ID: 1196097083

View in Genome Browser
Species Human (GRCh38)
Location X:111811869-111811891
Sequence TTGCTGTTCTGGGCCATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196097083_1196097086 -9 Left 1196097083 X:111811869-111811891 CCTTTGATGGCCCAGAACAGCAA 0: 1
1: 0
2: 0
3: 5
4: 131
Right 1196097086 X:111811883-111811905 GAACAGCAATCTCTCATCCTTGG 0: 1
1: 0
2: 1
3: 9
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196097083 Original CRISPR TTGCTGTTCTGGGCCATCAA AGG (reversed) Intronic
902656657 1:17873728-17873750 TTGCTTTTCTGGCCCATCTCTGG - Intergenic
902656873 1:17875112-17875134 TTGCTTTTCTGGCCCATCCCTGG - Intergenic
909937189 1:81565725-81565747 GTGCTTTTCTGGTCCATCAGGGG - Intronic
910099922 1:83564718-83564740 TAGCTGAGCAGGGCCATCAATGG + Intergenic
910267416 1:85352363-85352385 TTCCAGTTCAGGGTCATCAAGGG - Intronic
910302381 1:85721032-85721054 TTGGTGTTCAGGGGCAACAAGGG + Intergenic
910599387 1:89014520-89014542 GTGCTGTTCTGGGTCACAAAAGG + Intronic
910603701 1:89059290-89059312 GTGCTGTTCTGGGTCACAAAAGG + Intronic
912417415 1:109519283-109519305 GTGCTCTTCTGGGCCTTTAAAGG + Intergenic
914445600 1:147748043-147748065 TTGATGTTCTGTCCCATCACAGG - Intergenic
917964016 1:180167188-180167210 TTGCTGCCCTGGGCTATCCAGGG - Intronic
918140629 1:181716715-181716737 TTGCTGTTTTGTGCCACCAGTGG + Intronic
919090342 1:192971325-192971347 TTTCTGTCCTGAGCCAGCAAGGG + Intergenic
923751945 1:236754494-236754516 TGGCTGTTCTTGGTGATCAAAGG - Intronic
1066347139 10:34598925-34598947 GTGCAGTTCTGGACCATCAAGGG - Intronic
1071676042 10:87657332-87657354 TTGGTGATCTGTGACATCAAAGG + Intergenic
1071949206 10:90683662-90683684 TTTCTTTTTTGGGTCATCAAGGG - Intergenic
1074091316 10:110260253-110260275 TTGCTTTTCTTGGCTATTAAAGG + Intronic
1076256498 10:129030399-129030421 TTGATGATCTGGACCATCTACGG - Intergenic
1076733140 10:132448071-132448093 TGGCGGCTCTGGGCCCTCAAGGG + Exonic
1077752061 11:4983205-4983227 GTGCTGTACTGGGGCATCGATGG + Intronic
1080247534 11:30196505-30196527 TAACTGTTCTGGGCCATCTGAGG - Intergenic
1080357001 11:31460696-31460718 TCAGTGTTCTGGACCATCAATGG - Exonic
1080400618 11:31931926-31931948 TTGCTCTTCTGGGCCAGTGAAGG - Intronic
1080403946 11:31961973-31961995 TTGCTGTTTTGTGCAATCAAGGG + Intronic
1082180483 11:49111844-49111866 TTGCTCTTCTGGGCAATTAGTGG - Intergenic
1083020087 11:59497724-59497746 GTGCTGTTCTTGGCGATCAGAGG - Intergenic
1083686801 11:64381392-64381414 TTGCTGCTCTGGTCCCTCAGAGG - Intergenic
1084790459 11:71472540-71472562 TCGCTGTTCTCGGCCAACAGTGG + Intronic
1088072514 11:105807095-105807117 TTGTTGTTTTGAGCCATCCATGG - Intronic
1089776314 11:120839091-120839113 TTGGTGTTTTGGGCCATAGAGGG + Intronic
1090241113 11:125182540-125182562 GTGCTGTTTTGGGACTTCAATGG + Intronic
1093762232 12:22923406-22923428 TTCATGTTCTGAGCCACCAAGGG - Intergenic
1096392510 12:51240010-51240032 CTGCTGTTCTGGCTTATCAAGGG - Intronic
1096626366 12:52898559-52898581 CTGTTGTTCTGGGCCAAGAAGGG - Intronic
1098608667 12:72426977-72426999 TTAGTGTTCTGGGCCATCCGAGG - Intronic
1101522034 12:105492964-105492986 TTGCTGATTTGGGAGATCAAAGG + Intergenic
1102099969 12:110270595-110270617 TTTCTATTGTGGGACATCAAGGG + Intergenic
1103891434 12:124241863-124241885 TTGCCACTCTGGTCCATCAAGGG - Intronic
1105853253 13:24354415-24354437 TTGCTGTTCTTGGGGAGCAATGG - Intergenic
1106311550 13:28558963-28558985 TTGCTGGTCTGTGACACCAAAGG - Intergenic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1112812152 13:103231309-103231331 ATGCTGATCTGGCCCTTCAAAGG + Intergenic
1116622996 14:47229729-47229751 TTCCTGTTTTAGGCCATTAAAGG - Intronic
1121340322 14:93101115-93101137 GTTCTGTTCTGGGCCATGATTGG - Intronic
1122077359 14:99245136-99245158 CTGCTTTTCTGGGCCTTTAAGGG + Intronic
1123958626 15:25369028-25369050 TTGCAGTTCTGCTCCAACAATGG + Intronic
1126692856 15:51301289-51301311 TGGCTGTTCTTGCCCCTCAAAGG + Intronic
1127402827 15:58607499-58607521 TAGATGTTCTGGGCCTTCAATGG - Intronic
1129153418 15:73703168-73703190 TTGCTGTTCTGGGAGATTGAAGG - Intronic
1131621249 15:94070595-94070617 TTCCTGTTCTGAGCCATCGCCGG - Intergenic
1133123148 16:3624624-3624646 TTGCTGGTTTGGGCCACCACTGG - Intronic
1133448045 16:5879248-5879270 ATGCTGTGCTGGGCCAGCAGGGG + Intergenic
1145209745 17:21004318-21004340 TTGCTGTTGTTAACCATCAAGGG - Exonic
1147561743 17:41513541-41513563 TTGCTCTTCTGGGTCACCATGGG - Intergenic
1147684301 17:42277397-42277419 TTGCAGCTCTGGGCCATCTCTGG - Intergenic
1148216200 17:45835160-45835182 TTGCTGCCCTGGGGCATCATGGG + Exonic
1150828125 17:68494574-68494596 GTGCTGTGCTGGGACTTCAAGGG + Intergenic
1151043830 17:70895947-70895969 TTGCTGTTCTGGGCCAGGCTTGG - Intergenic
1151570036 17:74921498-74921520 GTGCTGTGCTGGGCCCCCAAGGG - Intronic
1151851449 17:76692588-76692610 TTGCTTTCCTGACCCATCAATGG - Intronic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1153014188 18:568622-568644 TTTCTGTTCTGGGGCATCTCAGG - Intergenic
1153433720 18:5046750-5046772 TTTCTTTTCTGGGGCTTCAATGG - Intergenic
1155680744 18:28482808-28482830 TGGCTGCCCTGGGCCATCCAGGG + Intergenic
1156297705 18:35807985-35808007 TTGCTGTGCTGGGACCTCCAGGG - Intergenic
1161316435 19:3619661-3619683 TTTCTGTTCTGGGCCTGCAGGGG + Intronic
1163593299 19:18206150-18206172 ATGCTGCTCTGGACAATCAAGGG - Intergenic
1165303179 19:34985638-34985660 ATGCTGTTCTTGGCCATCTGGGG - Intergenic
1168527688 19:57101915-57101937 TTGCTGTTCTGGGCCAGGCGCGG + Intergenic
927879198 2:26678767-26678789 CTCCTCTTCTGTGCCATCAAGGG + Intergenic
930666857 2:54107842-54107864 CTGCAGAACTGGGCCATCAAGGG + Intronic
931693329 2:64853556-64853578 GTTCTGTTCTGGGCAAACAAAGG - Intergenic
931780109 2:65572183-65572205 CTGAAGTTCTGGGCCATTAAGGG - Intergenic
932579872 2:72986144-72986166 TTTCTGTCGTGGGCCATTAATGG - Intronic
938761866 2:134433428-134433450 TTTCTGTTCTGGCTCTTCAAAGG + Intronic
939094685 2:137821211-137821233 TTGCTGTTTTGGACTCTCAATGG - Intergenic
939266916 2:139885922-139885944 TTGCTATTCAGGGCAATCCATGG + Intergenic
945298129 2:208191090-208191112 TTGTTCTTCTGGCCCATCTACGG + Intergenic
945958769 2:216110198-216110220 TTACTGATCTGGGACACCAATGG - Intronic
1174724501 20:52847137-52847159 GTGATGTTCTGGGGCATGAATGG - Intergenic
1175321321 20:58090379-58090401 TTGCTGCACTGGGCCATCCTTGG + Intergenic
1175805581 20:61826736-61826758 ATGCTATCCTAGGCCATCAACGG - Intronic
1180920119 22:19517264-19517286 TTGGTGTCCTGGGTCATCACGGG - Intronic
949943973 3:9175709-9175731 TTTCTGTTCTAGACCATCAACGG + Intronic
950005321 3:9687676-9687698 TGGGTGTTCTGGTCCATAAATGG - Intronic
953805950 3:46067353-46067375 TGGATATTCTGGGCCATCAGGGG + Intergenic
959728511 3:109573470-109573492 TTGCTTTTCTGTGCCACCAATGG + Intergenic
960350499 3:116587137-116587159 TTGCTGTTGTGGGCCTTTAGGGG - Intronic
961177720 3:124849501-124849523 TTGATGTTTTGGGACATCACAGG + Intronic
961790656 3:129374219-129374241 TTGCTGTTGTGTGCCATGCATGG - Intergenic
962679723 3:137785679-137785701 TGGCTGTTCTGGAAGATCAAAGG - Intergenic
965203057 3:165685432-165685454 TTGCTTTACTGGGCAATCACTGG + Intergenic
967377931 3:188826519-188826541 TTGCTACTCTAGGCCATCCATGG + Intronic
968189955 3:196660439-196660461 TTGCTGTACTGGGGCAGCAGCGG - Exonic
969052068 4:4380147-4380169 TCGCTGTTCTGATCCACCAATGG - Intronic
969462305 4:7335322-7335344 TTTCTGTTCTGGGCCCTCCCTGG + Intronic
972918040 4:43904532-43904554 TTGCAGTTCTCAGCCAGCAAGGG - Intergenic
976911449 4:90312201-90312223 TTGCTGCTCTGGTACATCACTGG - Intronic
980973986 4:139593147-139593169 TTGCTGTTCTGAGGCAGCTATGG + Intronic
981593047 4:146386578-146386600 CTGCTATTCTGGCCCTTCAAAGG + Intronic
982581315 4:157182445-157182467 TTTCTGTTATGTGTCATCAATGG - Intergenic
983298977 4:165901767-165901789 GTGCTGTTCTGGGAGATCCATGG + Intronic
985574903 5:669495-669517 TGTCTGTCCTGGGCCGTCAAAGG + Intronic
985849278 5:2376706-2376728 TGGCTGTTCTTGGGCACCAAGGG - Intergenic
997894344 5:137702823-137702845 TTGCTCTTCTGGGCCCTCCGTGG - Intronic
999904507 5:156124898-156124920 TTTCTGTTCTGGGAAACCAAAGG + Intronic
1000534755 5:162466183-162466205 ATTCTGTTCTGCTCCATCAAGGG - Intergenic
1001604559 5:172950703-172950725 TTGCAGATCTGTGCCATCATTGG + Exonic
1002569287 5:180130861-180130883 TTGCTGTGCTGGGCAAACAGAGG - Intronic
1003014100 6:2454128-2454150 TTGATGTGCTGGGACACCAAGGG + Intergenic
1003523540 6:6879563-6879585 TTTGTGTTCTGGGACATTAATGG + Intergenic
1005589902 6:27312391-27312413 TTGCTGTTCTGAGACCTCAGCGG + Intergenic
1007947757 6:45841208-45841230 TTGCTGTCCTGGGGCAGTAATGG + Intergenic
1015455652 6:133424266-133424288 TGCCTCTTCTGGGCCACCAATGG - Intronic
1024054407 7:45650724-45650746 TTGAGGTTCTGGGCCTTAAAGGG + Intronic
1025758267 7:64366678-64366700 TTGCTGGTCTAGGACCTCAATGG - Intergenic
1029532061 7:101132036-101132058 TTGTTGGTCTGAGCCATCATGGG - Exonic
1032773883 7:135090280-135090302 TTGCTCTGCTGGGCCCTCTAGGG - Intronic
1032795880 7:135275945-135275967 TTGCTGTTCTGCACCCTCACTGG - Intergenic
1042483588 8:69328865-69328887 GTGCTGTCCTGGTCCATCGAGGG - Intergenic
1043366017 8:79534284-79534306 TTGCATTTCTGGGCGATCAGTGG + Intergenic
1045132724 8:99174879-99174901 TTGCTGTACTGAGCCTTGAAAGG + Intronic
1045845737 8:106633790-106633812 TTGCTGTTTTGGGTCATCCTAGG + Intronic
1047239300 8:123072063-123072085 TTGCTTTTCTGGACCATGATTGG + Intronic
1053239058 9:36481690-36481712 ATGCTGTTCTGGGGGCTCAAGGG - Intronic
1056578371 9:87872598-87872620 TGGCTGAGCTGGGCCATCATGGG + Intergenic
1185937961 X:4280442-4280464 TTGCTCTTTTGGGCCGTAAAGGG - Intergenic
1186900148 X:14045788-14045810 TTTCTGTTCTGGGGCATTTATGG + Intergenic
1188546488 X:31313270-31313292 TTGCTGCTTTGGGCAATAAAGGG - Intronic
1189181238 X:39006541-39006563 TTGCTGTCTTGTGCTATCAATGG - Intergenic
1194244534 X:91494520-91494542 TTCTTCTTCTGGGCCATCCAAGG + Intergenic
1196097083 X:111811869-111811891 TTGCTGTTCTGGGCCATCAAAGG - Intronic
1199162471 X:144629048-144629070 TTTCTGTTCTGAGCCACCTAAGG - Intergenic
1200096577 X:153667402-153667424 CTGCTGTTCTGGGCCACACAGGG - Intergenic
1200867749 Y:8063241-8063263 TGCCTGTTCTGTGCCCTCAAAGG + Intergenic
1201952141 Y:19577235-19577257 TTGCTTGTGTGGGCCATCATAGG - Intergenic