGATGGAGAAAGG - Intronic
977573742 4:98656519-98656541 ACATTTTCACAAATGGAGAAGGG + Intronic
977692552 4:99931194-99931216 AGATAGGCTGAGATGGAAAAAGG + Intronic
978983590 4:114982339-114982361 AGGTGGTCTCAGATGGAGATGGG + Intronic
979811184 4:125038219-125038241 TGATATTCACAGAAAGAGAAAGG + Intergenic
980213571 4:129821677-129821699 AATTATTCTGAGATGGAGAAAGG - Intergenic
980232504 4:130062521-130062543 AGATTTTCTCACTGGGAGAATGG - Intergenic
980385988 4:132088607-132088629 AGGAAGTCTCAGAGGGAGAAGGG + Intergenic
980646033 4:135643521-135643543 AGGTGGTCTCAGATGGAGATGGG + Intergenic
980925704 4:139135186-139135208 ATATATTCTAAAATGTAGAATGG - Intronic
981555320 4:145987292-145987314 TGATACTCTCAGATGGCAAATGG - Intergenic
983322236 4:166210364-166210386 ATCTATTCTCAGATGAGGAATGG - Intergenic
984026245 4:174547028-174547050 AGGTGTTCTCAGATGGAGATGGG + Intergenic
984900441 4:184581451-184581473 AGGTGGTCTCAGATGGAGATGGG - Intergenic
986950907 5:13083869-13083891 AAATTTACTCACATGGAGAAAGG + Intergenic
987216653 5:15744409-15744431 AGGTGATCTCAGATGGAGATGGG - Intronic
988381588 5:30503507-30503529 AGATATTCAGAGATGTAGAAAGG + Intergenic
988885114 5:35548064-35548086 GTATGTTCTCAGGTGGAGAACGG - Intergenic
989730305 5:44640958-44640980 AGATATTTCCAGCTGGTGAAGGG - Intergenic
990653890 5:57933443-57933465 AGATATTATAAGCTGTAGAAAGG + Intergenic
992458148 5:76935388-76935410 AGGTATTCTGAGATCGAGAAAGG - Intergenic
992669976 5:79049706-79049728 GGATAGTGTCAGATGGAGACTGG + Intronic
993251154 5:85524767-85524789 AGATGTTCTCAGATGAAGATGGG + Intergenic
993711648 5:91230974-91230996 AGGTGGTCTCAGATGGAGATGGG - Intergenic
994019605 5:95007492-95007514 AGTTATTCTCTGATTGAGGAAGG - Intronic
994516598 5:100780192-100780214 AGATATTCTGGGATAGAGACTGG - Intergenic
994726801 5:103445757-103445779 ATTTCTTCTCAGAGGGAGAAAGG - Intergenic
994808166 5:104478788-104478810 AGGTAGTGTCAGATGGAGATGGG + Intergenic
995199952 5:109414528-109414550 AGGTGGTCTCAGATGGAGAAGGG + Intergenic
995404874 5:111783600-111783622 AAACTTCCTCAGATGGAGAAGGG - Intronic
995512674 5:112923948-112923970 AGATACTTTCAGATAGAGGAGGG - Intergenic
995616584 5:113971254-113971276 AGATTTCATCAGATGAAGAAAGG - Intergenic
997894460 5:137703779-137703801 AGATATTTCCAGGTGGAGGAGGG - Intronic
998785434 5:145703715-145703737 AGATATAGTTAGAGGGAGAAAGG + Intronic
999046670 5:148477138-148477160 AGATAATGTCAGTTGTAGAAAGG + Intronic
1003573603 6:7271949-7271971 AGATGCTCTCAGATAGAGAACGG + Intronic
1003573605 6:7271990-7272012 AGATGCTCTCAGATAGAGAACGG + Intronic
1003573606 6:7272031-7272053 AGATGCTCTCAGATAGAGAACGG + Intronic
1003573608 6:7272109-7272131 AGATGCTCTCAGATAGAGAACGG + Intronic
1003573611 6:7272187-7272209 AGATGCTCTCAGATAGAGAACGG + Intronic
1003573614 6:7272228-7272250 AGATGCTCTCAGGTAGAGAACGG + Intronic
1003573616 6:7272269-7272291 AGATGCTCTCAGGTAGAGAACGG + Intronic
1003573618 6:7272310-7272332 AGATGCTCTCAGATAGAGAACGG + Intronic
1003573619 6:7272351-7272373 AGATGCTCTCAGATAGAGAATGG + Intronic
1003573620 6:7272392-7272414 AGATGCTCTCAGATAGAGAACGG + Intronic
1003573623 6:7272470-7272492 AAATGCTCTCAGATAGAGAACGG + Intronic
1003573625 6:7272511-7272533 AAATGCTCTCAGATAGAGAACGG + Intronic
1003573628 6:7272589-7272611 AGATGCTCTCAGATAGAGAACGG + Intronic
1003573630 6:7272630-7272652 AGATGCTCTCAGATAGAGAACGG + Intronic
1003573632 6:7272708-7272730 AGATGCTCTCAGATAGAGAACGG + Intronic
1003573633 6:7272749-7272771 AGATGCTCTCAGATAGAGAACGG + Intronic
1003573635 6:7272827-7272849 AGATGCTCTCAGATAGAGAACGG + Intronic
1003573637 6:7272868-7272890 AGATGCTCTCAGATAGAGAACGG + Intronic
1003573639 6:7272909-7272931 AGATGCTCTCAGATAGAGAACGG + Intronic
1003573641 6:7272950-7272972 AGATGCTCTCAGGTAGAGAACGG + Intronic
1003573644 6:7272991-7273013 AGATGCTCTCAGGTAGAGAACGG + Intronic
1003573646 6:7273032-7273054 AGATGCTCTCAGGTAGAGAACGG + Intronic
1003573648 6:7273073-7273095 AGATGCTCTCAGGTAGAGAACGG + Intronic
1003573650 6:7273114-7273136 AGATGCTCTCAGGTAGAGAACGG + Intronic
1003573653 6:7273192-7273214 AGATGCTCTCAGGTAGAGAATGG + Intronic
1003573654 6:7273233-7273255 AGATGCTCTCAGATAGAGAACGG + Intronic
1003573655 6:7273274-7273296 AGATGCTCTCAGATAGAGAACGG + Intronic
1003573656 6:7273315-7273337 AGATGCTCTCAGATAGAGAACGG + Intronic
1003573657 6:7273356-7273378 AGATGCTCTCAGATAGAGAACGG + Intronic
1003573661 6:7273471-7273493 AGATGCTCTCAGGTAGAGAATGG + Intronic
1003573662 6:7273512-7273534 AGATGCTCTCAGATAGAGAACGG + Intronic
1003573664 6:7273553-7273575 AGATGCTCTCAGATAGAGAACGG + Intronic
1003573665 6:7273594-7273616 AGATGCTCTCAGATAGAGAACGG + Intronic
1003573668 6:7273672-7273694 AAATGCTCTCAGATAGAGAACGG + Intronic
1008589717 6:52981917-52981939 TGGAATTCTCAGAAGGAGAATGG + Intronic
1008960200 6:57258725-57258747 AGATAATATCAGATGGAACAGGG - Intergenic
1009825334 6:68859215-68859237 AGGTGGTCTCAGATGGAGATGGG - Intronic
1010760553 6:79717595-79717617 AGATTTTCACAGAAGGAAAACGG + Intergenic
1010819347 6:80395391-80395413 AGGTGATGTCAGATGGAGAAGGG + Intergenic
1010913370 6:81586388-81586410 AGGTGGTCTCAGATGGAGATGGG - Intronic
1011164408 6:84430305-84430327 AAACAGTCTCACATGGAGAAAGG - Intergenic
1011559023 6:88596566-88596588 AGAAAATGTCAGCTGGAGAATGG - Intergenic
1011659408 6:89581500-89581522 AGATGAGCTCAGATGGTGAAGGG - Intronic
1011870383 6:91885703-91885725 AGGTGGTCTCAGATGGAGATGGG + Intergenic
1012745238 6:103078665-103078687 AGATGGTCTCAGATGGAGATAGG - Intergenic
1013616212 6:111845655-111845677 AGTCATTCTCAGATGATGAAGGG + Intronic
1014301477 6:119687464-119687486 AGATATTTTCAGATCTTGAATGG - Intergenic
1014665278 6:124230114-124230136 AGATGATCTCAGATGGAGATGGG + Intronic
1016615037 6:146037950-146037972 AGAGTTGCTCAGATGCAGAAGGG - Intronic
1018928576 6:168224080-168224102 TGATAATCTCAGAAGCAGAAGGG + Intergenic
1020505292 7:8979297-8979319 AGATAGACAAAGATGGAGAATGG + Intergenic
1021351047 7:19595033-19595055 AGATATGGTCATTTGGAGAAAGG + Intergenic
1021900896 7:25284388-25284410 AGTGATTCTTAGATGTAGAAAGG - Intergenic
1023296322 7:38718453-38718475 AAGTGTTCTCAGATGCAGAATGG + Intergenic
1023300890 7:38769837-38769859 AAAGATTCTCTGATGGAGATGGG - Intronic
1023946520 7:44807233-44807255 AGATTTTCTGAGGTGGAGAAAGG - Intronic
1024039070 7:45535511-45535533 AGACTTTCTCAGGTGGAGAGTGG + Intergenic
1024262533 7:47582744-47582766 AGAGATTCTCAGAGGAGGAAAGG + Intergenic
1025595301 7:62915971-62915993 AAATATTCTCAGATAGAAACTGG + Intergenic
1026501705 7:70948274-70948296 AGATGTCCTCACATGGAGGAAGG - Intergenic
1027277372 7:76572301-76572323 AGGTTTACTCAGAGGGAGAAAGG + Intergenic
1028668435 7:93373060-93373082 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1030887477 7:114956019-114956041 AGTGATTCTCAAATGGAGAGTGG + Intronic
1030906784 7:115194928-115194950 AGATATTTTCAGATATAGAGGGG + Intergenic
1031608160 7:123794066-123794088 AGGTGGTCTCAGATGGAGATGGG + Intergenic
1031749490 7:125554502-125554524 TTATATCCTCACATGGAGAAGGG - Intergenic
1032691434 7:134291120-134291142 AGAGATTCTCAAATAGAGAAGGG + Exonic
1032887949 7:136162669-136162691 AGAGATTCTCATAAGGAGTAAGG + Intergenic
1033305963 7:140225937-140225959 AGATATGCACACAGGGAGAATGG - Intergenic
1034507888 7:151509522-151509544 AGATTTCCTTAGAGGGAGAATGG - Intronic
1036086280 8:5616606-5616628 TGGTATTCCCACATGGAGAAGGG - Intergenic
1036612152 8:10359701-10359723 GGATGGTCTCAGATGGAGGATGG + Intronic
1036612160 8:10359752-10359774 GGATGGTCTCAGATGGAGGACGG + Intronic
1036761413 8:11511613-11511635 AGAGATTCCCAGAGGAAGAAAGG - Intronic
1037288871 8:17329931-17329953 AGATGTTTTCAGATGTAGGAAGG + Intronic
1037660345 8:20920759-20920781 GGGTAGTCTCAGATGGAGATGGG - Intergenic
1042463114 8:69094133-69094155 AGATTGTCTGAGGTGGAGAAAGG - Intergenic
1043581944 8:81724566-81724588 AGATATACTCATATCCAGAAAGG - Intronic
1044103418 8:88170659-88170681 AGATAATTTCAGATGGTGAGGGG + Intronic
1045039353 8:98206883-98206905 AGACATCTTAAGATGGAGAAAGG - Intronic
1045082331 8:98640544-98640566 AGATATTTTCATAAGAAGAATGG - Intronic
1045888611 8:107127967-107127989 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1046354583 8:113064832-113064854 AGATATTTTCAGAGACAGAATGG - Intronic
1046607512 8:116388203-116388225 AGGTGGTCTCAGATGGAGATGGG + Intergenic
1047060542 8:121219982-121220004 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1047513115 8:125530537-125530559 AAATGTTCTCAGATGGATCATGG - Intergenic
1047929728 8:129714700-129714722 AGACATTCTCAGATGAAAGATGG + Intergenic
1048220818 8:132540120-132540142 AGATTTACTCTGTTGGAGAAAGG - Intergenic
1049780773 8:144427892-144427914 AGATAAACTCAGACGGAGAGGGG + Intronic
1050976910 9:11950192-11950214 AGGTAGTCTCAGATGGAGATGGG - Intergenic
1051956373 9:22700229-22700251 AGAGAAAGTCAGATGGAGAATGG - Intergenic
1052780815 9:32780940-32780962 AAATATTCTCAGTTGGCAAATGG + Intergenic
1053622396 9:39833077-39833099 AGGTGGTCTCAGATGGAGATGGG + Intergenic
1053882742 9:42612103-42612125 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1053889927 9:42682199-42682221 AGGTGGTCTCAGATGGAGATGGG + Intergenic
1054221769 9:62419571-62419593 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1054228945 9:62489602-62489624 AGGTGGTCTCAGATGGAGATGGG + Intergenic
1055727915 9:79251237-79251259 AGATTTCCTGAGAAGGAGAAAGG - Intergenic
1056119612 9:83474359-83474381 TGATGTTATCAGATGTAGAATGG - Intronic
1058221579 9:102309978-102310000 AGAGCCTCTCAGATGGAGATGGG + Intergenic
1058428398 9:104896550-104896572 AGATATTCTGAGAGGCAAAAAGG + Intronic
1058560778 9:106226708-106226730 AGAAATTGTGAGATGTAGAAAGG + Intergenic
1059628231 9:116091080-116091102 AGGTGGTCTCAGATGGAGATGGG + Intergenic
1059894788 9:118850503-118850525 AGATATTCTTAGTAGGTGAATGG + Intergenic
1060008132 9:120018537-120018559 AGGTGAGCTCAGATGGAGAATGG + Intergenic
1060306886 9:122421727-122421749 AAGATTTCTCAGATGGAGAATGG - Intergenic
1061176185 9:128998782-128998804 GGATATCCTGAGATGGAGCAGGG + Intronic
1061454510 9:130687677-130687699 AGATGTTCAAAGATGGGGAAGGG - Intergenic
1062617073 9:137402508-137402530 AGATGGTCTCAAATGGAGATGGG - Intronic
1203424800 Un_GL000195v1:27979-28001 AGAAAGTCTCAAATGGAGAGAGG - Intergenic
1186094245 X:6082687-6082709 GGATCTTCCCAGATGGAGAGTGG + Intronic
1186311542 X:8324715-8324737 ATGTAGTCTCAGCTGGAGAATGG + Intergenic
1186890728 X:13956933-13956955 AGATTTTATCAGAAGGAAAAAGG + Intergenic
1187245468 X:17549712-17549734 TGATCTTCTCAGAGGTAGAAGGG + Intronic
1187568715 X:20478572-20478594 AGATATTCCCAAGTAGAGAATGG - Intergenic
1192373080 X:70531835-70531857 AGATATTCAGAGAAAGAGAAGGG + Intronic
1192934983 X:75849914-75849936 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1193222811 X:78946677-78946699 AGATATACTGAGGTGGAAAATGG + Intronic
1193316610 X:80072267-80072289 AGGTGGTCTCAGATGGAGATAGG - Intergenic
1193492977 X:82172185-82172207 AGATATTCTCAGCTAAACAAAGG + Intergenic
1193651431 X:84139206-84139228 AGATAGTCCCACATCGAGAATGG + Intronic
1193752734 X:85366196-85366218 AGGTATTCTCTTATGGAGAGGGG + Intronic
1194778279 X:97992029-97992051 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1194927242 X:99839982-99840004 AGGTATCCTCACATGGAGGAAGG - Intergenic
1194952566 X:100144620-100144642 AGGTGGTCTCAGATGGAGATGGG + Intergenic
1195111539 X:101655857-101655879 AGATAATCTCAAATAGAGTAAGG + Exonic
1195451837 X:105022819-105022841 AGATTTTCTCTTGTGGAGAATGG + Intronic
1196093789 X:111776569-111776591 AGATATTCTCAGATGGAGAAAGG - Exonic
1196504348 X:116423894-116423916 AGATATCCTCAGATAGAATAAGG + Intergenic
1196582903 X:117396287-117396309 AGGTAGTCTCAGATGGAGATGGG - Intergenic
1198177390 X:134170586-134170608 AAATTTTCTTAGATGGAGAGGGG - Intergenic
1198442694 X:136679346-136679368 ACATATTTGCAGATGGACAATGG + Intronic
1198693226 X:139307099-139307121 AGGTGGTCTCAGATGGAGATAGG + Intergenic
1198991629 X:142521147-142521169 AGGTGGTCTCAGATGGAGATGGG - Intergenic
1199078525 X:143550992-143551014 AGGTAGTCTCAGATGGAGATGGG + Intergenic
1199127434 X:144139401-144139423 AGGTGATCTCAGATGGAGATGGG - Intergenic
1199373691 X:147082787-147082809 AGGTAGTCTCAGGTGGAGATGGG + Intergenic
1201177340 Y:11316837-11316859 AGAATTTCACAGATGGACAAGGG - Intergenic