ID: 1196105136

View in Genome Browser
Species Human (GRCh38)
Location X:111887204-111887226
Sequence TAGTGGGTAATGCCAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196105129_1196105136 17 Left 1196105129 X:111887164-111887186 CCCTTTATGCTATTACATTGCTT 0: 1
1: 0
2: 4
3: 26
4: 307
Right 1196105136 X:111887204-111887226 TAGTGGGTAATGCCAGAGGAAGG 0: 1
1: 0
2: 0
3: 18
4: 162
1196105130_1196105136 16 Left 1196105130 X:111887165-111887187 CCTTTATGCTATTACATTGCTTT 0: 1
1: 0
2: 2
3: 35
4: 352
Right 1196105136 X:111887204-111887226 TAGTGGGTAATGCCAGAGGAAGG 0: 1
1: 0
2: 0
3: 18
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196105136 Original CRISPR TAGTGGGTAATGCCAGAGGA AGG Intronic
900289459 1:1917746-1917768 TAGTGGGTGACGCCAGGGGCCGG + Exonic
901131175 1:6963110-6963132 GAGTGGGTGAGGCCAGAGGGTGG - Intronic
902394859 1:16127030-16127052 TAGTGGTTAATCTCACAGGATGG + Intronic
902879139 1:19359520-19359542 TAGTGGGTAGTGCCGGAGAGGGG - Intronic
903282204 1:22256393-22256415 TAGGGGGCAAGGGCAGAGGAAGG + Intergenic
904617520 1:31757969-31757991 GAGTGGGTAAGGGCTGAGGATGG + Intronic
905183971 1:36183057-36183079 TGGTGGGTGATGGCTGAGGAGGG - Intergenic
905637607 1:39565362-39565384 TTGTAGGTAATGCTGGAGGATGG - Exonic
905651253 1:39658484-39658506 GACTGGGTCAGGCCAGAGGAAGG + Intergenic
906734371 1:48110380-48110402 TACTGGGCAAGGTCAGAGGAAGG - Intergenic
908429476 1:64041921-64041943 TACTGGGGAGTGCAAGAGGAAGG + Intronic
910575964 1:88764153-88764175 TAGAGTGTAATGAGAGAGGAAGG - Intronic
911105034 1:94122975-94122997 GAGGAGGGAATGCCAGAGGAAGG + Intergenic
911519142 1:98907975-98907997 TAGGGGTTCATGCCAGATGAAGG - Intronic
915782314 1:158566418-158566440 GAGTAGGTAATAACAGAGGATGG + Intergenic
915963349 1:160285021-160285043 TAGTGGGAAAGGCCCGAAGAGGG - Intronic
919163819 1:193867181-193867203 TTGAGGGAACTGCCAGAGGATGG - Intergenic
919788682 1:201276195-201276217 TAGGCGGTGCTGCCAGAGGAAGG + Intergenic
919982680 1:202652147-202652169 TGGTGGCTGATGCCAGTGGAAGG + Intronic
920247751 1:204601105-204601127 TCATGGGTAATGCCTGAGGTTGG + Intergenic
920615956 1:207492756-207492778 TAGGGGCAAATCCCAGAGGAAGG + Intergenic
922240917 1:223755184-223755206 TGGTGGGAGATGGCAGAGGATGG - Intronic
922362364 1:224834910-224834932 TATTGGGTAAAGCCAGGAGATGG + Intergenic
923048357 1:230371953-230371975 TAGTTGGGAATGGAAGAGGAGGG + Intronic
1063149375 10:3322601-3322623 TAGTGGGTAATCACAGGAGAGGG + Intergenic
1063513513 10:6670951-6670973 CAGTGGGTAAGGCAAGAGGTTGG + Intergenic
1064860247 10:19817667-19817689 TAGTGGGGATCGCCAGGGGAAGG - Intronic
1066625205 10:37398869-37398891 CAGTGGGGACTACCAGAGGAGGG - Intergenic
1068639327 10:59384735-59384757 TAATGGGTAAAGCCAGAGCAGGG - Intergenic
1071605599 10:86985553-86985575 CAGGGGGTAAAGCCAGAGTAGGG - Intergenic
1072278402 10:93844939-93844961 TAGGGGGTACTGGCAGAGAAGGG - Intergenic
1072562413 10:96587892-96587914 TGGTTGGTACTGGCAGAGGAAGG - Intergenic
1077236447 11:1484219-1484241 TGGTGGGAAGTGCCAGATGAGGG - Intronic
1078034774 11:7791881-7791903 TAGTAGGTAATGGCAGATGTTGG + Intergenic
1085795349 11:79534202-79534224 CAGTGGCTACTTCCAGAGGATGG + Intergenic
1089009997 11:115124414-115124436 AAGTGGGTAATGGCAAAGGGAGG - Intergenic
1089793572 11:120962262-120962284 CACTGTGTAATGGCAGAGGAGGG - Intronic
1091538242 12:1434212-1434234 TAGTGAGGAAATCCAGAGGATGG - Intronic
1092948758 12:13480810-13480832 TAGTGGGGGTCGCCAGAGGATGG - Intergenic
1093055167 12:14548829-14548851 AACTGTGTAATACCAGAGGAGGG + Intronic
1095851887 12:46818600-46818622 TATTGGATAATGCCAGCTGAGGG - Intronic
1098299370 12:69038398-69038420 TAGTGGGTAATGCCAGCTCAAGG - Intergenic
1098870774 12:75814624-75814646 AAATAGGAAATGCCAGAGGAAGG - Intergenic
1101048907 12:100840503-100840525 TAGTAGTAAATGTCAGAGGAGGG + Intronic
1104296439 12:127519043-127519065 TAGTGGGTGAGGTCAGGGGAGGG - Intergenic
1105841744 13:24259697-24259719 TATTGGGAAATGCTATAGGAGGG + Intronic
1106065474 13:26344052-26344074 TACTGGGAACTACCAGAGGAGGG - Intronic
1110812807 13:79829208-79829230 TAAAGGCTAATGCCAGAGGCTGG - Intergenic
1111238463 13:85441396-85441418 GAGTGGCTAAAGCCAGAGCATGG - Intergenic
1111269470 13:85862629-85862651 TAGTCAGGAATGTCAGAGGAAGG - Intergenic
1111294391 13:86260034-86260056 CAGTGGGTAAGGACAGAGTAAGG + Intergenic
1114068694 14:19090090-19090112 AAGGGGGTAAAGCCAGAGTAGGG + Intergenic
1114578567 14:23736120-23736142 TACTGGGGACTACCAGAGGAAGG + Intergenic
1115257419 14:31417825-31417847 CAGTGTGTAATGATAGAGGAAGG - Intronic
1117989760 14:61422009-61422031 TAGTGGGTAGTGCCAGATGCAGG + Intronic
1120303539 14:82738251-82738273 TAGTGGGTCATAGAAGAGGAAGG - Intergenic
1120411024 14:84155684-84155706 TAGTGAGAGATGCCAGAGGAAGG - Intergenic
1122008328 14:98724922-98724944 TAATGGGTAATGGCAGAGCCTGG - Intergenic
1123049455 14:105533709-105533731 TCCTGGGTAATGGCAGAGGGAGG - Intergenic
1123817733 15:23996730-23996752 TAGTGGGTGATGACACAGGTGGG + Intergenic
1127680445 15:61290939-61290961 TAATGTGTGATGGCAGAGGAGGG + Intergenic
1128355618 15:66924380-66924402 TGGTGGTTGTTGCCAGAGGATGG - Intergenic
1130097671 15:80867928-80867950 TACTGGGCAATGTCAGAGAAGGG + Intronic
1131739095 15:95367461-95367483 TAATGGCTACTGCCAGAGGCAGG + Intergenic
1132212729 15:100036327-100036349 TAATGGGAAAGGACAGAGGAAGG + Intronic
1132866788 16:2097104-2097126 GAGGGGGGATTGCCAGAGGAGGG - Intronic
1132977110 16:2716384-2716406 CACTGGGGAATTCCAGAGGAGGG - Intronic
1134109136 16:11503784-11503806 TTGTGGGTCCTGCCGGAGGAAGG - Intronic
1135124354 16:19795704-19795726 CAGTGGGTAAGGACAGAGTAAGG - Intronic
1137254102 16:46760898-46760920 GAATGGGTAAGGGCAGAGGAGGG + Intronic
1139573575 16:67827862-67827884 GAGTCGGAAATGCCAGAGGAGGG + Exonic
1140562787 16:76003125-76003147 CAGTGGGTAATACAAGAGGAGGG + Intergenic
1142326446 16:89418474-89418496 CAGTGGGTCATGGGAGAGGAAGG - Intronic
1143057195 17:4171203-4171225 CAGTGTTTCATGCCAGAGGAAGG - Intronic
1143165279 17:4894376-4894398 TGCTGGGTAACGGCAGAGGATGG + Intronic
1148406000 17:47416590-47416612 AAGTGGGGACTACCAGAGGAGGG - Intronic
1149029778 17:52069433-52069455 TTGTGGGTAAGGTCAGAGGAAGG + Intronic
1149213711 17:54330718-54330740 TGGTGGTTAATGACAGAAGACGG + Intergenic
1151088952 17:71413289-71413311 TAGTGATTATTTCCAGAGGAAGG + Intergenic
1151618024 17:75227126-75227148 AAGTGGGTAATGGCAGAAGATGG + Intronic
1152112680 17:78365903-78365925 TTCTGGGAAATGCCAGAGGCCGG - Intergenic
1155426467 18:25712729-25712751 TATTGGGGACTGCCAGAGGTGGG - Intergenic
1155736882 18:29235318-29235340 TACTGGGAAATGGCAGAGTAGGG - Intergenic
1157231428 18:45920110-45920132 GAGTGGGTAAGGGGAGAGGAAGG - Intronic
1157863519 18:51161927-51161949 CAGTGGGCACTGCCAGTGGATGG + Intergenic
1158062831 18:53366810-53366832 GAGTGGGCAAGGCCGGAGGATGG - Intronic
1158543289 18:58375493-58375515 CAGAGGGTAATGCCAGAGGGGGG - Intronic
1160554542 18:79717154-79717176 TGGTGGGTACTGCCAGGTGAGGG + Intronic
1163170376 19:15527110-15527132 TAGAGGGTAAGGCCTGAGCAGGG - Intronic
1164435253 19:28223158-28223180 TAGTGGGGACTGGCTGAGGAAGG - Intergenic
1164896387 19:31880954-31880976 TAGGAGGGAATGCCAGAGGGAGG - Intergenic
925529699 2:4845651-4845673 TACTGTGTAATGACAGAGGCAGG + Intergenic
926858898 2:17286807-17286829 TAGTGGTTAATTCCTGAGGATGG - Intergenic
926945316 2:18181522-18181544 TAATGGGGGATGCTAGAGGAAGG - Intronic
927522429 2:23707464-23707486 TTGTAGGTAGTGCCAGAGGGGGG + Exonic
929243107 2:39672928-39672950 AAGTGTGAAATGCCAGGGGATGG + Intronic
936044948 2:109180210-109180232 TAGTGGGGAATACCAGTGGAGGG - Intronic
937791878 2:125970467-125970489 TAGTGGGGAATGAAAGAGGGTGG + Intergenic
941392598 2:164932940-164932962 AAATGGGTAAAGACAGAGGAAGG - Intronic
942824903 2:180163864-180163886 TAGTGTGTAATGCCATATGGTGG + Intergenic
945696666 2:213115057-213115079 TAGTAGGTAATGCTGGATGATGG + Intronic
947848860 2:233267978-233268000 AAGTGGGTAATGACGCAGGAAGG - Intronic
1169165729 20:3421957-3421979 GAGTGGGAAATGCAAGAGGGAGG - Intergenic
1170102182 20:12714531-12714553 TAGAGGGAAAGGCCATAGGAAGG - Intergenic
1173288989 20:41697877-41697899 TAGTGGGCAAGGGAAGAGGAGGG - Intergenic
1173566005 20:44039166-44039188 AAGAGGGTGAGGCCAGAGGATGG + Intronic
1175268873 20:57719972-57719994 TAGTGGGAAGTGGGAGAGGAGGG + Intergenic
1175576034 20:60061402-60061424 TAGTGGGTAGGGGAAGAGGAGGG + Intronic
1175925914 20:62471259-62471281 GAGTGGATACAGCCAGAGGAGGG + Intronic
1178585051 21:33864748-33864770 AAGTTGCTATTGCCAGAGGATGG - Intronic
1180487165 22:15812650-15812672 AAGGGGGTAAAGCCAGAGTAGGG + Intergenic
1183950782 22:41351551-41351573 TCGTGGGTCATGCCTGGGGAGGG - Exonic
1184410111 22:44321496-44321518 GTGTGGGTGATGACAGAGGATGG - Intergenic
1184928423 22:47660895-47660917 TAGTGTGTATTGCCAGAGAGAGG - Intergenic
949199478 3:1357238-1357260 TAGTGGTTTATGCCAGTTGAAGG + Intronic
953025484 3:39142537-39142559 TGGTGGGTAATGCCAGGGGTGGG - Exonic
956843393 3:73160456-73160478 TACTGGGTCCTGCCAGAAGATGG + Intergenic
957566459 3:81890533-81890555 TTGTGGGAAGTGCAAGAGGAAGG + Intergenic
960916924 3:122704241-122704263 TAGTGAAGAAAGCCAGAGGAGGG + Intronic
961844935 3:129754485-129754507 TACAGGGTAATACCGGAGGAAGG + Intronic
964435129 3:156643433-156643455 TAGTGGTTATGGCCAGAGCAAGG + Intergenic
966731828 3:183158099-183158121 GAGTGGGAAGGGCCAGAGGAGGG - Intronic
967191737 3:186990841-186990863 TCCTGGGTAATGCCAGAAGCTGG - Intronic
967395918 3:189008891-189008913 TAGTGCCTAATGGCAGAGAATGG + Intronic
976703809 4:88000953-88000975 CAGTGGGGAATACAAGAGGAGGG + Intergenic
977103303 4:92846327-92846349 TACTGGGGACTGCCAGAGGGAGG - Intronic
980235118 4:130095597-130095619 TATGGGGTAATTCCAAAGGAGGG + Intergenic
983199929 4:164850436-164850458 TATTGGGAAATGGCTGAGGAGGG + Intergenic
993941479 5:94063490-94063512 CAGTGGGTCAGGCCAGTGGATGG - Intronic
995547755 5:113249829-113249851 TAGAGGGTGATACCAGAGTAAGG - Intronic
996165618 5:120219044-120219066 TAGAGGATAATGCCAGAAGTAGG + Intergenic
1004774382 6:18826560-18826582 CAGTGGGTAAGGTCAGAGGATGG - Intergenic
1009056000 6:58335820-58335842 TCATGGGTGATGCCACAGGATGG - Intergenic
1009235182 6:61114776-61114798 TCATGGGTGATGCCACAGGATGG + Intergenic
1011548086 6:88502298-88502320 TATTGGTTAAAGCCAGAGGGGGG + Intergenic
1011553887 6:88554877-88554899 TAGAGGGAAATTCCAGATGAAGG + Intergenic
1018337547 6:162810183-162810205 TACTGGGTGACCCCAGAGGAGGG - Intronic
1021759117 7:23886111-23886133 TAATGTGTAATGACTGAGGACGG + Intergenic
1022836780 7:34125216-34125238 TAGTGGGTAATGCCATTTCAGGG + Intronic
1025228338 7:57182229-57182251 AGGTGGCTCATGCCAGAGGAGGG - Intergenic
1029642488 7:101829872-101829894 TAGTGAGTAATGCAACAGGGGGG - Intronic
1029941178 7:104482221-104482243 AAGTGGGTAACAGCAGAGGAAGG - Intronic
1030340803 7:108377651-108377673 TGGTGAGTAATGAGAGAGGATGG - Intronic
1032268479 7:130384271-130384293 GAGTGGGGAAGGCCATAGGATGG - Intronic
1033078447 7:138271165-138271187 TGGTGGGGCATGCCAGTGGAAGG + Intergenic
1034354772 7:150443654-150443676 AAGTGGGTACAACCAGAGGACGG + Intergenic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1037856417 8:22374411-22374433 TACTGGGTGAGGCCAGAGGAGGG + Intronic
1039411963 8:37362402-37362424 CACTGGGGAATGCCAGAGGGTGG + Intergenic
1040684926 8:49860413-49860435 TAGTGGATAATGCCACAGAGAGG + Intergenic
1040760538 8:50836691-50836713 TACTGGGAAATACTAGAGGAGGG - Intergenic
1040803785 8:51371664-51371686 TAGTGTGGAATGGAAGAGGATGG + Intronic
1041187552 8:55316650-55316672 TGGTGGGGCAGGCCAGAGGAAGG - Intronic
1044445564 8:92271257-92271279 TAGTGTGTACTAACAGAGGAAGG - Intergenic
1047171402 8:122496593-122496615 TAGAGGGGAACGACAGAGGATGG + Intergenic
1047608988 8:126502262-126502284 TGGAGGGAAATGCCCGAGGAAGG - Intergenic
1047617012 8:126571053-126571075 TAGTTGGAAATGCCAGACAAGGG + Intergenic
1050930009 9:11310968-11310990 TAGTGGGGATTACCAGAGCAGGG + Intergenic
1054821620 9:69527077-69527099 GAGTGGGGAAGGACAGAGGAGGG + Intronic
1055659217 9:78485370-78485392 GAGTGGGTAATGACAGAGCAGGG - Intergenic
1056275953 9:84994459-84994481 TAGTGGCTGATCCCAGAGGATGG + Intronic
1058619796 9:106870986-106871008 AACTGGGAAATGCCAGAGGCTGG + Intronic
1059433278 9:114262429-114262451 TAGTGTGAACTGCCTGAGGAAGG + Intronic
1059785261 9:117575258-117575280 TAGGTTGTAATGTCAGAGGATGG - Intergenic
1188056142 X:25542812-25542834 AAGTGGGCAAAGCCAGAGGCTGG - Intergenic
1189996760 X:46646523-46646545 TAGTGGGGAGGGGCAGAGGAAGG + Intronic
1190765851 X:53475126-53475148 GAGGTGGTAATCCCAGAGGAGGG + Intergenic
1192430361 X:71107572-71107594 AAGTGGGGAATGCCAAATGAAGG + Exonic
1193846142 X:86473503-86473525 TAGTGGGTGATGGGGGAGGAAGG - Intronic
1194066113 X:89264529-89264551 AATTTGGTAATGCCAGAGGAAGG + Intergenic
1194105308 X:89760729-89760751 AAGTGGGTAATAACGGAGGATGG + Intergenic
1195950883 X:110271367-110271389 AACTGGCAAATGCCAGAGGAAGG + Intronic
1196105136 X:111887204-111887226 TAGTGGGTAATGCCAGAGGAAGG + Intronic
1198991973 X:142525097-142525119 TAGTGGGAGATACTAGAGGAAGG - Intergenic
1199932468 X:152537709-152537731 ATGTGGGTACTGCCAGTGGAAGG - Intergenic
1200457271 Y:3408546-3408568 AAGTGGGTAATAACGGAGGATGG + Intergenic
1200720283 Y:6598649-6598671 AATTTGGTAATGCCAGAGGAAGG + Intergenic
1201132518 Y:10963981-10964003 TAGAGGGTAATGCAATAGAATGG - Intergenic
1201530903 Y:14988885-14988907 TGGTGGTTAATGACAGAAGAGGG + Intergenic