ID: 1196098778

View in Genome Browser
Species Human (GRCh38)
Location X:111827312-111827334
Sequence TTTAGATACTATGCGTATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 59}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196098776_1196098778 5 Left 1196098776 X:111827284-111827306 CCTTAGTGATCTCATCTAGTTCC 0: 1
1: 0
2: 11
3: 47
4: 264
Right 1196098778 X:111827312-111827334 TTTAGATACTATGCGTATGCTGG 0: 1
1: 0
2: 0
3: 2
4: 59
1196098775_1196098778 16 Left 1196098775 X:111827273-111827295 CCACACTCACTCCTTAGTGATCT 0: 1
1: 0
2: 2
3: 19
4: 203
Right 1196098778 X:111827312-111827334 TTTAGATACTATGCGTATGCTGG 0: 1
1: 0
2: 0
3: 2
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196098778 Original CRISPR TTTAGATACTATGCGTATGC TGG Intronic
901243766 1:7711950-7711972 TATAGATACTCTGCATTTGCAGG + Intronic
910046455 1:82923498-82923520 TTTACATAGTATTCGTAAGCAGG + Intergenic
912175302 1:107148390-107148412 TTAAGATATTGTGCGTATTCAGG - Exonic
912610221 1:111034879-111034901 TTTAGATACAATGGGGATACAGG - Intergenic
917021762 1:170596421-170596443 TATATTTACTATGCATATGCAGG + Intergenic
1068973291 10:62981596-62981618 TTCAGATACCATGCGTTTCCAGG + Intergenic
1087493758 11:98863522-98863544 TCTAGATACAATGGGTATACAGG + Intergenic
1099097066 12:78387936-78387958 TCTAGATCCTATTCATATGCTGG + Intergenic
1108722018 13:53141898-53141920 TTTAGGTACTATATGTGTGCTGG + Intergenic
1113164106 13:107418203-107418225 TTTGGAGACTATCCCTATGCAGG + Intronic
1113181302 13:107630652-107630674 TTTAGATATTTTGCATATACAGG + Intronic
1119096967 14:71842063-71842085 TTTAAATACTATTGGTATGTTGG - Intergenic
1121927274 14:97939377-97939399 TTTATAAACTTTGCTTATGCTGG + Intronic
1122166013 14:99824409-99824431 TGTACATAGTATGTGTATGCAGG - Intronic
1123985422 15:25642063-25642085 TGTAGAAACTATGCTTATCCTGG + Intergenic
1126339336 15:47622167-47622189 TTTTGAATCTATGCATATGCAGG + Intronic
1131192384 15:90326842-90326864 TGTAGTTGCTATGCGTATGGTGG - Intergenic
1132184920 15:99796060-99796082 TGTTGATACTGTGCGAATGCTGG + Intergenic
1140951130 16:79818470-79818492 TTTAGATACTACACATATGCTGG - Intergenic
1141160618 16:81627253-81627275 TGGGGATACTATGAGTATGCTGG + Intronic
1143401706 17:6649982-6650004 TTTAGATACTTGGCATATTCTGG + Exonic
1154050315 18:10949677-10949699 CTTAGATACTCTGCATAAGCTGG - Intronic
1159805759 18:72957006-72957028 TTTAGATACAATGGGTGTACAGG + Intergenic
925422313 2:3722965-3722987 TTTTGTTACCATGAGTATGCAGG + Intronic
926940957 2:18136285-18136307 TCTAGATACTATGCTTGTCCCGG + Intronic
931347881 2:61463103-61463125 TTTAGATACTATGAGTATATAGG - Intronic
932169804 2:69543700-69543722 TTAAGATACTATCCATAGGCCGG - Intronic
935392979 2:102572791-102572813 TTTTGATACTAAGCTTATACTGG + Intergenic
936281730 2:111147139-111147161 TTTAGAGACTAGGCTTATACTGG - Intronic
939695649 2:145320645-145320667 TGTAGATTCTTTGCGTATTCTGG - Intergenic
940618894 2:156085293-156085315 TTTAGATCCTATGAGTACACTGG + Intergenic
941759883 2:169230431-169230453 TTTAGATATTATGCAGATGTAGG - Intronic
1170445404 20:16422032-16422054 TTTAAATAATATGCCTATTCTGG - Intronic
1172284322 20:33730599-33730621 TTTAATTACAATGTGTATGCCGG - Intergenic
1175439337 20:58979943-58979965 TTTAGATTCGGTGCGTGTGCAGG - Intergenic
1178331351 21:31696171-31696193 TTTTGATGCTGTGTGTATGCTGG + Exonic
1178791314 21:35702882-35702904 TTTAAATAATATGCCTCTGCCGG - Intronic
957118395 3:76057178-76057200 ATCTGATACTAGGCGTATGCGGG + Intronic
980426245 4:132630999-132631021 TTTAGATACAATGGGGGTGCAGG - Intergenic
982948805 4:161663354-161663376 TCTAGATACAATGTGGATGCAGG + Intronic
986039708 5:3980624-3980646 TTTCAATACTATGAGTATACAGG - Intergenic
997345575 5:133189529-133189551 TTTAGATACTAGGCCTTTGTTGG + Intergenic
998918132 5:147038637-147038659 TTTGGATACTTTCCCTATGCTGG + Intronic
999111162 5:149122502-149122524 TTTAGATAGTATTTGTATGGTGG - Intergenic
999295296 5:150455852-150455874 TTTAAATACCATCTGTATGCTGG - Intergenic
1000097022 5:157980269-157980291 TCTTGATACTATGGGTCTGCTGG - Intergenic
1016464171 6:144309272-144309294 TTTAAATACTATCTGAATGCTGG + Intronic
1017505363 6:155064043-155064065 TTTACATATGATGCATATGCTGG - Intronic
1036970531 8:13349859-13349881 TTTAGATATTATGGGTTTGGAGG + Intronic
1037137026 8:15474887-15474909 TTTAAATACTATGATAATGCTGG - Intronic
1048668272 8:136689033-136689055 CTTAGATACAATGGGTATACAGG + Intergenic
1059873328 9:118602571-118602593 TCTGGATCCTATGCCTATGCTGG + Intergenic
1061736716 9:132665988-132666010 TTTAGAAAACATGTGTATGCTGG + Intronic
1186201603 X:7160643-7160665 GTTAGATACGATGTCTATGCGGG + Intergenic
1193439859 X:81526573-81526595 TTTTGATACTAAGCTGATGCTGG + Intergenic
1194145595 X:90257956-90257978 TTTAGATACTAGTCCTTTGCTGG - Intergenic
1194455663 X:94099845-94099867 GTCAGATACTATGCTAATGCTGG - Intergenic
1196098778 X:111827312-111827334 TTTAGATACTATGCGTATGCTGG + Intronic
1197781073 X:130161021-130161043 TTTAGCTACTATTCTAATGCTGG - Intronic
1198259031 X:134950119-134950141 TTTAGATATTATTCTCATGCAGG - Intergenic
1200342186 X:155409328-155409350 TTTAGATACAATGGGTGTACAGG - Intergenic
1200491348 Y:3827255-3827277 TTTAGATACTAGTCCTTTGCTGG - Intergenic