ID: 1196101722

View in Genome Browser
Species Human (GRCh38)
Location X:111853858-111853880
Sequence CAGGAGAAGCATAAAGAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 675
Summary {0: 1, 1: 0, 2: 2, 3: 62, 4: 610}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196101716_1196101722 18 Left 1196101716 X:111853817-111853839 CCCTGTACATGAAGGTCTGTCCT 0: 1
1: 0
2: 0
3: 7
4: 127
Right 1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG 0: 1
1: 0
2: 2
3: 62
4: 610
1196101715_1196101722 19 Left 1196101715 X:111853816-111853838 CCCCTGTACATGAAGGTCTGTCC 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG 0: 1
1: 0
2: 2
3: 62
4: 610
1196101718_1196101722 -2 Left 1196101718 X:111853837-111853859 CCTGACAATGTGCTGAGAAGCCA 0: 1
1: 0
2: 0
3: 13
4: 189
Right 1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG 0: 1
1: 0
2: 2
3: 62
4: 610
1196101717_1196101722 17 Left 1196101717 X:111853818-111853840 CCTGTACATGAAGGTCTGTCCTG 0: 1
1: 0
2: 4
3: 7
4: 87
Right 1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG 0: 1
1: 0
2: 2
3: 62
4: 610

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196101722 Original CRISPR CAGGAGAAGCATAAAGAGGA AGG Exonic
900552692 1:3264584-3264606 CAGGAGGAGCGGAAAGGGGAGGG + Intronic
900721083 1:4176183-4176205 CAGGAGAAGAATAGAGAGGGAGG - Intergenic
900850011 1:5135401-5135423 CAGGAGGTGAATAATGAGGAGGG - Intergenic
901447913 1:9319418-9319440 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
901824500 1:11851897-11851919 CAGGAGAATCATGAAGGGCAGGG + Intergenic
903463553 1:23536067-23536089 TAGGAAAAGCACAAAGAAGATGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904801501 1:33096258-33096280 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
907376949 1:54052257-54052279 GGGGGGAAGCATAGAGAGGAGGG + Intronic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
907857812 1:58321247-58321269 CTGCTGCAGCATAAAGAGGAAGG - Intronic
908390591 1:63679951-63679973 GAGGAGAAGCAAAAAGAGAAGGG - Intergenic
909336405 1:74480110-74480132 CAAGAGAAGAGAAAAGAGGAGGG + Intronic
909837713 1:80277360-80277382 CAGAAGAAGCAAAGAGAGGTGGG - Intergenic
910479350 1:87641462-87641484 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
910484787 1:87701244-87701266 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
911766195 1:101678003-101678025 AAGGAGCAGCATAAAGAAAATGG + Intergenic
911991280 1:104699738-104699760 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
912017708 1:105062023-105062045 CAGGAGAAAAATAAAGTGGTGGG + Intergenic
912194228 1:107378634-107378656 CAGGAGAAGAATGTCGAGGAAGG + Intronic
912421138 1:109543156-109543178 CAGCAGGAGCATGAAGAAGAGGG - Exonic
913182407 1:116334876-116334898 CAGCATAAGAATGAAGAGGAGGG + Intergenic
913338663 1:117734288-117734310 CAGGAGAGGCAGAAAGACAAAGG - Intergenic
913610215 1:120503506-120503528 CTGGAGAAGCAAACAGAAGAAGG - Intergenic
913688639 1:121257518-121257540 CAGGACAGGCAGAAAGATGATGG - Intronic
913984585 1:143553333-143553355 CTGGAGAAGCAAATAGAAGAAGG + Intergenic
914148960 1:145022758-145022780 CAGGACAGGCAGAAAGATGATGG + Intronic
914580975 1:149018733-149018755 CTGGAGAAGCAAACAGAAGAAGG + Intronic
914929890 1:151921619-151921641 CAGAAGAAAGATAAAGAGGCAGG + Intergenic
915054920 1:153119383-153119405 CAGGAGAACCAGAAAGACCACGG + Intergenic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915480455 1:156181021-156181043 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
915515714 1:156411321-156411343 CAGCAGAAGCACAATGCGGAGGG + Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916242913 1:162657796-162657818 GAGGAGAAGGGAAAAGAGGAAGG - Intronic
917335907 1:173924167-173924189 CAGGAGAAGCATAGTGGAGAGGG - Intergenic
918953574 1:191174388-191174410 GAGGAGGAGAACAAAGAGGAGGG + Intergenic
920189222 1:204181775-204181797 AAGGAGAAGAGAAAAGAGGAAGG - Intergenic
920457871 1:206114878-206114900 CAGAAGCAGGATAAAGAGGAGGG + Intronic
920475963 1:206276019-206276041 CAGGACAGGCAGAAAGATGATGG - Intronic
921092934 1:211860264-211860286 GAGGGGAAGACTAAAGAGGATGG + Intergenic
921841685 1:219835333-219835355 CAGGTCAAGCTGAAAGAGGATGG - Intronic
923037214 1:230292638-230292660 CAAGAGAAGGAGAGAGAGGAAGG - Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923143471 1:231181263-231181285 CAGGAGAAGTCTTAAGAGCAAGG + Intronic
923316146 1:232781981-232782003 CAGGAGAACCAAAAACAGAAAGG + Intergenic
923355137 1:233147463-233147485 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
923754407 1:236777558-236777580 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
924139430 1:241006805-241006827 GAGGAGGAGGATGAAGAGGAGGG - Intronic
924258561 1:242206744-242206766 CAGGAGGAGGAGGAAGAGGATGG + Intronic
924838561 1:247681538-247681560 CAGGAGAAGCAAACAGGGAAGGG - Intergenic
924927675 1:248699012-248699034 CAGGAAAAGAACAAAGAAGATGG - Intergenic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1063011017 10:2021515-2021537 CTGGAGAAGCACACAGAGGGAGG - Intergenic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066547481 10:36516479-36516501 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067799600 10:49349923-49349945 GAGGTGGAGCAGAAAGAGGAAGG + Intergenic
1069116796 10:64517098-64517120 CAGGAGCAACATAAAGATGCTGG + Intergenic
1069369702 10:67734127-67734149 CAGGAAAAGAGAAAAGAGGAAGG - Intergenic
1069718521 10:70535600-70535622 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1070245372 10:74726243-74726265 CAATAAAAGCATAAAGAGGGAGG + Intergenic
1070377647 10:75849181-75849203 CAGGAGAAGCAAGAATAAGAAGG - Intronic
1070607497 10:77909228-77909250 CATGAGAAGCCTGAAGATGAGGG + Intronic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1070906335 10:80076762-80076784 GAGGAGAAGAATAAAGAGGGTGG + Intergenic
1071777572 10:88806341-88806363 CAGGAGGAGCAAAATGAGCAGGG - Intronic
1072022734 10:91419845-91419867 CAGGAGAACACTAAAGATGATGG - Intronic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1073305381 10:102499740-102499762 CAGAAGAAGCACAAAGAGCCTGG + Intronic
1073586018 10:104710850-104710872 CATGTGAAGCATGAGGAGGAGGG + Intronic
1073811105 10:107152849-107152871 CAGGAGAATCATAAAAAGAGAGG - Intronic
1074570858 10:114622749-114622771 GAGGAGAAGGAAGAAGAGGAGGG - Intronic
1074745344 10:116527022-116527044 CAGGAAAAGCATACAGAATAAGG - Intergenic
1075291978 10:121238489-121238511 AAGGAGAAGCATAAAGGAGATGG - Intergenic
1076150892 10:128161252-128161274 CTGCAGAAGAGTAAAGAGGAAGG - Intergenic
1076182785 10:128423467-128423489 CAGGAGAAGTATAAAGACGAAGG + Intergenic
1078048552 11:7940775-7940797 GAGAAAAAGCATAAGGAGGAAGG + Intergenic
1078571352 11:12460824-12460846 CAGGTGATGCATGAAGACGAAGG + Intronic
1079049702 11:17143319-17143341 CAGGTGAAAGATAAAGAGCATGG - Intronic
1079237259 11:18699475-18699497 CAGTAGTAGAATAAGGAGGATGG - Intronic
1079689243 11:23401747-23401769 TAGGAGAAGCAAAACTAGGATGG - Intergenic
1079788739 11:24709477-24709499 AAGGAGAAGCTAAAAGAGAAAGG + Intronic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1081174042 11:39903713-39903735 CAATAGAAGCTTAAAGATGAAGG + Intergenic
1082076426 11:47979614-47979636 CAGGAGAAGCCGCAAGAGAAAGG - Intergenic
1082708785 11:56527407-56527429 CAGGAACAGTACAAAGAGGATGG + Intergenic
1082775221 11:57239444-57239466 CAGGAGAAGAACCAAGAGGATGG + Intergenic
1083045318 11:59729249-59729271 CAGGAGAACCACAATGAGGTGGG - Intronic
1084101158 11:66950527-66950549 CAGGAGAAAGCTGAAGAGGAGGG + Intronic
1084491632 11:69481737-69481759 CAGGAGATCCCTACAGAGGAAGG + Intergenic
1084938859 11:72601663-72601685 CAGGAGACACAAGAAGAGGAAGG + Intronic
1085688498 11:78647200-78647222 CAGGAGAGGCTTCTAGAGGAAGG - Intergenic
1086078880 11:82882122-82882144 CAGGAGGAGGAGAAAGAGGAGGG + Intronic
1086294906 11:85354403-85354425 CATGAGAAGAACAAAGGGGAAGG + Intronic
1087058144 11:93953264-93953286 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1088737067 11:112736685-112736707 CAGGAGAAGCAAATAAAGAATGG + Intergenic
1089178156 11:116563095-116563117 CAGGAGAGGCATGGACAGGATGG - Intergenic
1089593768 11:119561554-119561576 GAGGGGAAGGAAAAAGAGGAAGG - Intergenic
1089629142 11:119773035-119773057 CAGGGGAAGTGGAAAGAGGAGGG - Intergenic
1089957058 11:122581288-122581310 CATCAGAAGCATAAAAAGAAGGG - Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090357884 11:126152220-126152242 CAGGAGAAGAATATAGAGAAAGG - Intergenic
1090401621 11:126452980-126453002 CAGGAGAGGCACGAAGAGGGTGG - Intronic
1090934151 11:131326931-131326953 GAGGAGAGGCATCAAGAGGATGG - Intergenic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091814140 12:3423527-3423549 CGTGAGAAGCATAGACAGGAAGG + Intronic
1092846905 12:12592037-12592059 CAGGAGAAGTAGAAAGTGGCTGG - Intergenic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1094872318 12:34605264-34605286 CAGGAGAAGCGTAAAGCGGCAGG + Intergenic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095215800 12:39545868-39545890 CCAAAGAAGCAGAAAGAGGAAGG + Intergenic
1095965637 12:47865158-47865180 CAGGCGAAGCATGAAGCGGAAGG - Exonic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096628568 12:52910705-52910727 CAGGAAAAGAACAAACAGGAAGG + Intronic
1096748646 12:53744893-53744915 CAGGGGAAGCAGAGAGAGAATGG - Intergenic
1097269534 12:57765661-57765683 CAGGAAATGAGTAAAGAGGAAGG - Intronic
1097458175 12:59826898-59826920 CAAGACAAGCATCAAGAGTAAGG - Intergenic
1097544447 12:60981540-60981562 CAGGAGTAGCATATGCAGGAAGG + Intergenic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1098012749 12:66071758-66071780 CAAGAGAAGCAAGAAGTGGAGGG - Intergenic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1098603188 12:72358288-72358310 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1099066166 12:77982692-77982714 CAGACGAGGCATAAAGAGAATGG + Intronic
1099643391 12:85319524-85319546 GAGGAGGAGGACAAAGAGGAGGG - Intergenic
1100093054 12:90995452-90995474 CAGAAGAAGCAGAAAAAGAATGG + Intronic
1101599435 12:106196207-106196229 CATGAGAAGGAAAAAGAGCATGG + Intergenic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102320187 12:111926575-111926597 CAGAAGAAGGATCAAGAGGGAGG - Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103163230 12:118748459-118748481 GAGGAGGAGAAGAAAGAGGAGGG + Intergenic
1103411673 12:120716630-120716652 CAGGAGGAGGATGAGGAGGAGGG + Exonic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1103851560 12:123936920-123936942 CAAGAGAAGCAGAAGGAGAATGG + Exonic
1105486259 13:20835840-20835862 CAGGAGGAGGAGGAAGAGGAGGG - Intronic
1105782053 13:23714352-23714374 CAGGAGAAGAAAAAAGAGGTTGG - Intergenic
1105967724 13:25399723-25399745 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1106242224 13:27921117-27921139 CAGGATAGGAGTAAAGAGGAAGG + Intronic
1106243061 13:27925387-27925409 GAGGAGGAGGAGAAAGAGGAGGG - Exonic
1106358477 13:29007614-29007636 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1106636558 13:31534847-31534869 CAAAAGAAACATAAGGAGGAAGG - Intergenic
1107242507 13:38253586-38253608 CAGAACAAGCATGAAGAGTAGGG - Intergenic
1107527292 13:41245884-41245906 CAGGACAGGGATAAAGAGGGAGG - Intronic
1107763149 13:43703297-43703319 CTGTAGAAACATAAAGAGTATGG + Intronic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1109344245 13:61095766-61095788 CAGAAGAAGCTGAAAGAGGCTGG - Intergenic
1109757119 13:66775529-66775551 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1110634570 13:77751667-77751689 CTGGAGAAGTATAAAGAGCCTGG + Intronic
1111073315 13:83199161-83199183 GAGGAGAAGGTTGAAGAGGAGGG - Intergenic
1112164729 13:96906148-96906170 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1112436471 13:99394382-99394404 CACGAGAAGCATCAACGGGAGGG - Intergenic
1112484791 13:99810554-99810576 CAGGATGAGCCTAGAGAGGAAGG + Intronic
1112542282 13:100326671-100326693 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1112884510 13:104152082-104152104 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1113163936 13:107416428-107416450 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1114257296 14:21014297-21014319 AAAGAGAAGGAAAAAGAGGAAGG + Intergenic
1115089731 14:29559354-29559376 CAGGAAGATCATAGAGAGGAGGG + Intergenic
1115113208 14:29849219-29849241 CAGGAGGAAAAGAAAGAGGAGGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115546010 14:34465324-34465346 CAGGAGAAGCTAATGGAGGAAGG + Intergenic
1115815567 14:37160957-37160979 GAGGAGGAGGAGAAAGAGGAAGG + Intronic
1116023795 14:39491937-39491959 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116486672 14:45458154-45458176 CCTGTGAAGCATAAAGGGGAAGG + Intergenic
1117123020 14:52589294-52589316 CAGGAGATGGATAAAGGTGATGG + Intronic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1118538336 14:66793327-66793349 CAGGGAAAGCACAAAGAAGATGG + Intronic
1118638460 14:67769745-67769767 CAGGAGGAGAAGAAAGAGGGAGG + Intronic
1118903445 14:70005443-70005465 CAGGAGAGGAAAAAAGAGGTTGG - Intronic
1119745083 14:77038303-77038325 TAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1120087322 14:80288057-80288079 CAAGAGAGGCCTTAAGAGGAAGG + Intronic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1121006379 14:90493207-90493229 GAGGAGGAGGAAAAAGAGGAGGG - Intergenic
1121144207 14:91569434-91569456 AAGGAGGAGGAAAAAGAGGAAGG - Intergenic
1121291240 14:92777281-92777303 CAGGAGAAACCTAGAGGGGAGGG - Intergenic
1121488159 14:94336347-94336369 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1121642359 14:95494322-95494344 CAGGAGAGGCTCATAGAGGAAGG + Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1123188995 14:106549998-106550020 CAGGAGAACAGCAAAGAGGAAGG - Intergenic
1123771854 15:23537079-23537101 CAGGTGAGACATAATGAGGAAGG - Intergenic
1124073348 15:26416218-26416240 CAGAAGGAGCAGAAAGAGAATGG + Intergenic
1124700826 15:31910269-31910291 CAGGAGCAGCATCCAGAGGAGGG + Intergenic
1124847813 15:33309389-33309411 CAGGAGAAGAAAAGAGTGGATGG + Intergenic
1125705955 15:41736425-41736447 CACGAGAAGAATAAACAGGAGGG - Exonic
1126079581 15:44946384-44946406 CAGCAGAAGGCTAAGGAGGAAGG + Intergenic
1126411806 15:48379948-48379970 GATCAGAAGCATAAGGAGGAGGG + Intergenic
1126966703 15:54062345-54062367 TAGGAGAATCACACAGAGGATGG - Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128377135 15:67085139-67085161 GAGGTGAAGCATTTAGAGGATGG + Intronic
1129484092 15:75852217-75852239 CAGGAAAGGCTTAAAAAGGAAGG - Intronic
1130571433 15:85048483-85048505 CAGAAAAAGCATAAACTGGAGGG - Intronic
1131031057 15:89186258-89186280 CAGGACAAGCATGAAGAATAAGG - Intronic
1131059923 15:89398308-89398330 CTGGAGAAGCGTAAGTAGGAGGG + Intergenic
1131419157 15:92289314-92289336 CATGAGTAGCATAAAAAGAAGGG - Intergenic
1131465720 15:92653694-92653716 CAGGAAAACTATACAGAGGAAGG + Intronic
1131625957 15:94120934-94120956 GAGGAGAAGGAAGAAGAGGAGGG - Intergenic
1131719045 15:95147212-95147234 CTGGAGAAGCCCAAAGAGTAGGG + Intergenic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133822173 16:9246554-9246576 CAGGAGAAGCTTAAAGATCAAGG - Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134398663 16:13889078-13889100 CCGGAGAAGGAGAAAGGGGAGGG - Intergenic
1134638648 16:15811601-15811623 CAGTAGAGGCAGAGAGAGGAAGG - Intronic
1134798416 16:17062516-17062538 CAGCAGAAACACAAAGAGAATGG - Intergenic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1136252440 16:29014704-29014726 CAGAAGCAGAATAAAGAGGTGGG - Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1138248800 16:55486933-55486955 TAGTAAAAGCATAAACAGGAAGG - Intronic
1138515145 16:57531795-57531817 CAGGAGAAGCCAGAACAGGAGGG - Intronic
1140042739 16:71419773-71419795 CAGGGTAAACATACAGAGGAAGG + Intergenic
1140139720 16:72244121-72244143 CAGAAGAAATAAAAAGAGGAAGG + Intergenic
1141007136 16:80363136-80363158 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141535267 16:84674942-84674964 GAGGAGAAGAAGGAAGAGGAGGG - Intergenic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1143391349 17:6561031-6561053 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391375 17:6561128-6561150 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391467 17:6561436-6561458 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143724339 17:8835181-8835203 CAGGAGAAGGAGGAAGAGCAGGG + Intronic
1143930449 17:10417818-10417840 GAGGGGGAGAATAAAGAGGAAGG - Intronic
1144031967 17:11331178-11331200 CAGAAGAAGCTTAAAAGGGAGGG + Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144291953 17:13834981-13835003 CAGGAGAAGGATGACAAGGAGGG - Intergenic
1144612256 17:16731219-16731241 AAAGAGAAACATAAAAAGGATGG + Intronic
1144620700 17:16816679-16816701 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1144884942 17:18451468-18451490 CAGGAGAAGGAAAAAGGGGAGGG - Intergenic
1144900475 17:18584073-18584095 GAAGAGAAACATAAAAAGGATGG - Intergenic
1144967346 17:19086028-19086050 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1144980573 17:19166038-19166060 AAGGAGAAGGATGAGGAGGAGGG - Intergenic
1144987649 17:19212195-19212217 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1145131972 17:20361612-20361634 AAAGAGAAACATAAAAAGGATGG + Intergenic
1145147279 17:20492909-20492931 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1145248138 17:21283352-21283374 CAGGAGACGCAGGAAGAGAATGG + Intergenic
1146429808 17:32781680-32781702 AAGGAGAGAAATAAAGAGGAAGG + Intronic
1147198134 17:38781316-38781338 CAGTAGAAGCCTTAAGAGGGAGG + Intronic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147572089 17:41577577-41577599 CAGGAGAAGGACAAAGGGGAGGG + Intergenic
1148512493 17:48184371-48184393 CAGTCGAAGAATAAAGAGAATGG + Intronic
1148678128 17:49456928-49456950 AAGGAGAAGGATGAAGAGGAAGG - Intronic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1150278042 17:63912149-63912171 GAGGAGGAGAAAAAAGAGGACGG - Intronic
1150279357 17:63920034-63920056 GAGGAGGAGAAAAAAGAGGAGGG - Intergenic
1150699724 17:67436450-67436472 CAGGAGAGGAATAAAGGTGAGGG + Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150952987 17:69823025-69823047 CTAGAGAAGGAAAAAGAGGAGGG - Intergenic
1151532918 17:74718935-74718957 CAGGAAAAACATAAAAAGTATGG + Intronic
1152328569 17:79657134-79657156 GAGGAGAAGAATGAGGAGGAAGG + Intergenic
1153152560 18:2111551-2111573 CAGGAGAAGCAAGTAAAGGAGGG - Intergenic
1153469443 18:5427648-5427670 CAGGACAAACAGAAAGAGCATGG + Intronic
1153748807 18:8208829-8208851 CACGTGATTCATAAAGAGGAAGG + Intronic
1153899982 18:9609691-9609713 CTGGAGAATGATAGAGAGGATGG - Intronic
1153919878 18:9779033-9779055 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
1154299277 18:13178795-13178817 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1154465645 18:14641261-14641283 CGGGAGAACGAAAAAGAGGATGG - Intergenic
1154484812 18:14865219-14865241 TGGGAGAAGGATAAAGAGGGTGG - Intergenic
1155759054 18:29541369-29541391 GAGGAGAGGGAGAAAGAGGAAGG - Intergenic
1155844307 18:30686355-30686377 GAGGAAAAGAAGAAAGAGGAGGG + Intergenic
1155881732 18:31157658-31157680 CATGAGAAGCAGAAAAAGGGAGG + Intronic
1156413946 18:36867173-36867195 CAAGAATAGCACAAAGAGGATGG - Intronic
1157060600 18:44284053-44284075 CAGGAGAATATTAAAGAAGATGG + Intergenic
1157793140 18:50550832-50550854 CAGGAGGAGGAAGAAGAGGAGGG - Intergenic
1157894806 18:51455682-51455704 AAGAGGAAGGATAAAGAGGAAGG + Intergenic
1158097029 18:53784602-53784624 CAGGAAAAGCTTAAAGGAGAAGG + Intergenic
1158985126 18:62807423-62807445 GGGGAGAAGCATAAAGAAGAAGG + Intronic
1159507599 18:69357033-69357055 CAAGAGAAGCATAAGGATGCTGG - Intergenic
1160174569 18:76582189-76582211 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1161042009 19:2115326-2115348 CAAGAGGAGGAAAAAGAGGAAGG - Exonic
1161861601 19:6802024-6802046 TAGGAGAGGCATTATGAGGACGG - Intronic
1162215013 19:9126855-9126877 CAGGAACAGCATGAAGAGGATGG + Exonic
1162222634 19:9191302-9191324 CAGGAACAGCCCAAAGAGGATGG - Intergenic
1162223976 19:9204378-9204400 CAGGAACAGCCCAAAGAGGACGG - Intergenic
1162225140 19:9214742-9214764 CAGGAACAGCCCAAAGAGGACGG + Exonic
1162227399 19:9235217-9235239 CAGGAACAGCCCAAAGAGGACGG - Intergenic
1163069613 19:14828146-14828168 CAGGAACAGCCCAAAGAGGAAGG + Exonic
1163071058 19:14841782-14841804 CAGGAACAGCCCAAAGAGGAAGG + Exonic
1163073333 19:14864620-14864642 CAGGAACAGCCCAAAGAGGAAGG + Intergenic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1164250190 19:23469049-23469071 GAGAAGAAGGAAAAAGAGGATGG - Intergenic
1165992156 19:39822570-39822592 CAGGAGAGACCTAAAGAGGAAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
924979872 2:209801-209823 CTGGAGAAACATAAATTGGAGGG - Intergenic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926951505 2:18248481-18248503 CAGGAGCAAGAGAAAGAGGAAGG + Intronic
927339830 2:21970585-21970607 CAGAAGCAGCAGAAAAAGGATGG + Intergenic
927946669 2:27138856-27138878 GAGGAGAGGAATAAGGAGGAAGG + Intronic
928189915 2:29154631-29154653 CAGGGAAATCATAGAGAGGAGGG + Intronic
928221773 2:29409312-29409334 CAGTAGAAGGAGAAAAAGGAAGG - Intronic
928325881 2:30319167-30319189 CAGCAGCAGCAGAAAGAGGTGGG + Intronic
928914248 2:36454909-36454931 CAGAAGGAGGATAAAGAGGCAGG + Intronic
929564509 2:42976125-42976147 CAGGAAAAGAAAAAAAAGGAAGG + Intergenic
929684893 2:44025060-44025082 CAAGAGAGGCAGAAAGAAGAGGG - Intergenic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930558194 2:52926806-52926828 CAGTAGAGGCATAAAGAATAAGG + Intergenic
930664742 2:54090790-54090812 CAGGACAATGATACAGAGGAGGG - Intronic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
931880207 2:66560808-66560830 CAGGAGGAGAATAGACAGGAGGG - Intronic
932385268 2:71326563-71326585 CAGAGGAAGAATGAAGAGGAAGG - Intronic
932752031 2:74377371-74377393 GAGGGGAAGGAGAAAGAGGAGGG - Intronic
932906110 2:75753996-75754018 GAGGAGGAGCATAAAGAAGGAGG - Intergenic
933292337 2:80451923-80451945 TAAGATAAGCATAAAGAGGAGGG + Intronic
933309003 2:80637488-80637510 CAGGAGAGGAAGAAAGAGGTGGG + Intronic
933701018 2:85255589-85255611 AAGGAGAAGCCTAAACAGGGTGG + Intronic
934095981 2:88604397-88604419 CAAGAGATGGATAGAGAGGAGGG - Intronic
934473477 2:94576891-94576913 CAGGAGCATCAGAGAGAGGAGGG + Intergenic
936122497 2:109758941-109758963 GAGGGGAAGAAAAAAGAGGAGGG + Intergenic
936162681 2:110096534-110096556 CATGAGAAAGATACAGAGGAGGG + Intronic
936222196 2:110612531-110612553 GAGGGGAAGAAAAAAGAGGAGGG - Intergenic
937528390 2:122798986-122799008 GAGGGGAAGGAGAAAGAGGAGGG - Intergenic
937757382 2:125556768-125556790 CAGGAGAAACAGAGAGAGGCAGG - Intergenic
938508846 2:131918302-131918324 CATGAGAAGCATCACGTGGATGG - Intergenic
938597307 2:132801100-132801122 CAGTGGAAGGATAAAGAGCATGG - Intronic
938893027 2:135724308-135724330 CAGGGGAACCATAAAGGCGAAGG - Exonic
939524227 2:143272283-143272305 CAGAAAAAGCAGAAAGAGTATGG - Intronic
940088964 2:149895129-149895151 CCGGAAAGGCATAAGGAGGAAGG - Intergenic
940837990 2:158546706-158546728 CAGGTTAAGGATAAAGAGCAAGG + Intronic
941006505 2:160252525-160252547 AAGGAGAACTCTAAAGAGGAAGG + Intronic
941046519 2:160682340-160682362 CAGGAAAAGAACAAACAGGATGG - Intergenic
941387849 2:164875069-164875091 CAGGAGGAGGAAGAAGAGGAGGG + Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
942568808 2:177292824-177292846 GAGGAGAAACATAAAATGGATGG - Intronic
942635305 2:177997785-177997807 CAGAAGAAGCAGAAAATGGAGGG - Intronic
942898379 2:181085748-181085770 TAGGAGCAGCATAAGAAGGAAGG + Intergenic
943278271 2:185896885-185896907 GAGGAGAAGGAAGAAGAGGAGGG + Intergenic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943352227 2:186809108-186809130 TATAAGAAGCATAAAGAAGAGGG + Intergenic
944446000 2:199789900-199789922 CAGGACCTGCATAAAGAGGATGG + Intronic
945744432 2:213703091-213703113 CAGGAGAGGGAAAAAGAGAATGG - Intronic
946366136 2:219250223-219250245 CAGCAGCAGCATGAAGGGGAAGG + Exonic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946539249 2:220665804-220665826 GAGGAGAGGGATAAAGAGGTTGG - Intergenic
946644257 2:221816319-221816341 CAGGAGAGAGAAAAAGAGGAGGG - Intergenic
946964944 2:225027608-225027630 CAGGAGAAGGAGAGAGAGGGAGG - Intronic
947480563 2:230495752-230495774 CAAGAGAAGCATAAGTAGAATGG - Intronic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948263546 2:236621711-236621733 CAAGAGAGGCACAAAGAGAAGGG + Intergenic
948587462 2:239028238-239028260 CAGGAGAAGAATCCCGAGGATGG - Intergenic
948599160 2:239098386-239098408 CAGGAGCAGCAGCGAGAGGATGG - Intronic
948747705 2:240108200-240108222 CAGGAGCTGCATCAACAGGAGGG + Intergenic
948747758 2:240108486-240108508 CAGGAGCTGCATCAACAGGAGGG + Intergenic
1170081625 20:12482928-12482950 GTTGAGAAGCTTAAAGAGGAAGG + Intergenic
1170779057 20:19407248-19407270 CAGCAGCAGCACTAAGAGGATGG + Intronic
1170841131 20:19925042-19925064 GAGGAGGAGCACAAAGAGGTGGG - Intronic
1171030076 20:21669185-21669207 CAGGAGAAGCAGAGAAAGGAGGG - Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171504506 20:25623035-25623057 CTGATGAAGCATGAAGAGGACGG + Intronic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173576276 20:44114802-44114824 CAGGAGGTGAACAAAGAGGATGG + Exonic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1175452084 20:59077886-59077908 AAGGAGAAGGAGAAAAAGGAGGG + Intergenic
1175539186 20:59737610-59737632 GATGAGAAAAATAAAGAGGAAGG + Intronic
1175649124 20:60701953-60701975 CAAGAGCAGCAACAAGAGGATGG - Intergenic
1176784646 21:13240246-13240268 CATGAGAAGCATCACGTGGATGG + Intergenic
1176796515 21:13374256-13374278 TGGGAGAAGGATAAAGAGGGTGG + Intergenic
1176808912 21:13517221-13517243 CGGGAGAACGAAAAAGAGGATGG + Intergenic
1177606255 21:23381354-23381376 CACGAGAAGCAGCAAGAGGGAGG - Intergenic
1177982694 21:27934091-27934113 CATGAGAAGCATCACGTGGACGG + Intergenic
1178123793 21:29496033-29496055 CAGGAAAAGGATAAGAAGGAAGG - Intronic
1179531075 21:42020051-42020073 CACAAGAAGAACAAAGAGGAAGG - Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1180047266 21:45313765-45313787 CAGTAAAAGCCTAAACAGGAAGG + Intergenic
1181314652 22:21963567-21963589 CAGGAGAAGGCAAATGAGGAAGG - Intronic
1181348765 22:22240415-22240437 CAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1181893074 22:26081816-26081838 CAGGATAAGCGTGAAGAGGAAGG + Intergenic
1182032612 22:27171310-27171332 CAGGACCATAATAAAGAGGAGGG + Intergenic
1182062466 22:27407802-27407824 CAGGAGAGGCAAAAATAGCAGGG - Intergenic
1183170557 22:36184668-36184690 CAGGAGGAGAATAGAGAAGAGGG - Intergenic
1184273677 22:43398715-43398737 CAGGAGAAGGGTGCAGAGGAAGG - Intergenic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184818138 22:46887910-46887932 CAGTGGAAGCTTAAGGAGGATGG + Intronic
1184856360 22:47148745-47148767 CAGGAGAAGAACCCAGAGGAGGG - Intronic
1185234770 22:49705352-49705374 CAGGAGAACCACGAGGAGGACGG + Intergenic
949316678 3:2764014-2764036 AAGGAGAGGTATAAAGTGGAGGG + Intronic
949347769 3:3092782-3092804 CAGTAGAAGGAAAAAGAAGAAGG - Intronic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950499935 3:13357395-13357417 CAGGAGATGCACAAATAAGATGG - Intronic
950666832 3:14501975-14501997 CAGAAGAAGTATAAAGAAAATGG + Intronic
950681997 3:14591888-14591910 CAGGAGGCACATCAAGAGGAAGG + Intergenic
950729987 3:14948243-14948265 GAGGAGGAGGATAAGGAGGAAGG - Intronic
951002520 3:17580372-17580394 CAGAAGAAGCCTAAAGAAGTGGG + Intronic
951033010 3:17903788-17903810 GAGGAGGAGGACAAAGAGGAAGG - Intronic
951050305 3:18086256-18086278 AAAGAGAGCCATAAAGAGGATGG - Intronic
953720509 3:45350726-45350748 CAGGAAAAGCACAAATATGATGG - Intergenic
954927482 3:54249077-54249099 AAGGAGAAGAATAAACAGCATGG + Intronic
955006845 3:54976597-54976619 AAGAAGAAGAATAAGGAGGATGG - Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
956302228 3:67784631-67784653 CAGGGGAAGAATTAGGAGGATGG + Intergenic
956516368 3:70052920-70052942 CAAGAGAAGCAGAAAGAAAAGGG - Intergenic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
957347856 3:78984926-78984948 TAGGAGGAGGAGAAAGAGGAGGG - Intronic
957784326 3:84861816-84861838 CAGGAAAGGCATAAAGATAATGG + Intergenic
957805892 3:85148871-85148893 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
958075835 3:88677033-88677055 GAGGAGGAGCAGAAAAAGGAAGG - Intergenic
958665047 3:97126845-97126867 CAGTAAGAGCATAAAGAAGATGG + Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
960121677 3:113953672-113953694 CAGAAAAAGCACAAAGAGGAGGG - Intronic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960928203 3:122817185-122817207 AAGGAAAATCATAAAGAGAAAGG + Intronic
961108143 3:124259795-124259817 AAGGAGAAAAATAAAGAGAAGGG + Intronic
962258583 3:133888405-133888427 CAGGAAATGCATAAAAAGAATGG - Intronic
963635814 3:147794286-147794308 CAGAAGATGCATAAAGATAATGG - Intergenic
964027224 3:152090317-152090339 CAAGAGAAGCATATAGATAATGG - Intergenic
964129678 3:153272821-153272843 CCTGAGAAGCATACAGGGGAAGG + Intergenic
964361987 3:155908196-155908218 CAGGAGGAAGATAAAGGGGAGGG + Intronic
964429044 3:156584736-156584758 CAGCAAAAGCATAAAGAACAAGG + Intergenic
964570081 3:158101498-158101520 CAGGAGAGGCTTAAAAAGGAAGG + Intronic
965153902 3:165020340-165020362 CAAGAAGAACATAAAGAGGAAGG + Intronic
966370944 3:179250150-179250172 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
967279813 3:187811037-187811059 CAGGAGAGCCAAAAAGTGGAAGG + Intergenic
967644399 3:191903772-191903794 CAAGTGAAGAAGAAAGAGGAAGG - Intergenic
967948179 3:194820558-194820580 AAGGAGAACCATGGAGAGGAGGG + Intergenic
969323668 4:6428117-6428139 TAGGACATGCATAAAGAGGAAGG - Intronic
969828868 4:9779918-9779940 CAGGAGAAGAAGATAGGGGAAGG + Intronic
970301079 4:14681854-14681876 CAGGAGAAAGAGAAAGAGAATGG + Intergenic
970401780 4:15724203-15724225 TAAGAGAAACACAAAGAGGAAGG - Intronic
972417987 4:38861502-38861524 CAGAAGAATAATGAAGAGGATGG - Intergenic
972897476 4:43641317-43641339 GAAGAGAAGAAAAAAGAGGAGGG - Intergenic
973246049 4:48012510-48012532 CAGCAAAAGGAAAAAGAGGAAGG - Intronic
973694599 4:53477779-53477801 CAGGAGGAGAAAAAAGAGAAAGG + Intronic
974682897 4:65186661-65186683 GAGGAGAAGAAGGAAGAGGAAGG + Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975330938 4:73112043-73112065 CAGCACAAACAAAAAGAGGATGG + Intronic
975795239 4:78000148-78000170 GAGAAGAAGAATGAAGAGGAGGG + Intergenic
975803212 4:78084679-78084701 CAGGAAATGTATGAAGAGGACGG - Intronic
976395405 4:84550122-84550144 CAGGAGTAGCATAAAGCCAAAGG + Intergenic
976561967 4:86511893-86511915 AAGGAGAAGAATGAGGAGGAAGG + Intronic
977069637 4:92368293-92368315 CTTGAGAAGCATTAAGAGGTAGG + Intronic
977178749 4:93846722-93846744 CAGGAAGAAGATAAAGAGGAGGG - Intergenic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
978021240 4:103815487-103815509 AAGGAGAAGAAAAAAGAGAAGGG - Intergenic
978852298 4:113353749-113353771 AAGCAGAAACAAAAAGAGGAAGG + Exonic
979652743 4:123155001-123155023 CAAGAGAACAATAAGGAGGAGGG - Intronic
979903135 4:126248874-126248896 GAGGAGAGGTATAAAAAGGATGG + Intergenic
979931388 4:126636026-126636048 CATGAGAAGCTGAAAGAGGAAGG - Intergenic
980017216 4:127663817-127663839 TAGGAAAAGAAAAAAGAGGAAGG + Intronic
980176867 4:129356460-129356482 CATCAGAAGGAGAAAGAGGAGGG - Intergenic
980822578 4:138036652-138036674 CTGGAGAAGGACAAAGAGGTTGG - Intergenic
981221119 4:142236291-142236313 CAGTAGAAGCATAAGGAGTTTGG - Intronic
981251836 4:142612123-142612145 CAGGAGAAAAAAATAGAGGAAGG + Intronic
982065585 4:151651632-151651654 CAGGAGAAGCCTGGTGAGGAGGG + Intronic
982243342 4:153322841-153322863 CAGAAGAAGCATAAAAAAGGGGG - Intronic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
983379832 4:166978676-166978698 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
983563217 4:169122273-169122295 TAGGAAAAACATAAAGAGAAAGG + Intronic
983655966 4:170084974-170084996 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
984189552 4:176589019-176589041 TAGTAGAAGGAGAAAGAGGAAGG + Intergenic
984538936 4:181013085-181013107 CAGAAGGAGAATAAAGAGGATGG + Intergenic
984617537 4:181915644-181915666 GAGGAGAAGCAGAGAGGGGAGGG + Intergenic
984782389 4:183537708-183537730 GAGGAGGAGGATGAAGAGGAGGG + Intergenic
985380155 4:189385270-189385292 CAGGAGAAAACTAAACAGGAGGG + Intergenic
986618297 5:9643028-9643050 GAGAGGAAGGATAAAGAGGAAGG - Intronic
986898588 5:12402874-12402896 CAGGAGGAGAAGAAAGAGAATGG - Intergenic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987425056 5:17763575-17763597 CAGCACAAGCACAAAGAGGTGGG - Intergenic
987665510 5:20933323-20933345 GAGGACGAGGATAAAGAGGAAGG + Intergenic
987734064 5:21816170-21816192 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
988089626 5:26519794-26519816 AAGGAGAAGGAAAAAGAAGAAGG + Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988164738 5:27572067-27572089 GAGAAGAAAGATAAAGAGGAGGG + Intergenic
988243461 5:28645072-28645094 CAGAAGAAGAAGAAAGAGAAAGG + Intergenic
988721434 5:33883044-33883066 CACTAGGAGAATAAAGAGGAAGG - Intronic
988757185 5:34268855-34268877 GAGGACGAGGATAAAGAGGAAGG - Intergenic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990156376 5:52882202-52882224 CAAGAGAAGGATAAGAAGGATGG - Intronic
990276814 5:54205956-54205978 CAGAAGAAGAATAAGGGGGAAGG - Intronic
990570999 5:57078773-57078795 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
990675444 5:58179048-58179070 CAGGAGAAGTAGAGAGAGAAGGG + Intergenic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992668600 5:79036081-79036103 CAGGAGAAGAATGAAGCGCAGGG - Intronic
993033373 5:82729877-82729899 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
993168465 5:84385036-84385058 CAGAAGGAGCTGAAAGAGGAGGG - Intergenic
993215534 5:85018254-85018276 CAGGAGGAGGAGAAAGAGAAGGG + Intergenic
993292069 5:86086265-86086287 AAGGATAAGCATAAAGAAGAAGG + Intergenic
993339681 5:86708000-86708022 TAGGAAAAACATAGAGAGGAGGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994203759 5:97008949-97008971 CAGGTAAAGAGTAAAGAGGAGGG - Intronic
994569989 5:101503857-101503879 CAGGAGCAAGAGAAAGAGGAAGG - Intergenic
994679183 5:102864326-102864348 CAGGATAAGGATAAAGCTGAAGG + Intronic
995035147 5:107525709-107525731 GAGGAGAAGGAGAAAGAAGAGGG + Intronic
995341987 5:111070707-111070729 CAGGAGAAGCATCGAGATGGCGG - Intronic
995350818 5:111173364-111173386 AAGGAGAAATATAAAGATGAAGG + Intergenic
995733521 5:115272342-115272364 CAGAAGAAGAATTAAGAGTAGGG + Intronic
996154384 5:120080002-120080024 CAGGAAAGGCACAATGAGGAGGG + Intergenic
996557618 5:124795432-124795454 GAGGAGGAGAATGAAGAGGAGGG + Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997084271 5:130778519-130778541 GAGGAGAAGGAAGAAGAGGAGGG + Intergenic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997768142 5:136525818-136525840 CAGGAGAAGCTTTGAGATGAAGG - Intergenic
998233108 5:140374235-140374257 TTGGAGAAGCATGAAGATGAGGG - Intronic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
1000642661 5:163721077-163721099 CAGGAGAATTATAGAGAGAATGG - Intergenic
1001981057 5:176037296-176037318 CGGGAGAAAGATAAAGAGGGTGG + Intergenic
1002193455 5:177490443-177490465 CAGGAGGAACAGAAAGAGGGAGG + Intronic
1002236404 5:177806770-177806792 CGGGAGAAAGATAAAGAGGGTGG - Intergenic
1002952475 6:1828340-1828362 CAGAAGAAGCAGAGAGAAGAAGG + Intronic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003529272 6:6924598-6924620 CAGGAGCAGGAGAGAGAGGAGGG - Intergenic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1005981591 6:30840896-30840918 CAGGAGACAGATAAAGGGGAGGG - Intergenic
1006238006 6:32652694-32652716 AAGTGGAAGCATAAAGTGGAGGG + Intergenic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1007126500 6:39430150-39430172 GAGAAGAAGCATAAAGAAGAGGG - Intronic
1007326006 6:41060123-41060145 AAGGAGAAGAAAAAAGAGAAGGG - Intronic
1007335820 6:41154256-41154278 CAGGAGCAGCAGCAAGAGCAGGG + Exonic
1008750964 6:54733431-54733453 CATGAGAAACAGCAAGAGGAAGG + Intergenic
1009055344 6:58328174-58328196 CAGGAGAAGGATAGAGAGAGGGG - Intergenic
1009798218 6:68499574-68499596 CAGAAATAGAATAAAGAGGAAGG - Intergenic
1010396063 6:75393477-75393499 CAGAAAAAGCATAATGAGAAAGG + Intronic
1010977905 6:82337295-82337317 CAGGAGAAGAAGAGAGAGGCTGG + Intergenic
1011000858 6:82587091-82587113 CAGGAGACCAATAAAGAGTAGGG - Intergenic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1013329963 6:109090662-109090684 GAGGAGGAGGATCAAGAGGAGGG + Intronic
1013951479 6:115787628-115787650 CTGGATAAGCATACAGAGTAAGG + Intergenic
1014305068 6:119730007-119730029 CAGGAAAACCATGAAAAGGAAGG - Intergenic
1014617553 6:123622128-123622150 GAGGAGGAGGAAAAAGAGGAAGG - Intronic
1014755994 6:125302181-125302203 CAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1015445577 6:133300211-133300233 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
1015857104 6:137636511-137636533 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1016550841 6:145278283-145278305 CAGCTGAAGCAAAAAGAGAAAGG + Intergenic
1016900286 6:149094082-149094104 CAGGAGCAGCATCAAGGTGATGG - Intergenic
1017196391 6:151704982-151705004 TAGGAGCAGTATAAAAAGGAAGG + Intronic
1017981189 6:159402170-159402192 CAGGAGAGCCAGAAAGGGGAGGG - Intergenic
1018149684 6:160926362-160926384 AAGGAGACGCATAAAGGGAACGG + Intergenic
1018285219 6:162230443-162230465 CAGGGGAAGAGTGAAGAGGAAGG + Intronic
1018479418 6:164174844-164174866 AAGGAGAAGCATGAATAGGATGG + Intergenic
1018615774 6:165685420-165685442 CAGAAGAAGCATTTAGAAGAAGG - Intronic
1019013341 6:168860923-168860945 GAGGAGAGGGAGAAAGAGGAAGG + Intergenic
1019198060 6:170293712-170293734 GAGGAGAAGGAAGAAGAGGAAGG - Intergenic
1020026813 7:4905350-4905372 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1020828136 7:13058019-13058041 GAGGAGAAGCAGAAAGAAGGAGG - Intergenic
1020832313 7:13108135-13108157 CAGGAGTAGGATGAAGAGTAGGG + Intergenic
1021059991 7:16099457-16099479 CAGGAAAAACATAAGGAGAAGGG + Intronic
1021467343 7:20960017-20960039 AAGGAAAAGCATAAGAAGGAAGG - Intergenic
1021482919 7:21137354-21137376 CAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1021777182 7:24065412-24065434 CAGGAGAAGCTTCAATAGGTGGG - Intergenic
1021974065 7:25994842-25994864 CAAGAGAAGAAGAAAGGGGAAGG + Intergenic
1023710443 7:42986896-42986918 CAGGATAGGAAGAAAGAGGAAGG + Intergenic
1026052744 7:66960793-66960815 GAGGAGCAGGATAGAGAGGATGG + Intergenic
1026216725 7:68356183-68356205 CATGGGAAGAATAAAAAGGAGGG + Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026350341 7:69510072-69510094 CTTGAGAAGGATAAAAAGGAGGG + Intergenic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026886306 7:73949414-73949436 CAGGAGAAGAAGAAAGCAGAAGG - Intergenic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1028210568 7:88069196-88069218 AAGGAGAAACATAGGGAGGAAGG - Intronic
1028600764 7:92598039-92598061 CAGGAGAAGCATATCTTGGAGGG - Intergenic
1029184727 7:98730397-98730419 CAGGAGAAAGAGACAGAGGAAGG + Intergenic
1029290415 7:99498351-99498373 CTGGAGAAGGATAGAGGGGAAGG + Intronic
1029310751 7:99661525-99661547 CAGGAGAAATATCAAGAGGGAGG - Intronic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1029872080 7:103705013-103705035 CAGGAGAAAAATCAAGAGGGTGG - Intronic
1030897696 7:115082250-115082272 TAGGAGAAACAAAAAGAGAATGG + Intergenic
1031282849 7:119826451-119826473 CAGTAGAAACATAAGAAGGAAGG + Intergenic
1031379941 7:121073324-121073346 GAGGAGATGGAAAAAGAGGAGGG + Intronic
1031972355 7:128073976-128073998 CAGGAGAGGCAGAAAGACGCGGG - Intronic
1032432760 7:131875358-131875380 GAGGTTAAGCATAAGGAGGAAGG - Intergenic
1032523275 7:132561942-132561964 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1032639781 7:133753042-133753064 CAGGATAAGGATAAAAAGAATGG - Intronic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034356150 7:150451882-150451904 CAGGGCAACCATCAAGAGGAAGG - Intronic
1035079834 7:156206739-156206761 CAGGAGAAGAATTTAGAGGTGGG - Intergenic
1035284661 7:157798639-157798661 CAGGAGAATTATTAAGATGAAGG - Intronic
1036453704 8:8891356-8891378 CAGGAGAAGCACGACGCGGAGGG - Exonic
1037591214 8:20313535-20313557 CAGGAGAACCTCAAAGAGGAAGG - Intergenic
1038568519 8:28639571-28639593 GAGGGGAAGTATAAAGAGGTAGG - Intronic
1039053128 8:33512769-33512791 CGGGATAAGAATAAAGAGAAAGG + Intronic
1039340112 8:36638741-36638763 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1040399545 8:47034574-47034596 CAGGAGAAGCAGAGAAAGAAAGG + Intergenic
1041392361 8:57358445-57358467 CAGGAGGAGGAGAGAGAGGAGGG + Intergenic
1041433561 8:57811632-57811654 CTGGAGAAGGGCAAAGAGGAAGG + Intergenic
1041682070 8:60604136-60604158 CAGGAGAAAGAGAAAGAGGTGGG - Intronic
1042002528 8:64141727-64141749 CAAGAACAGCATCAAGAGGATGG - Intergenic
1042076670 8:65003246-65003268 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1042876482 8:73444937-73444959 TAGGAGAAGCCTTCAGAGGAAGG + Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043196963 8:77307336-77307358 AAGGAGAATCAAAAAGAGAATGG + Intergenic
1044464745 8:92489871-92489893 AATGAGAAGCATGAAAAGGAGGG - Intergenic
1044787510 8:95810078-95810100 CCTGTGAAGCATAAAGGGGAGGG - Intergenic
1045316984 8:101052058-101052080 GTGGAGCAGCATAAAGATGAAGG - Intergenic
1046461178 8:114538333-114538355 CAGTAGATGCAGGAAGAGGAGGG + Intergenic
1046838794 8:118833379-118833401 GAGGAGAAGAAGGAAGAGGAGGG + Intergenic
1046927972 8:119813599-119813621 CCAGAGAAGGACAAAGAGGATGG + Intronic
1047616740 8:126568836-126568858 CAAGAGAAGCAAAAAGAGGGTGG + Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1048821288 8:138382939-138382961 CAGAAGATGGATAGAGAGGATGG + Intronic
1049445965 8:142631705-142631727 CAGGAGAAGCAGAACCGGGAGGG + Intergenic
1050302206 9:4271034-4271056 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1052510570 9:29413916-29413938 CAGGAGTAGCATGAATATGAAGG + Intergenic
1052607623 9:30724698-30724720 CAGGAGAAGAAAAAAAAGAAAGG + Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1053873045 9:42513776-42513798 CAGGATCAGCATAAAGAGGTGGG + Intergenic
1053899707 9:42782144-42782166 CAGGATCAGCATAAAGAGGTGGG - Intergenic
1054261938 9:62875449-62875471 CAGGATCAGCATAAAGAGGTGGG + Intergenic
1054269285 9:62952976-62952998 CAGGATCAGCATAAAGAGGTGGG - Intergenic
1055280496 9:74668744-74668766 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1055360122 9:75480722-75480744 CAGGATAGGCAAACAGAGGAGGG + Intergenic
1055398213 9:75895650-75895672 CAGGATAAGCATACTGCGGATGG + Intronic
1055529677 9:77171490-77171512 CAGGAGAAGGATGGAGAGGTGGG - Intergenic
1056392149 9:86150269-86150291 TAGGCAAAGCATAAATAGGAAGG + Intergenic
1056523129 9:87418590-87418612 AAGGATGAGCATAAAGAAGAGGG - Intergenic
1056632345 9:88304296-88304318 CAGGAGATACATACAGAGAATGG - Intergenic
1056774653 9:89502036-89502058 CAGCAGAAGCATAGAAATGAAGG + Intergenic
1057414121 9:94846225-94846247 CTGGAGAAGCACAACGTGGAAGG + Intronic
1057490948 9:95518964-95518986 CAGGAGTGGCATAATGAGGCAGG + Intergenic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058567718 9:106304337-106304359 CAGATGCAGCATAAGGAGGAAGG + Intergenic
1058882658 9:109298971-109298993 CTAGAGAAGCAAAAATAGGAGGG + Intronic
1059065009 9:111074597-111074619 CAAGAGCAGCACCAAGAGGATGG + Intergenic
1059080254 9:111241709-111241731 CATGAGAAAGATGAAGAGGAAGG - Intergenic
1059663096 9:116420812-116420834 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1059944229 9:119391483-119391505 CAAAAGAAGCAAAAAAAGGAGGG + Intergenic
1060443312 9:123662271-123662293 CAAAAGAAGAATAAAGAGGCTGG + Intronic
1061445480 9:130634963-130634985 CACGGGGAGAATAAAGAGGAGGG - Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1185535366 X:857197-857219 CAGGAAAAGCAAAAACTGGAGGG + Intergenic
1185948692 X:4406311-4406333 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1186017836 X:5218111-5218133 AAAGGGAAGGATAAAGAGGAAGG + Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186114622 X:6292503-6292525 CAGGAGAAGCCAAAAGCTGAGGG - Intergenic
1186178422 X:6949371-6949393 GAGGAAAAGGATAAGGAGGAGGG - Intergenic
1186318590 X:8398964-8398986 TATAAGAAGCAAAAAGAGGACGG - Intergenic
1186459946 X:9740034-9740056 CAGGAGAAGGAGAAAGTGGGAGG + Intronic
1187916083 X:24153310-24153332 CAGGAAAGGCATGAAGGGGAAGG - Intronic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1189094473 X:38123609-38123631 CAGCAGAAGCTTAAACTGGATGG - Intronic
1189163940 X:38840289-38840311 ATGGACAAGCATAAAGAGGTGGG + Intergenic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1189534599 X:41923507-41923529 CGGGAGGAGGAGAAAGAGGAGGG - Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1190048010 X:47128002-47128024 CAGGAGAAGGAGAGAGAGGTAGG + Intergenic
1190432284 X:50389834-50389856 CAGGAGAATAAGAAAGGGGAGGG - Intronic
1190919798 X:54840818-54840840 CAGGAAAAGAATTAAGAGCACGG - Intergenic
1192153620 X:68727004-68727026 TAGGAGATGGATAAAGAGGAGGG + Intergenic
1192204149 X:69085183-69085205 GAGGAGGAGAAGAAAGAGGAGGG - Intergenic
1193948474 X:87766839-87766861 CAGGAGAGAAATAAAGAGTAGGG + Intergenic
1194859940 X:98985600-98985622 CAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1195457564 X:105085988-105086010 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1195614202 X:106900083-106900105 CAGGAGAAAAATAAACTGGATGG - Exonic
1195989894 X:110672064-110672086 CAGGAGGAACAGACAGAGGAGGG + Intergenic
1196052591 X:111321459-111321481 CAGGACAAGCCCAAACAGGATGG + Intronic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196586612 X:117436473-117436495 TAGGAGAAGCAAAGAGTGGAGGG + Intergenic
1196761084 X:119201530-119201552 TAGCAGAAGAACAAAGAGGAAGG - Intergenic
1196964184 X:121037817-121037839 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1197645766 X:129015124-129015146 CAGAAGAAGCAGCAAGAAGATGG - Intergenic
1198015939 X:132610970-132610992 CAGGGGAAGAAAGAAGAGGAGGG + Intergenic
1198211483 X:134520632-134520654 CAGGATAAGCCTAAATAAGAAGG + Intergenic
1198764868 X:140070247-140070269 CAGGTGAAGCAATAAGAGTATGG + Intergenic
1199585167 X:149407086-149407108 AAGGAGATGCAAAAAGAAGAAGG + Intergenic
1199701887 X:150385632-150385654 GAGGAGAAGGAGGAAGAGGAAGG + Intronic
1200215368 X:154365900-154365922 CAGTAGAAGCTCAAAGAGTAGGG + Intronic
1200239883 X:154487849-154487871 CAGGAGGAGCACAAAGCTGAAGG + Exonic
1200639929 Y:5704232-5704254 CAAGAACAGCATCAAGAGGATGG + Intronic
1201247911 Y:12024662-12024684 GAGGAGGAGTAAAAAGAGGAGGG - Intergenic
1201890807 Y:18941900-18941922 GAGGAGGAGAATGAAGAGGAGGG - Intergenic
1202594133 Y:26519504-26519526 CAGGAGAAGGAGAAAGATGGGGG - Intergenic