ID: 1196104836

View in Genome Browser
Species Human (GRCh38)
Location X:111884599-111884621
Sequence TCATAACCTAAGTTTAGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 129}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196104829_1196104836 20 Left 1196104829 X:111884556-111884578 CCAGTTGAAGCCTAGCCAAGGAC 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1196104836 X:111884599-111884621 TCATAACCTAAGTTTAGATAAGG 0: 1
1: 0
2: 1
3: 15
4: 129
1196104833_1196104836 5 Left 1196104833 X:111884571-111884593 CCAAGGACTAAGCCTGGGTAAGG 0: 1
1: 0
2: 2
3: 13
4: 158
Right 1196104836 X:111884599-111884621 TCATAACCTAAGTTTAGATAAGG 0: 1
1: 0
2: 1
3: 15
4: 129
1196104831_1196104836 10 Left 1196104831 X:111884566-111884588 CCTAGCCAAGGACTAAGCCTGGG 0: 1
1: 0
2: 1
3: 16
4: 204
Right 1196104836 X:111884599-111884621 TCATAACCTAAGTTTAGATAAGG 0: 1
1: 0
2: 1
3: 15
4: 129
1196104835_1196104836 -7 Left 1196104835 X:111884583-111884605 CCTGGGTAAGGTCTAGTCATAAC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1196104836 X:111884599-111884621 TCATAACCTAAGTTTAGATAAGG 0: 1
1: 0
2: 1
3: 15
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196104836 Original CRISPR TCATAACCTAAGTTTAGATA AGG Intronic
901469349 1:9445139-9445161 TCATAGCCTCAGTATTGATAGGG - Intergenic
906222131 1:44089100-44089122 GCATAACCTAAGGTAAAATAAGG + Intergenic
909470457 1:76021571-76021593 TTATAATTTAAGTCTAGATAAGG - Intergenic
911058890 1:93731023-93731045 TCATAACCTTAGTCTAGCCATGG + Intronic
914985431 1:152452513-152452535 TTAGAACCTATTTTTAGATAGGG + Intergenic
917271582 1:173280844-173280866 TCTTAGCCTAACTTTAGAGATGG + Intergenic
921474168 1:215585729-215585751 TTAAAACCTAAATTCAGATAGGG + Intronic
921649721 1:217663034-217663056 TTATAATATAAGTTTAGATTTGG + Intronic
923593346 1:235339823-235339845 TAACATCCTAATTTTAGATAAGG - Intronic
1064906697 10:20354842-20354864 TCATATTCTAACTTTAGAGATGG - Intergenic
1067420918 10:46146464-46146486 TCAAAACCTAACCCTAGATATGG + Intergenic
1067506256 10:46852930-46852952 TCAAAACCTAACCCTAGATATGG + Intergenic
1068105320 10:52607734-52607756 CAATAACCTAACTTTAAATAGGG + Intergenic
1068365771 10:56048163-56048185 TTATAAACTGAGTTTAGAAAAGG + Intergenic
1068393986 10:56437482-56437504 TCAAAACCTAACCCTAGATATGG - Intergenic
1068409050 10:56630965-56630987 TTAGAACCTAAGTTAAAATAAGG - Intergenic
1070858739 10:79630697-79630719 TCAAAACCTAACCCTAGATATGG + Intergenic
1070998600 10:80809023-80809045 TCATCAACTAAGTGAAGATAGGG - Intergenic
1072175297 10:92914721-92914743 TGATAACCTAAGTGTAGAGAAGG + Intronic
1073275627 10:102308038-102308060 TCATACCCTAAGGGTAAATAGGG + Intronic
1074727400 10:116325587-116325609 TCATTACCTTAGTTTATTTAGGG - Intronic
1074738463 10:116460671-116460693 TCATAACCTTATTGTATATATGG + Intronic
1075807115 10:125197307-125197329 TCATAATCTAAGTTAAAAGAAGG - Intergenic
1079708491 11:23652073-23652095 TTATAAGCTAAGTTTGGATGAGG + Intergenic
1080182672 11:29443379-29443401 TAACAACCTAAGCTCAGATATGG - Intergenic
1086738268 11:90334292-90334314 TATAAACCAAAGTTTAGATATGG - Intergenic
1090604981 11:128412325-128412347 TAATTACGTAAGTTTAGAAAAGG + Intergenic
1092697110 12:11184663-11184685 TGATAATCTAAGATTAGATAAGG - Intergenic
1093318489 12:17681541-17681563 TCATAGAATAAGTTAAGATATGG + Intergenic
1098535399 12:71588721-71588743 CCATAACCTAATTGTAGTTAAGG - Intergenic
1100987668 12:100219473-100219495 TCATAAACTATGTTTAAAGAAGG - Intronic
1108558400 13:51619492-51619514 TCATTATCTAAATTTAAATAGGG - Intronic
1109395359 13:61751135-61751157 TCATAAGATAAGTTTGGATGTGG + Intergenic
1109509317 13:63349167-63349189 TCATAGACTGAGTTTAAATAAGG + Intergenic
1110098814 13:71569365-71569387 ACATTACATAAATTTAGATATGG + Intronic
1111834780 13:93374766-93374788 TCATTAGCTAAGTATGGATATGG + Intronic
1112130579 13:96519414-96519436 ACATAAGTTCAGTTTAGATACGG - Intronic
1112174709 13:97010592-97010614 TTAAGACCTAAGTTAAGATAAGG - Intergenic
1113025277 13:105934014-105934036 TCATAACAAAAGTTTATATCTGG + Intergenic
1115413087 14:33098247-33098269 TGATAACCTAAGTTATGATAGGG - Intronic
1116535778 14:46027801-46027823 TCATAACCTAGGTTAAGAATTGG - Intergenic
1119499020 14:75107021-75107043 TCAAGACCTAAGTTTAGTTTTGG - Intronic
1119633246 14:76252462-76252484 TCACAACCTCATTTTACATAAGG - Intronic
1127566222 15:60191154-60191176 TCATAACATACCTTTAAATATGG + Intergenic
1129791071 15:78340950-78340972 TCATACCCTAACTTTAGAAAGGG - Intronic
1130507727 15:84561752-84561774 GTATAACCTTAGTTTAGATTAGG - Intergenic
1132358064 15:101187965-101187987 TGTTAACCAAAGATTAGATATGG - Intronic
1132428058 15:101737036-101737058 GTATAACCTTAGTTTAGATTAGG - Intergenic
1134386387 16:13777406-13777428 TGAGAAGGTAAGTTTAGATAGGG - Intergenic
1135830059 16:25765167-25765189 TCAAAACATAACTTTAAATAAGG - Intronic
1143123828 17:4627995-4628017 TCAGAACTTAAGTTTAAAAAAGG - Intergenic
1143426313 17:6841887-6841909 TCAGAACTTAAGTTTAAAAAAGG + Intergenic
1143601062 17:7946338-7946360 TCATAACTTCAGTTTACACATGG + Intronic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1153747595 18:8195960-8195982 ATTTTACCTAAGTTTAGATAAGG - Intronic
1153936952 18:9935764-9935786 TCACAAGCTGAGTTTAGAAAGGG + Intronic
1155371452 18:25105867-25105889 TGATAACGTATGTTTAGTTAAGG + Intronic
1156202143 18:34845846-34845868 TCATTACACAAGTTTAGATTTGG - Intronic
1156646904 18:39174428-39174450 CCATAACCAAAGTGTAGATCTGG + Intergenic
1159060863 18:63512554-63512576 TCATGACGTAAGTATAGAAATGG - Intergenic
1162264226 19:9557819-9557841 TCATAACCTAATTTCAGAACTGG + Intergenic
1167473634 19:49688394-49688416 TCATAACTTATGTTTTTATATGG + Exonic
925498017 2:4473882-4473904 TCAAAATCTAGGATTAGATATGG - Intergenic
927735083 2:25513265-25513287 GTATAACTTAGGTTTAGATAGGG + Intronic
929171033 2:38933685-38933707 TTATAACCTAATCTTAGAAATGG + Intronic
929741076 2:44600996-44601018 TCATATCCTAAATTTAGGGAGGG + Intronic
929746618 2:44666154-44666176 TTATAACTTAAGCATAGATAAGG + Intronic
933403312 2:81826501-81826523 TCATTACTTAATATTAGATATGG - Intergenic
937804169 2:126118175-126118197 TCATAACATAATTTTAGCCATGG + Intergenic
939485073 2:142801452-142801474 TCATGACCTAAGATGTGATAAGG - Intergenic
940047709 2:149427157-149427179 TCATAATCTAATGTTAGATTTGG + Intronic
942988023 2:182164876-182164898 TCATTACATAAGTTTACAGATGG - Intronic
943540755 2:189211138-189211160 TCATAACTGAAGTTTATATAGGG - Intergenic
944866270 2:203865565-203865587 TCATTACCTTAGTTTAGACCAGG + Intergenic
945056804 2:205876388-205876410 ACATAATCTAATTTTACATATGG - Intergenic
945472251 2:210240395-210240417 TAATCACCTAAGTTAAGATAAGG + Intergenic
945736917 2:213612177-213612199 TCTTATCTTTAGTTTAGATATGG + Intronic
947231064 2:227886852-227886874 TGAGAGCCTAAGTTCAGATAAGG + Intronic
948561035 2:238852198-238852220 TCATAACTTTAGTTTAAATCTGG + Intronic
1177044988 21:16158153-16158175 TAAATACCTAAGTCTAGATATGG + Intergenic
1177126706 21:17203204-17203226 TAATCACTTAAGTTAAGATAAGG + Intergenic
1178116698 21:29425248-29425270 GAATAACCTAAGTTTAAATATGG + Intronic
1182191764 22:28468442-28468464 TGATAACCTGAGCTTAGATGGGG - Intronic
949959438 3:9300018-9300040 TCATTACCTCAGTTTACATATGG - Intronic
951123275 3:18953837-18953859 TTATAACCTAAGATTATATCTGG - Intergenic
955486889 3:59443914-59443936 TCATCACCTCAGTGTAGAGAAGG - Intergenic
959772427 3:110115375-110115397 TCATTACCTAATTTTAAATGTGG + Intergenic
962296117 3:134189138-134189160 TCATATACTTAGTTTAGATATGG - Intronic
963455279 3:145538833-145538855 TCATGACCTAAGAGTAGAGAAGG - Intergenic
963795970 3:149631201-149631223 GCAGAAGCTAAGTTTAGATGAGG + Intronic
964447255 3:156772618-156772640 TTATAGCCTCAGTTTAGTTAAGG - Intergenic
966746289 3:183280356-183280378 TCAAAATCTAAGTTTAAAAAGGG - Intronic
968722052 4:2214828-2214850 ACATATCCTAAGTTTAGTTTAGG - Intronic
970706866 4:18815351-18815373 TAATAACCTATAATTAGATATGG + Intergenic
971519203 4:27528307-27528329 TCATAGGCTAGGTTTAGAGATGG - Intergenic
977645933 4:99411869-99411891 TCATCAGCTGAGTTTAGCTATGG - Intergenic
979589905 4:122466135-122466157 TCATCGCCTAACTTTAGATATGG - Intergenic
980629002 4:135409824-135409846 TCATCATCTAAATTTAGAAAAGG - Intergenic
981594623 4:146405665-146405687 TCATAACAAAATTTTATATATGG - Intronic
982986281 4:162211374-162211396 TCTTAACCTAGGTCTACATAAGG - Intergenic
986660643 5:10057037-10057059 TCATTAGCGAAGTTTAGATAAGG + Intergenic
987339409 5:16926385-16926407 TCTTAATCTAAGTCTAGAGATGG - Intronic
992915106 5:81441867-81441889 TCAAAAGCATAGTTTAGATATGG + Intronic
993815317 5:92537307-92537329 TCATAACAGAAGATTAGATATGG + Intergenic
995190979 5:109319156-109319178 TCACAACATAAGGGTAGATAAGG - Intergenic
996046547 5:118880240-118880262 ACATATCCTAATTTTAGAGATGG - Intronic
996555471 5:124774237-124774259 TCAGAACATAAATTTAGAAAAGG - Intergenic
998278554 5:140782678-140782700 TAACAACCTATGATTAGATATGG + Intergenic
1001964933 5:175903402-175903424 TCAGAAGGTAAGGTTAGATAAGG + Intergenic
1002252022 5:177935786-177935808 TCAGAAGGTAAGGTTAGATAAGG - Intergenic
1005666209 6:28059081-28059103 TCATCATCTAAGTTTAGATAAGG + Intergenic
1009268602 6:61589444-61589466 TCAGCAACTAAGTTTAAATAAGG + Intergenic
1009671817 6:66763658-66763680 TCATAACCAAAATTTAGGAATGG - Intergenic
1011808110 6:91096591-91096613 TCATAACTTTAGGTAAGATAGGG - Intergenic
1012044000 6:94245746-94245768 TCAAAACCTAAGTTTTGGAAGGG + Intergenic
1012639939 6:101597421-101597443 ACAAAACTTAAGTTCAGATAGGG - Intronic
1016097288 6:140053969-140053991 TGATAACATCAGTTTAGACATGG - Intergenic
1020824775 7:13013068-13013090 TCATAAAACAAGTCTAGATAAGG - Intergenic
1021526069 7:21589819-21589841 TCATCACGTAAGTTAAGATTTGG + Intronic
1022835339 7:34108316-34108338 TCATAACCTTAGATAAGCTAAGG + Intronic
1023308006 7:38851663-38851685 TCATTCTCTAAGTTTAGAAAGGG + Intronic
1025282128 7:57635508-57635530 ACATGACCTAAGTCTGGATATGG + Intergenic
1025302602 7:57830009-57830031 ACATGACCTAAGTCTGGATATGG - Intergenic
1028712820 7:93929198-93929220 TCGTAACCTAATTATAGAGATGG - Intergenic
1029586852 7:101478406-101478428 TCATGACCTAATTTTACAAAAGG - Intronic
1033674785 7:143529939-143529961 GCAGAAGCTAAGTTTAGAAAGGG + Intergenic
1033697052 7:143799500-143799522 GCAGAAGCTAAGTTTAGAAAGGG - Intergenic
1035249206 7:157585987-157586009 TCAAACCCAAAATTTAGATAAGG + Intronic
1035411455 7:158646191-158646213 TCATAACTTAAATTCAGTTAAGG - Intronic
1036001972 8:4615924-4615946 TCTTAATCTAAGTTTTGAAAGGG - Intronic
1036235020 8:7031982-7032004 TCATAACCTATGTTTGGCAATGG + Intergenic
1041057638 8:54003549-54003571 TCATCAACTGATTTTAGATAAGG + Intronic
1041531733 8:58876082-58876104 TAATAAACTAAGTATAGAGATGG + Intronic
1051075035 9:13223349-13223371 TCATAACTTAAGTTTTGGTAAGG - Intronic
1052211741 9:25912351-25912373 TCATAACATAAGTTAGTATAAGG + Intergenic
1052621795 9:30920933-30920955 TCATAACCTGAGATCACATATGG + Intergenic
1056202344 9:84288847-84288869 TCATTACATCATTTTAGATAGGG + Intronic
1057963989 9:99485533-99485555 TCAACACCTAAGGTTAGATATGG - Intergenic
1058306403 9:103446957-103446979 TCATCACCTCAATTTAGAAAAGG - Intergenic
1187997143 X:24939639-24939661 TCATAACTTTAGTTTAGAGCTGG + Intronic
1189954037 X:46260335-46260357 TGATAACCTAAGTTCAGTTAGGG + Intergenic
1194298066 X:92151841-92151863 TGTAAACCTAAGTTTAAATATGG + Intronic
1195960199 X:110378196-110378218 TCATAACCTATCTTTGGGTATGG + Intronic
1196104836 X:111884599-111884621 TCATAACCTAAGTTTAGATAAGG + Intronic
1200615674 Y:5376808-5376830 TGTAAACCTAAGTTTAAATATGG + Intronic
1201977052 Y:19862440-19862462 TCATTAACTAAATTTACATAAGG - Intergenic