ID: 1196106253

View in Genome Browser
Species Human (GRCh38)
Location X:111899092-111899114
Sequence TAGTGGGTGAGGAGAGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 757
Summary {0: 1, 1: 0, 2: 7, 3: 66, 4: 683}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196106253_1196106259 30 Left 1196106253 X:111899092-111899114 CCTTGCCCTCTCCTCACCCACTA 0: 1
1: 0
2: 7
3: 66
4: 683
Right 1196106259 X:111899145-111899167 ATAAAAAAAAAGCTAATACAAGG 0: 1
1: 0
2: 14
3: 223
4: 1912

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196106253 Original CRISPR TAGTGGGTGAGGAGAGGGCA AGG (reversed) Intronic
900191137 1:1352796-1352818 TACTGGCTGAGGACAGGGGAGGG - Exonic
900438205 1:2641239-2641261 AAGGGGGTGTGGAGAGGGCAGGG + Intronic
900524244 1:3120707-3120729 TAGTCGGTGAGGAGAGGGTCTGG + Intronic
901154011 1:7123516-7123538 GAGCAGGTGTGGAGAGGGCAGGG - Intronic
901930869 1:12595587-12595609 GAGCGGGTGAGGAGGGGGCCAGG + Intronic
902332624 1:15738074-15738096 CAGTCTGTGGGGAGAGGGCACGG - Exonic
902550529 1:17216517-17216539 GAGTGGGGAAGGAGTGGGCATGG + Intronic
902687312 1:18086878-18086900 TAGTTGGTGGGGAGTGGGTATGG - Intergenic
903849036 1:26295366-26295388 GTGTGGGTGAGGAGAGGACGGGG - Intronic
904328351 1:29742013-29742035 TACTGGGTGTGGAGAAGGGATGG + Intergenic
904392103 1:30192808-30192830 TTGAGGGTGAAGAGAGGGAAAGG + Intergenic
904629697 1:31831573-31831595 TAGTGGCTGGGCAGAGGGAAGGG - Intergenic
904656423 1:32051630-32051652 TGGTGGGGGAAGAGAGGGCTAGG - Intronic
904995312 1:34626928-34626950 CAGAGGAGGAGGAGAGGGCAAGG + Intergenic
905199407 1:36306261-36306283 GAGTGGGTGTGGAGAGGGGGCGG - Intergenic
905441513 1:37999240-37999262 TCGAGGGTAAGGAGAGGGCCAGG - Exonic
905460227 1:38117707-38117729 GAGTGGGGCAGGAGAGGGCCTGG + Intergenic
906675179 1:47688264-47688286 CAGGGGATGAGGAGAGGCCAGGG - Intergenic
906754553 1:48297644-48297666 TAGAGAGTGAGGGGAGGGAAAGG - Exonic
908320192 1:62971275-62971297 AAGGGGGTGAGGAGAGTGCAAGG + Intergenic
908424849 1:63996833-63996855 GATTGGGTGAGGAGAGATCATGG + Intronic
910867460 1:91801418-91801440 CACTGGGTGAGGAGAGGGAAAGG + Intronic
910867652 1:91802872-91802894 CATTGGGTGAGGAGAGGGAAGGG - Intronic
911475525 1:98367683-98367705 CAGTGGGGGAGGAGTGGCCAGGG - Intergenic
911520983 1:98930730-98930752 TAGTGAGTAAGTAAAGGGCAGGG + Intronic
911669934 1:100596428-100596450 TACTGGGGGTGGAGTGGGCAGGG - Intergenic
912480248 1:109977604-109977626 GAGTGGGTGATGTGAGGGCCTGG - Intergenic
912777275 1:112513610-112513632 AAGTGGGTGAGGAGAAGGGAGGG - Intronic
913197476 1:116469979-116470001 TAGGGGGTGTGCTGAGGGCATGG + Intergenic
913203556 1:116515633-116515655 TAGTGGGTGAGGAGACTGCTGGG - Intronic
913338552 1:117733591-117733613 TTGATGGTGAGGAGAGGTCAAGG - Intergenic
913978818 1:143489125-143489147 TGGTGGTTGAGGAGAGGTCTTGG - Intergenic
914073224 1:144314774-144314796 TGGTGGTTGAGGAGAGGTCTTGG - Intergenic
914105930 1:144651586-144651608 TGGTGGTTGAGGAGAGGTCTTGG + Intergenic
914667988 1:149847929-149847951 TAGTGGGTTTGGAGAGAGCATGG + Intronic
915130748 1:153693806-153693828 GACTAGGTGAAGAGAGGGCAGGG + Exonic
915141938 1:153773337-153773359 TAGAGGCTGAGGAGATTGCAGGG + Exonic
915147352 1:153802894-153802916 TAGTGGGAGAGAAGAGGGTGTGG + Intergenic
915300180 1:154947292-154947314 TAGTGGGAGAGGGGAGGGTCAGG + Intronic
915300670 1:154949809-154949831 TAGTGGGAGAGGGGAGGGTCAGG + Intronic
915460252 1:156066177-156066199 AAGTGGGGGAGGAGGAGGCAAGG + Intronic
915897760 1:159824832-159824854 TCATGGGGGTGGAGAGGGCAAGG - Intergenic
915907539 1:159889821-159889843 TAGTGGGTGGAGCCAGGGCAGGG + Intronic
915914206 1:159931428-159931450 TAGTGGCTGGAGAGAGGGCCAGG - Intronic
916225754 1:162488175-162488197 TAGTGGGTGAGCTGCGGGCCTGG + Intergenic
916961896 1:169896939-169896961 AAGGGGGTGAGGAGTGGGAATGG - Intergenic
917306801 1:173634837-173634859 TAGTGGGTGAGGGGTGAGGAAGG - Intronic
917484922 1:175447213-175447235 GAGTGGGTGAGGAGGGGGTGGGG + Intronic
917498561 1:175564907-175564929 TAGTGGTGAAGGAAAGGGCAAGG - Intronic
917512596 1:175680684-175680706 TAAGGGGTGGGGACAGGGCATGG + Intronic
917519116 1:175733571-175733593 TAGGGGTAGAGGGGAGGGCATGG + Intronic
918067549 1:181111621-181111643 TAGTGGGGGTGGGGAGGACACGG - Intergenic
918701309 1:187611836-187611858 TAGTGGGGGATGGGAGGGCATGG + Intergenic
918739153 1:188104794-188104816 CAGTGGGTAAGGGGAGGACAGGG + Intergenic
919704181 1:200660476-200660498 GAGGGGCTGAGGAGAGTGCAGGG + Intronic
919776476 1:201197391-201197413 TAGTGAGGGAGGGGAGGGGAGGG + Intronic
919881319 1:201903054-201903076 TGGGGTGTGGGGAGAGGGCAGGG + Intronic
919933634 1:202237217-202237239 TGGAGGGAGAGGAGAGGGCTGGG - Intronic
919938869 1:202272846-202272868 AAGTGGGTCAGGGCAGGGCAAGG - Intronic
920131681 1:203736896-203736918 GGGTGAGGGAGGAGAGGGCATGG - Intronic
920222886 1:204417003-204417025 AAGGGGGGGAGGAGAGGGAAGGG + Intergenic
920859901 1:209697290-209697312 GAGTGTGTGGGGAGAGGGGAGGG - Intronic
920947573 1:210544141-210544163 CAGTGGGTGAATAGAGGGCACGG - Intronic
921131843 1:212226415-212226437 CAGTGAGTGAGGAAAGGGCATGG - Intergenic
921287334 1:213621117-213621139 TAGTGGGGGCAGAGAAGGCAGGG - Intergenic
922468168 1:225859140-225859162 TAGCTGGTGAGAAGAGGGCTTGG - Intronic
922920813 1:229301301-229301323 GAATGGGCAAGGAGAGGGCAGGG + Intronic
923191962 1:231627714-231627736 TGCTGGGTGAGGACAGGGCTGGG + Intronic
923465297 1:234243010-234243032 TAGTGGGGGAGTAGGGGGAATGG + Intronic
1062841072 10:672392-672414 TAGTGGGAGTGGACAGTGCATGG - Intronic
1063236921 10:4126827-4126849 TAGTGGGTAAGGGGAAGCCAGGG + Intergenic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1063781188 10:9327153-9327175 GTTTGGGTGAGGAGAGGGAAAGG + Intergenic
1064794153 10:18992333-18992355 TAGTGGGGGAGAAGTGGGGATGG + Intergenic
1065454711 10:25894864-25894886 TGGTGGGGAAGGAGAGGTCATGG + Intergenic
1065705313 10:28466844-28466866 TAGAGGCTGGGGAGAGGACAGGG + Intergenic
1066199001 10:33128029-33128051 GGGTGGGTGAGGAGAGGGAAGGG - Intergenic
1066661574 10:37741827-37741849 CAGTGGGGGCGGGGAGGGCAGGG + Intergenic
1067069916 10:43123912-43123934 TGGGGGGTGGGGAGTGGGCAGGG + Intronic
1067455195 10:46414230-46414252 TGGTGGGTGAGCTGAGGGTAAGG - Intergenic
1067632005 10:47970404-47970426 TGGTGGGTGAGCTGAGGGTAAGG + Intergenic
1067647546 10:48123229-48123251 TAGTGTGTGAGTATAGGGCTGGG + Intergenic
1067704577 10:48597417-48597439 CAGTGGGTGAGGAGAGGCAGTGG + Intronic
1068780463 10:60914188-60914210 TTTTGGGTGTGGAGGGGGCAGGG + Intronic
1068959672 10:62853988-62854010 TGGAGGATGAGTAGAGGGCAAGG - Intronic
1069548197 10:69343772-69343794 TCGAGGGGGAGGACAGGGCAAGG - Intronic
1069738062 10:70670483-70670505 CAGAAGGTGGGGAGAGGGCAAGG - Intergenic
1070183716 10:74039443-74039465 TAGGTGGTGAGGGGAGAGCAGGG - Intronic
1070362535 10:75704877-75704899 CAGTGAGAGAGGAGAGGGAAAGG + Intronic
1070407340 10:76108707-76108729 TAGGTGCTGAGCAGAGGGCAGGG - Intronic
1071586700 10:86830023-86830045 CAGTGGGTGGGGAGAGAGCGTGG + Intronic
1072000761 10:91193555-91193577 TAGTTGGAGGGGAGAGAGCAGGG + Intronic
1072522373 10:96239799-96239821 TAGAGGGAAAGGAGAGGGCCTGG + Intronic
1073053668 10:100685617-100685639 TGGTGGGTGAGGAGAAGGAGGGG + Intergenic
1073189412 10:101640247-101640269 TAGGGGGTGAGGAGATGGTCTGG + Intronic
1073400040 10:103249938-103249960 CAGTGGGTGGGAAGGGGGCATGG + Intergenic
1073747869 10:106490573-106490595 TAGTGGGAGGGAATAGGGCAAGG - Intergenic
1074485058 10:113868253-113868275 AAGAGGGAGAGAAGAGGGCAAGG - Intronic
1074713034 10:116193254-116193276 GAGTGGGTGTGGAGGTGGCAGGG - Intronic
1075024791 10:118976570-118976592 TGGGGGGTGAGGTGAGGGGAGGG + Intergenic
1075187252 10:120274160-120274182 TAGTGGATGAAGAGATGGCATGG - Intergenic
1075447230 10:122521550-122521572 TGGTGGGTGAGGGGAGGAGACGG - Intergenic
1075737091 10:124670599-124670621 GAGTGGGTGTGGTGAGTGCAGGG - Intronic
1076117974 10:127913853-127913875 TGGTGGATGAGGTGGGGGCAGGG - Intronic
1076438630 10:130463659-130463681 GAGTGGGTGGGCAGAGTGCAGGG + Intergenic
1076865049 10:133162326-133162348 TCCTGGGTGAGGTGAGGGCACGG + Intronic
1077214442 11:1389528-1389550 TAGGGGGCGAGGCGAGGCCAGGG - Intergenic
1077216055 11:1395588-1395610 CAGTGGGTGGGGACAGGACAAGG - Intronic
1077666614 11:4116121-4116143 TGCTGGGTGAGGAGTGGTCAGGG + Intronic
1077799640 11:5525078-5525100 AAGGGGGTGTGGAGAGGGTATGG + Intronic
1077998683 11:7475664-7475686 TATTGGGTGAGGAGGGGAGAAGG + Intergenic
1078008132 11:7547843-7547865 TTGTGGAGGGGGAGAGGGCAGGG - Intronic
1078142872 11:8704263-8704285 ATGTGGGTGGGGAGAGGTCAGGG + Intronic
1078234652 11:9472986-9473008 TAGTGGGAGAGAGGAGAGCAGGG + Intronic
1078875486 11:15390976-15390998 GAGTGGGGGAGGGGAGGGAAGGG + Intergenic
1078891102 11:15559967-15559989 TAGTGGGTGCAGTGAGGGGAGGG - Intergenic
1079079795 11:17406268-17406290 GAGAGAGTGAGGGGAGGGCAGGG + Intronic
1079258527 11:18853635-18853657 TAGTGAGAGAGGAAAGGGAAAGG + Intergenic
1079376153 11:19893826-19893848 AAGTGGGAGAGAAGAGGGCAAGG - Intronic
1081655304 11:44853293-44853315 GAGTGGGTGGGGAGAAGGGAGGG + Intronic
1081668768 11:44931815-44931837 TTGTGGGGGAGGGGTGGGCAGGG + Exonic
1081867941 11:46369895-46369917 CACTGGGTGAGGGGTGGGCAGGG - Intronic
1082715424 11:56606325-56606347 TAGTGGGTCAGTAGAGGTGATGG - Intergenic
1083097762 11:60269044-60269066 TAGAGGGTGAGAAGAGGGTAAGG - Intergenic
1083423638 11:62571151-62571173 TAATGGGGGAGGTGAGGGAAAGG - Intronic
1083595308 11:63916093-63916115 GAGGGGGTGAGGGCAGGGCAGGG + Intronic
1083630148 11:64091119-64091141 GAGAGGGTGGGGAGGGGGCATGG + Intronic
1083660805 11:64251065-64251087 GAGTGGGTGAGGCGAAGCCAGGG + Intergenic
1083669149 11:64290952-64290974 AAGTGGGTGAGAACAGGGCGGGG + Intergenic
1084164906 11:67371056-67371078 GAGTGGGTGAGGAGTGGGCTAGG + Intronic
1084395599 11:68907661-68907683 TATTGAGAGAGGAGAGGGCCAGG + Intronic
1085452685 11:76644911-76644933 TAGTGTGCCTGGAGAGGGCATGG + Intergenic
1086191484 11:84084396-84084418 TAGTGGTGGGGGAGAGGGAAGGG + Intronic
1086243653 11:84725393-84725415 CAGTAGGAGAGGAGAGGGAAAGG - Intronic
1087316462 11:96609216-96609238 TCGGGGGTGAGGGGAGGGGAGGG - Intergenic
1088574161 11:111253539-111253561 TAGTGGTGGATGGGAGGGCAAGG - Intergenic
1088634369 11:111805651-111805673 TAGTGGGGGAGAATAGAGCATGG + Intronic
1088934205 11:114382510-114382532 TAGAGGGTGGGAAGAGGGAAAGG - Intergenic
1089233387 11:117001095-117001117 TAGTGGGTGGGGCGATAGCACGG + Intronic
1089374791 11:117986564-117986586 GAGCGGGCGCGGAGAGGGCAGGG - Intronic
1089614066 11:119685361-119685383 GCGTGGGAGAGGAGGGGGCACGG + Intronic
1089640985 11:119847079-119847101 TGGTGGATGAGGTGAGGGGAAGG + Intergenic
1089769226 11:120790813-120790835 TAGTGGGTGAGCAGATGGAGGGG + Intronic
1089966346 11:122656916-122656938 GAGTGGGGTAGGGGAGGGCAGGG + Intronic
1090267700 11:125363849-125363871 GAGTGGGGGTGGGGAGGGCAGGG + Intronic
1090405399 11:126473241-126473263 GAGTGGGTGGGGAGGGGGCTAGG - Intronic
1090689944 11:129170316-129170338 TGGAGGGTGAGGGGAGGGGACGG - Intronic
1090819823 11:130331485-130331507 TGCTGGGTGAGGAGTGGGCGGGG + Intergenic
1090867327 11:130713268-130713290 CGGTGGGACAGGAGAGGGCATGG - Exonic
1091081570 11:132673907-132673929 TAGTGGGTTAGGAGAGAAAAGGG - Intronic
1091130541 11:133143360-133143382 GAATGGGAGAGGAGAGGACATGG - Intronic
1091161751 11:133429063-133429085 TAGTGGGTATGGAAAGGGAATGG + Intronic
1091931209 12:4396830-4396852 TAGTGGCTGAGAAGAGGGCATGG + Intergenic
1092090873 12:5802753-5802775 CAGTTGGTGAAGAGAGGACATGG - Intronic
1092128155 12:6089808-6089830 CAGTGGGTGAGGTGGGGTCAGGG - Intronic
1092145683 12:6212943-6212965 GAGTGGGCCAGGAGCGGGCAAGG + Intronic
1092274441 12:7048473-7048495 TAATAGGTGAGGAGAGGAGAGGG - Intronic
1092522090 12:9285715-9285737 TAGGGGGTGAGGAGTGGGGGTGG + Intergenic
1092545192 12:9446141-9446163 TAGGGGGTGAGGAGTGGGGGTGG - Intergenic
1092579758 12:9826256-9826278 TAGAGGGTGGGAAGAGGGAAAGG - Intergenic
1092632490 12:10397406-10397428 TGGTGGGTGGGCAGAAGGCACGG - Intronic
1092940493 12:13403101-13403123 TAGTGGCTGCTGAGCGGGCAGGG + Intergenic
1093423206 12:18998679-18998701 TAGGTTGGGAGGAGAGGGCAGGG + Intergenic
1093491671 12:19711738-19711760 TGATGGCTGAGGAGATGGCATGG + Intronic
1093766978 12:22975241-22975263 TATTGGGAGTGGGGAGGGCAGGG - Intergenic
1093972183 12:25385554-25385576 AAGGGGGTGGGGAGAGGGAAAGG + Intergenic
1094507755 12:31075908-31075930 TAGGGGGTGAGGAGTGGGGGTGG + Intronic
1094536672 12:31327262-31327284 TAGAGGGTGGGGAGAGAGGAAGG + Intergenic
1094584024 12:31760434-31760456 AAGTAGGTGAGGACCGGGCACGG + Intergenic
1094599761 12:31898203-31898225 GAGTGGGGGAGGGGAGGGGAGGG + Intergenic
1095233802 12:39773464-39773486 TGGTGGGTGTTGAGTGGGCAGGG - Intronic
1096218279 12:49810190-49810212 AAGGGGGTGGGGAGAGGGAAGGG + Intronic
1096253380 12:50047930-50047952 TAGTGGTTGATGAGAAGGAAGGG + Intergenic
1096616283 12:52835046-52835068 TGGAGGCTGAAGAGAGGGCAGGG + Intergenic
1096985338 12:55752373-55752395 TGGTGGGTGGGGGGGGGGCAGGG + Exonic
1097041472 12:56158464-56158486 TGGGGGGCGAGGAGAAGGCAGGG + Intronic
1097050630 12:56221281-56221303 GAGGGGGTGAGGAGCGGGGAAGG + Intronic
1097102213 12:56597816-56597838 CAGTAGCTGGGGAGAGGGCAGGG - Exonic
1097177065 12:57149407-57149429 CAGCGGGGGAGGAGAGGACAGGG - Intronic
1097191734 12:57222653-57222675 AAGTGGGCTTGGAGAGGGCAGGG - Intronic
1097242624 12:57586135-57586157 TAGTGGGTCTGGAGACAGCATGG - Exonic
1099256129 12:80315068-80315090 TAGTGGTTGGGAAGTGGGCAGGG + Intronic
1101063149 12:100992529-100992551 TAGTGGGGAAGGAGAGGGTCAGG - Intronic
1101168187 12:102061123-102061145 AATTGGGTGATGAGAGGTCACGG + Intronic
1101739933 12:107492904-107492926 TGCTGGGTGAGCTGAGGGCAGGG + Intronic
1102460139 12:113094963-113094985 CAATGGCTGAGGAGTGGGCAGGG + Intronic
1103741188 12:123092689-123092711 GGATGGGTTAGGAGAGGGCATGG - Intronic
1104066861 12:125313630-125313652 AGGTGGGGGAGGAGAGGGGAGGG - Intronic
1104091376 12:125520647-125520669 TAGAGGGTGATGAGCTGGCAGGG - Intronic
1104296439 12:127519043-127519065 TAGTGGGTGAGGTCAGGGGAGGG - Intergenic
1104578509 12:129990764-129990786 TGTTGAGTGAGGAGAGGGCATGG + Intergenic
1104578539 12:129990915-129990937 TGCTGGCTGAGGAGAGGGTATGG + Intergenic
1104578544 12:129990944-129990966 TGTTAGGTGAGGAGAGGGTATGG + Intergenic
1105036975 12:132932193-132932215 TGGAGGTTGGGGAGAGGGCAGGG - Intronic
1105220514 13:18322265-18322287 TGGTGGTTGAGGAGAGGTCTTGG + Intergenic
1106075488 13:26457352-26457374 AAGTGGGAGAGGAGGGGACAAGG - Intergenic
1106520936 13:30497180-30497202 GTGTGAGTGAAGAGAGGGCAGGG - Intronic
1107314248 13:39114144-39114166 TATTGGGGGAGGGGAGGGGAGGG - Intergenic
1107381407 13:39860510-39860532 TAGCAGGTGTGGACAGGGCATGG + Intergenic
1107842203 13:44470063-44470085 TAAGGGGAGAGGAGAGGGCATGG - Intronic
1108579954 13:51819563-51819585 TAGTGGGAGAGAAGGGGGCCAGG - Intergenic
1110780990 13:79464750-79464772 TGGTGGGTGAGGAGATGGTTGGG + Intergenic
1110805154 13:79745595-79745617 AACTGGGTGAGAAGAGGGCCTGG - Intergenic
1111133944 13:84014139-84014161 GAGTGGGTGAGGAAAGGAGAAGG + Intergenic
1112323837 13:98430370-98430392 TAGGGGGAGAGCAGAGGACAGGG - Intronic
1112441233 13:99426414-99426436 GGCTGGGTGTGGAGAGGGCAGGG - Intergenic
1113531708 13:111032221-111032243 TATTGGGAGAGGAGTGGGAAAGG - Intergenic
1113744324 13:112732343-112732365 TAGTGGGTGATTAGAGGTCCTGG + Intronic
1114662047 14:24353175-24353197 GAATTGGTGAGGAGAGAGCAGGG + Intergenic
1116601764 14:46934858-46934880 CAGTGGGTGAGGAAAGCACAAGG + Intronic
1116933768 14:50716385-50716407 AAAGGGGTGGGGAGAGGGCAAGG + Intergenic
1116944755 14:50826252-50826274 TAGATGGTGAGGAGAGGCCCAGG - Intronic
1117792052 14:59351458-59351480 CAGTGGGAGAGGGCAGGGCAGGG - Intronic
1118006397 14:61567947-61567969 TAGTGGGACTGGAGAGCGCAAGG - Intronic
1118604368 14:67492064-67492086 AAGGGGGAGAGGAGAGGGAAAGG - Intronic
1118608622 14:67522247-67522269 GAGTGGGAGAGGAGCGGGTACGG - Intronic
1118682979 14:68262380-68262402 GGGTGGGTGAGAAGAGGGGAAGG - Intronic
1119682637 14:76604376-76604398 TAGTGAAAGAGGAAAGGGCATGG + Intergenic
1119731393 14:76953539-76953561 AAGTGGGTGAGAGGAGGGAAGGG - Intergenic
1121321697 14:92995268-92995290 GAGTGGGTGAGCAGAGGGCAGGG - Intronic
1121339856 14:93098910-93098932 GAGTGGGGCAGGTGAGGGCAAGG - Intronic
1121649769 14:95549359-95549381 TCTTGGGAGAGCAGAGGGCAAGG + Intergenic
1122633318 14:103118123-103118145 AAGTCGGGGAGGAGAGGGGAGGG - Intergenic
1122874489 14:104657390-104657412 TTGTGGGATAGGAGATGGCACGG - Intergenic
1123125244 14:105941412-105941434 CACTGTGTGAGGAGAGGGCGAGG + Intergenic
1124687166 15:31792444-31792466 TATGGGGAGAGGGGAGGGCAAGG - Intronic
1125541204 15:40471091-40471113 TAGTTGGGGAGGGGAGGGCAGGG - Exonic
1125786426 15:42322481-42322503 TAGCGGGTGGGGACAGGGCAAGG + Intronic
1126334444 15:47570839-47570861 TAGTGGGTTGGAAGAGGCCAGGG + Intronic
1126378954 15:48026485-48026507 CAGTGTGTGTGGAGAAGGCATGG - Intergenic
1126662183 15:51044052-51044074 TCATGGCTGGGGAGAGGGCAGGG + Intergenic
1126676561 15:51163767-51163789 GACTGGATAAGGAGAGGGCAAGG + Intergenic
1126849276 15:52787641-52787663 GAGTGGGGGGGGAGGGGGCATGG + Intronic
1127358775 15:58226716-58226738 TAGAGGGTGGGAAGAGGGGAGGG + Intronic
1127551688 15:60044782-60044804 TTGTGGGTGAGGAGAGGAGGTGG - Intronic
1127698625 15:61475449-61475471 CAGTGGGAGGGAAGAGGGCAAGG + Intergenic
1127815063 15:62600770-62600792 TAATGGGTGGGAAGAGGGAAGGG - Intronic
1128609197 15:69060226-69060248 TCGTGGGAGGGGAGGGGGCATGG + Intronic
1128767619 15:70260803-70260825 GAGAGGGTGACGAGATGGCAAGG + Intergenic
1129182131 15:73884297-73884319 AAGTGGCTGAGAAGGGGGCAGGG - Intronic
1129275394 15:74442114-74442136 CAGTGGATGCAGAGAGGGCAGGG - Intergenic
1129763684 15:78147747-78147769 TGGTGTGAGAGGAGAGTGCAAGG + Intronic
1129797729 15:78390916-78390938 TGGTCAGTGTGGAGAGGGCAGGG - Intergenic
1132734598 16:1379294-1379316 GAGCGGGGCAGGAGAGGGCAGGG - Intronic
1132803510 16:1765421-1765443 TAGAGGGTGACGGGTGGGCACGG + Intronic
1132886918 16:2186412-2186434 TCCTGGGGCAGGAGAGGGCAGGG - Intronic
1133194500 16:4159325-4159347 AAGTTGGAGAGGAGAGGGGATGG + Intergenic
1133972606 16:10578612-10578634 GAGTGGGTGAGGGCAGGGCCAGG - Intronic
1134071633 16:11263740-11263762 TAGGGGGTGAGGTGAGGTCTGGG - Intronic
1134523236 16:14927891-14927913 AAGGGGGAGAGGAGAGGGGAGGG - Intronic
1134523247 16:14927919-14927941 AAGGGGGAGAGGAGAGGGGAGGG - Intronic
1134523268 16:14927976-14927998 AAGGGGGAGAGGAGAGGGGAGGG - Intronic
1134523276 16:14927994-14928016 AAGGGGGAGAGGAGAGGGAAGGG - Intronic
1134523283 16:14928012-14928034 AAGGGGGAGAGGAGAGGGAAGGG - Intronic
1134523290 16:14928030-14928052 AAGGGGGAGAGGAGAGGGAAGGG - Intronic
1134603093 16:15548951-15548973 GAATGGGTGGGAAGAGGGCAGGG + Intronic
1134665878 16:16018182-16018204 TTGTGGGTGACGAAAGGGCTTGG + Intronic
1134829873 16:17314294-17314316 TTGTGGGTGATGAGTGGGCCTGG - Intronic
1134948690 16:18342078-18342100 AAGGGGGAGAGGAGAGGGGAGGG + Intergenic
1135149798 16:19995390-19995412 GAGAGGGTCAGAAGAGGGCAAGG - Intergenic
1135293964 16:21263510-21263532 CCGGGGGTGAGGAGAGGGAAAGG - Intronic
1135338722 16:21628460-21628482 AAGTGGGGGAGGACAGGGGAGGG - Intronic
1135483947 16:22847120-22847142 TGGAGGGTGGGAAGAGGGCAAGG - Intronic
1135995420 16:27244333-27244355 TAGTGAGTGGGGAAAGGGAAGGG - Intronic
1136568706 16:31084500-31084522 TATTGGGTGAGGGGATGCCAGGG + Intronic
1137530081 16:49273879-49273901 TAGGGGGTGGGGAGACGGGAGGG + Intergenic
1137729080 16:50676923-50676945 AAGTGGGTGCCAAGAGGGCACGG - Intronic
1138092169 16:54183934-54183956 AAGGAGGTGTGGAGAGGGCATGG + Intergenic
1138648586 16:58443556-58443578 TAGGGAGTGAGGAGAGGGTGTGG + Intergenic
1139547370 16:67655979-67656001 TAGGGTGTGGGGAGCGGGCAGGG + Intronic
1139696794 16:68680816-68680838 CAGTGGGTGAGGGGTGGTCAAGG + Intronic
1139821365 16:69723993-69724015 TAGTGTGTTAGGAGAGGTAAGGG + Intronic
1140239367 16:73187432-73187454 TAGCTAGTTAGGAGAGGGCAGGG - Intergenic
1140359515 16:74332523-74332545 CAGTGGGGGAGGGGAGGGGAGGG + Intergenic
1140947787 16:79786418-79786440 TAGTGGTGGAGGAAATGGCATGG - Intergenic
1141552561 16:84815926-84815948 TTGTTGGAGAGGAGGGGGCAAGG - Intergenic
1141558128 16:84849334-84849356 TGGTGGGTGAGGGGAGGGGCTGG + Intronic
1141570539 16:84930990-84931012 GAGTGGGTGTGGCAAGGGCATGG + Intergenic
1141645832 16:85367060-85367082 CAGTGGGTGAGCAGAGGCCACGG - Intergenic
1142254182 16:89006114-89006136 GGGTGGCTGAGGAGAGGGCAAGG + Intergenic
1142333984 16:89474986-89475008 GCAGGGGTGAGGAGAGGGCAGGG - Intronic
1142338643 16:89506889-89506911 TAGTGGAGGAGGAAACGGCAAGG + Intronic
1142669765 17:1482745-1482767 TAGTGTGGGAGGGGAGGGGAGGG - Intronic
1142669776 17:1482777-1482799 CAGTGTGGGAGGGGAGGGCAGGG - Intronic
1142864065 17:2779772-2779794 CAGTGGGGGAGGACAAGGCAGGG + Intronic
1143125970 17:4641104-4641126 GAGTGGGTGGTGAGAGGGAAGGG - Intronic
1143164582 17:4891575-4891597 CAGTGGGTGCGGGGATGGCAGGG - Exonic
1143402512 17:6655719-6655741 GAGTGGGTGGTGAGAGGGAAGGG + Intergenic
1143504156 17:7354787-7354809 CAGTGGGGGAGGAGATGGGAAGG + Exonic
1143953808 17:10653649-10653671 AAGGAGGTGAGGACAGGGCAGGG - Intronic
1144523059 17:15967118-15967140 AAGTGGGAAAGGAGAGGGCGTGG + Intronic
1144862002 17:18310607-18310629 GAGGGGCTGAGGAGAGGGTAAGG + Intronic
1145204023 17:20971128-20971150 TGGTGGTGGAGGAGGGGGCAGGG + Intergenic
1145787146 17:27601542-27601564 TAGAGGATGGGAAGAGGGCAGGG + Intronic
1145812442 17:27772611-27772633 TAGTGGGTGAGGGGAGGAAAAGG - Intronic
1145988755 17:29065488-29065510 AAGCTGGTCAGGAGAGGGCAGGG - Intergenic
1146305838 17:31729309-31729331 CAGTGGGGGAGGGAAGGGCATGG - Intergenic
1146597064 17:34178621-34178643 TTGTTGGAGAAGAGAGGGCAAGG + Intergenic
1146787635 17:35732792-35732814 TAGGGGAGGAAGAGAGGGCAAGG - Intronic
1147135540 17:38431915-38431937 AAGAGGGAGAGGGGAGGGCAGGG + Intronic
1147308207 17:39578216-39578238 GAGTGAGAGAGGAGGGGGCAGGG - Intergenic
1147630248 17:41925658-41925680 AAGTGGGGGAGGGGAGGCCAAGG + Intronic
1148110192 17:45139997-45140019 TAGTGGGGGCAGAGAGGGCTGGG + Intronic
1148799444 17:50213998-50214020 TAGGGGGTGAGGGGAGGTCTGGG + Intergenic
1148816124 17:50329385-50329407 AAGTGGGAGAGGAGAAGGGAGGG - Intergenic
1148856429 17:50581484-50581506 TGGTGGGAGAGGACAGGGCCTGG - Intronic
1149011990 17:51866350-51866372 TAGGGGGAGTGCAGAGGGCATGG - Intronic
1149257038 17:54837951-54837973 TTGTGGGTGTGGATAGGGCTGGG + Intergenic
1149728322 17:58919934-58919956 TATGGGGTCAGGGGAGGGCAGGG + Intronic
1150895654 17:69207751-69207773 CAGTGGGTGGAGAGAGAGCAGGG + Intronic
1151007575 17:70455684-70455706 CAGTGGGTGGGGAGAGGGGTAGG - Intergenic
1151599778 17:75099088-75099110 GAGTGGGTGGGGAGCGGGGAAGG + Intronic
1151661043 17:75518230-75518252 TGGAGTGTGAGGAGAGGTCAAGG + Intronic
1151930190 17:77227442-77227464 TTCTGGGAGAGCAGAGGGCAGGG - Intergenic
1152084759 17:78211319-78211341 GGGTGGGAGAAGAGAGGGCAAGG + Intergenic
1152240201 17:79157022-79157044 CAGCGGCTGAGGAGAGCGCAGGG - Intronic
1152263378 17:79279122-79279144 GAGGAGGAGAGGAGAGGGCAGGG + Intronic
1152578835 17:81157112-81157134 TGGCAGGTGAGGACAGGGCAGGG + Intronic
1153215528 18:2816929-2816951 TAGTGTGCCTGGAGAGGGCATGG + Intergenic
1153582485 18:6588431-6588453 TAGGGGGAGAGAAGAAGGCATGG + Intronic
1153640727 18:7154792-7154814 AATTGAGAGAGGAGAGGGCAGGG + Intergenic
1154031203 18:10755904-10755926 TAGAGGGTGAGGAGGAGGGATGG + Intronic
1155074423 18:22342236-22342258 CAGTGGGTAAGTTGAGGGCAGGG + Intergenic
1155461489 18:26089948-26089970 TAGAGTTTGAGGAGCGGGCAAGG - Intronic
1155706992 18:28828323-28828345 GTGTGGGTGAGCAGATGGCAAGG - Intergenic
1155906484 18:31458377-31458399 AAGTGGGGGTGGAGAGGGAAAGG + Intronic
1157186077 18:45540957-45540979 AAGAGGGTGATGAGAGGGAAGGG + Intronic
1157280211 18:46341978-46342000 TATTGGGAGAGGAGAGGGCAGGG + Intronic
1157284646 18:46369394-46369416 GGGTGGGAGAGGACAGGGCAGGG + Intronic
1157557512 18:48622339-48622361 TCATGGGTCAGGAGAGGGCTGGG + Intronic
1158000472 18:52612584-52612606 AAGAGGCTGATGAGAGGGCAGGG - Intronic
1158196131 18:54886989-54887011 GAGTTGGCGAGGGGAGGGCAGGG - Intronic
1158456275 18:57610722-57610744 TAATGGGTGGGGAGAGGGGGCGG + Intronic
1158847596 18:61461409-61461431 TAGTGGCTGTGGAGGGAGCATGG - Intronic
1159318651 18:66815936-66815958 TAGTGGGCCAGGAATGGGCAAGG - Intergenic
1159455147 18:68651982-68652004 TAGTGGTTGAGGAGAAGACCTGG + Intergenic
1160917574 19:1504492-1504514 CACTGTGTGAGGTGAGGGCAGGG - Intergenic
1161080806 19:2309071-2309093 GAGTGAGTGAGGACAGGCCAGGG - Intronic
1161902670 19:7131235-7131257 TGGTGGGTGAGAAGAGGGAAAGG + Intronic
1162052588 19:8043695-8043717 CAGAGGGTGAGGTGAGGGCAGGG - Intronic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162145150 19:8608855-8608877 CAGGGGGTGAGGACAGGGGAAGG + Intronic
1162485259 19:10956369-10956391 AAGAAGGGGAGGAGAGGGCAGGG - Intergenic
1162875441 19:13617842-13617864 TTGGGGATGAGGAGAGGGAAAGG - Intronic
1162998912 19:14353657-14353679 GAGTGGGGGAGGGGATGGCAGGG + Intergenic
1163439439 19:17314296-17314318 GGGTGGGTTAGGAGAGTGCATGG - Intronic
1163490872 19:17616551-17616573 GAGTGTGTGTGGAGGGGGCAGGG + Intronic
1163551451 19:17968062-17968084 TATTGGGGGAGGGGAGGGGAAGG + Intronic
1163635115 19:18433954-18433976 GAGAGGTTGAGGAGAGGGAAAGG - Intronic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1164649483 19:29881694-29881716 CAGTGGGTGAGGGATGGGCAGGG + Intergenic
1164998715 19:32743352-32743374 GAGTGGGGGAGGGGAGGGGAGGG - Intronic
1165478847 19:36049484-36049506 AAGAGGCTTAGGAGAGGGCATGG - Intronic
1165764298 19:38341115-38341137 GAGTGTGGGAGGAGAGGTCAGGG + Intronic
1166494030 19:43285380-43285402 TGGTGAGTGAGGGGAGGGAAGGG + Intergenic
1167457014 19:49601668-49601690 TGGTGGTGGAGGCGAGGGCATGG - Exonic
1167602046 19:50459957-50459979 GAGGGGGTGTGGAGAGGGGAGGG + Intronic
1167663533 19:50810458-50810480 TTGTGGATGAGGATAGGTCATGG + Intergenic
925022317 2:581322-581344 GAGTGGGAGAGGAGGCGGCAAGG + Intergenic
925348747 2:3187540-3187562 TGGTGGGTGGGGAGTGGGGAGGG - Intergenic
925348848 2:3187799-3187821 AGGTGGGTGAGGAGTGGGGAGGG - Intergenic
925348883 2:3187887-3187909 AGGTGGGTGAGGAGTGGGGAGGG - Intergenic
925649200 2:6071153-6071175 TAGTTGGTGAGGAAAGGTGATGG - Intergenic
925712464 2:6754560-6754582 TGGTGGGGGAGGAGAGGCCGGGG + Intergenic
926025327 2:9537926-9537948 GAGAGGGGGAGGAGAGGGGAAGG + Intronic
926210327 2:10864464-10864486 TAGTGGGTGCGGTGACGGGAGGG + Intergenic
926706280 2:15840063-15840085 TAGTGTGTGAGGAGGGGTGAAGG - Intergenic
926784148 2:16503473-16503495 TAGTGTGAGAGCAGAGGGCCAGG - Intergenic
927218922 2:20688549-20688571 TGCTGGGGGAGGAGAGTGCAGGG + Intronic
927284553 2:21343202-21343224 TAGTAGGAGAGGAGAGTACATGG + Intergenic
927465206 2:23331612-23331634 TGGTGAGTGAGGAGAGGGAAGGG + Intergenic
927961020 2:27240769-27240791 TAGCAGGTTAGGGGAGGGCAGGG - Intronic
928102938 2:28449978-28450000 CAGTGGGTGGGGGCAGGGCACGG - Intergenic
928170384 2:28999481-28999503 GGGTGGGTGAGGGGTGGGCAGGG - Intronic
928314032 2:30232320-30232342 TAGGGGCGGTGGAGAGGGCAGGG - Intronic
928646929 2:33364580-33364602 GAGTGGCTGAGCAGATGGCAGGG + Intronic
929536611 2:42788037-42788059 TAGTGGCTGAGGGGTAGGCATGG - Intronic
929875774 2:45795228-45795250 TGGTGGGAGAGTTGAGGGCAGGG - Intronic
930873507 2:56189837-56189859 TAGTGGGTGAGGGGAAGGAGTGG + Intronic
931467572 2:62505362-62505384 TAGGGGAGGAGGAGAAGGCAGGG + Intronic
931667275 2:64618326-64618348 CAGTGGGGCAGGAGAGAGCAGGG + Intergenic
932413568 2:71560853-71560875 AAGGGGGTGAGGTGGGGGCAGGG + Intronic
932622579 2:73273862-73273884 TAGTAGGTGAGGAGAAGTCTGGG - Intronic
933154365 2:78955947-78955969 TATTGGGTGGGGAGAGGGGAGGG + Intergenic
933721777 2:85401691-85401713 AAGTGGGAGAGGGCAGGGCAAGG + Intronic
933876486 2:86625228-86625250 TAGTGGGGGAGGAGTTGGAAGGG + Intronic
933979130 2:87536390-87536412 TGGAGGGTGTGGAGAGGGCAGGG + Intergenic
934061330 2:88296933-88296955 GAGTAGGTGAGCAGAGGACATGG - Intergenic
934183542 2:89650206-89650228 TGGTGGTTGAGGAGAGGTCTTGG - Intergenic
934293825 2:91724378-91724400 TGGTGGTTGAGGAGAGGTCTTGG - Intergenic
934645545 2:96057163-96057185 GAGTGGGAGAGGAGAGGGAGAGG + Intergenic
934838949 2:97613252-97613274 GAGTGGGAGAGGAGAGGGAGAGG + Intergenic
935251972 2:101271022-101271044 TAGTAGGAGAGGAAACGGCAGGG + Intergenic
935358858 2:102230598-102230620 CAGTGGCTGAGGGCAGGGCAGGG + Intronic
936093004 2:109512816-109512838 GAGGGGGTGAGGAGGGGTCAGGG - Intergenic
936314697 2:111414402-111414424 TGGAGGGTGTGGAGAGGGCAGGG - Intergenic
936462740 2:112724377-112724399 AAGTGGGTGAGACGAGGGCATGG + Intronic
936908421 2:117564832-117564854 TGGAGGGTGAGAAGAGGGAAAGG - Intergenic
937212813 2:120287655-120287677 TGGTGACTGAGGAGAGGACAAGG - Intronic
937602340 2:123753888-123753910 TATTGGGTGAGGAGATTCCAGGG - Intergenic
937982098 2:127621958-127621980 TGGTGGGTGAGGAGGGGAGAAGG - Intronic
938195548 2:129324401-129324423 TTGCGGGTGAGGAGAGGCAAAGG - Intergenic
938901066 2:135798762-135798784 CAGTGGGTGAGGAGAGGATTTGG - Intronic
939146769 2:138425043-138425065 CTGGGGGTGAGGGGAGGGCAAGG + Intergenic
939419277 2:141944824-141944846 TAGAGGGAGAAGAAAGGGCATGG - Intronic
940109801 2:150138951-150138973 TAGGGGAGGAGGTGAGGGCAAGG + Intergenic
940333710 2:152502873-152502895 AAGGGGGTAAGGAGAGGGTATGG + Intronic
940344901 2:152619105-152619127 TGGTGGTGGAGGAGGGGGCAAGG - Exonic
942773096 2:179546375-179546397 TAGAGGATGGGAAGAGGGCAGGG - Intronic
942854255 2:180526859-180526881 TCATGGGTGAGGAGAGGGGGAGG - Intergenic
943394333 2:187313988-187314010 TAGGGAGTGAGGAAAGGCCATGG + Intergenic
944202441 2:197121940-197121962 AAGTGGCTGCGGAGATGGCAGGG + Intronic
944882601 2:204028696-204028718 TAGTGGGCGAGAAGAGGGCAGGG + Intergenic
945037260 2:205714975-205714997 TTGCGGGTAAGGAGAGGGCTGGG - Intronic
945769840 2:214029471-214029493 TAGTGGGCGGGGAGAGGGGAAGG + Intronic
946209649 2:218137389-218137411 TTGGGGGTGAGGGGATGGCAAGG - Intergenic
946301812 2:218828502-218828524 TTGTGGGTGAGGAGAGGCTGGGG - Exonic
946308277 2:218868427-218868449 TAGGGAGTTAGCAGAGGGCAGGG + Intronic
946569070 2:221001344-221001366 GAGTGGGAGAGGAGAGGAGAAGG - Intergenic
946652267 2:221906214-221906236 AAATGGGGCAGGAGAGGGCAGGG + Intergenic
947461898 2:230310708-230310730 ACATGGGTGAGCAGAGGGCAGGG - Intronic
947470982 2:230400920-230400942 ACATGGGTGAGCAGAGGGCAGGG - Intronic
947747241 2:232514814-232514836 TATTGAGTGAGGGGAGGGCAGGG + Intergenic
947835033 2:233169192-233169214 CAGTGAGTGAGGAGCTGGCAAGG - Intronic
947963342 2:234258417-234258439 CAGAGGGTAGGGAGAGGGCAAGG + Intergenic
947978357 2:234386923-234386945 GAGTGGGGCAGGAGAAGGCAGGG + Intergenic
948163569 2:235844284-235844306 GAGTGGGTTTGGAGGGGGCAAGG + Intronic
948201944 2:236135916-236135938 TGGTGGGAGAGGAGGGGGCTGGG - Intergenic
948304183 2:236934399-236934421 CGGTGGGTGAGAAGAGGGAAGGG - Intergenic
948616407 2:239202134-239202156 TCGTGGATGAGGTGAGGGCATGG - Intronic
948828935 2:240588078-240588100 TAGAGGGTGAGGATAGTGGAGGG + Intronic
1169060167 20:2655241-2655263 GAGTAGGTGTGGAGAAGGCAAGG + Intronic
1169065051 20:2690412-2690434 CAGTGGGTGAGGACAGGGCTGGG - Intergenic
1169194458 20:3675692-3675714 GAGTGGGTGTGGAGAAGGCAGGG - Intronic
1170472276 20:16680235-16680257 GAAAGGGTCAGGAGAGGGCAGGG + Intergenic
1170562426 20:17569474-17569496 TAGTGGGGGAGGTGGGGGCAAGG - Intergenic
1170747281 20:19111459-19111481 CAGTGGGTGGGGAGAGAGGAAGG + Intergenic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1170940316 20:20843279-20843301 TATTAGGGGAGGAGAGGGAAGGG + Intergenic
1171239379 20:23552452-23552474 AGGTGGGTGAGGAGAGTGCGAGG - Intergenic
1171321456 20:24248049-24248071 TAGTGGGGGAAAGGAGGGCAGGG - Intergenic
1172007721 20:31828928-31828950 CAGTGGGAGAGGGGAGGGAAAGG + Intronic
1172013052 20:31857575-31857597 AAGTGGGGGAGGAGAGGGAGTGG - Intronic
1172037405 20:32019472-32019494 TGGTGGGTGGGGCGGGGGCAAGG - Intronic
1172337118 20:34126304-34126326 TAGGAGGTGAGGAGGGGGCAGGG + Intergenic
1172772282 20:37388792-37388814 TAGTAGAAGAGGAGAGGGAAAGG + Intronic
1172785988 20:37469339-37469361 CAGCTGGTGAGGAGAGGGGAGGG - Intergenic
1173065094 20:39703042-39703064 GAGGAGGAGAGGAGAGGGCAGGG + Intergenic
1173149060 20:40550403-40550425 TCGTGGGTGAGGAGAGGGAAGGG - Intergenic
1173498006 20:43532951-43532973 CAGGGGGTGAGGGGATGGCAGGG + Intronic
1173628965 20:44495663-44495685 TACTGTGTAAGGAGGGGGCAGGG - Intergenic
1173826880 20:46053476-46053498 GAGTGGGTGGGAAGAGGGGAAGG + Intronic
1173847414 20:46196936-46196958 TCCTGGGTGAGGAGTGGGCAGGG + Intronic
1174073873 20:47918332-47918354 TGTTTGGTGAGGGGAGGGCAGGG + Intergenic
1174161794 20:48556306-48556328 TAGTGGGTAGAGAGAGGCCAGGG + Intergenic
1174432024 20:50477256-50477278 TGGTGGGTGGGTAGAGGTCAGGG + Intergenic
1174509681 20:51041674-51041696 TGATGGCTGAGGAGTGGGCAGGG - Intergenic
1174854401 20:54029147-54029169 TCTTGGGAGAGGAGAAGGCAAGG + Intronic
1175010514 20:55729830-55729852 TTGTGGGTGAGGAGGAGACAAGG + Intergenic
1175232424 20:57482171-57482193 GAGAGGGGGAGGAGAGGGCAAGG + Intergenic
1177157393 21:17513167-17513189 TAGTGGGTGAGTAGGGGCCATGG + Exonic
1178169333 21:30021284-30021306 CAGTGGGTCAAGAGAGGTCATGG - Intergenic
1178351395 21:31874585-31874607 TGGTGGGTGATGAGGGGGCAGGG - Intronic
1178676765 21:34637814-34637836 TAGTCGGTGTGGAGGGGCCATGG + Intergenic
1179046251 21:37847913-37847935 TGATGGGAGAGGGGAGGGCAAGG + Intronic
1179350975 21:40610585-40610607 TATTGGGGGAGGGGAGGGGATGG - Intronic
1179878045 21:44281452-44281474 TAGTAGGAGGGGAGGGGGCAGGG + Intergenic
1179919055 21:44497454-44497476 GAGGAGGAGAGGAGAGGGCAGGG - Intergenic
1180055672 21:45358094-45358116 AAGGGGCTCAGGAGAGGGCATGG - Intergenic
1180122767 21:45765065-45765087 TGGTGTGTGTGCAGAGGGCATGG + Intronic
1181539589 22:23566266-23566288 GGCTGGGAGAGGAGAGGGCAGGG + Intergenic
1182102621 22:27668827-27668849 GAGTGGGTGGGGGCAGGGCAGGG - Intergenic
1182351947 22:29704345-29704367 TGGTGGGGGAGGGGAGGGGAGGG - Intergenic
1182351967 22:29704387-29704409 TGGTGGGGGAGGGGAGGGGAGGG - Intergenic
1182549909 22:31095279-31095301 TGCAGGGTGGGGAGAGGGCATGG - Intronic
1182756243 22:32682038-32682060 AAGTGAGGGAGGAGAGGGCACGG + Intronic
1183093335 22:35538444-35538466 AAGTGGGTGGGGAGGGGGGAAGG + Intergenic
1183445701 22:37852846-37852868 TAGTTAGTGAGGAGAGAGAAAGG + Intronic
1183560273 22:38567428-38567450 CAGTGAGTGAGTAGAGGCCAAGG + Intronic
1183981770 22:41544591-41544613 GAGAGGGCGAGGAGAGGGCGGGG + Intronic
1184154866 22:42660850-42660872 TAGTGTGCCTGGAGAGGGCATGG - Intergenic
1184220090 22:43094496-43094518 AAGTGGGGGAGAAGGGGGCAAGG - Intergenic
1184982194 22:48102660-48102682 AAGTGGGTGGGCAGAGGGGAGGG - Intergenic
1185036993 22:48484665-48484687 GAGTGGGGGAGGGGAGGGAAGGG - Intergenic
1185324189 22:50217645-50217667 TGGGGGCTGAGGACAGGGCAGGG - Intergenic
949924602 3:9031347-9031369 TACTGGGTCATGGGAGGGCAGGG - Intronic
950006526 3:9695042-9695064 TAGTGGGAGAGCAGAGGGGGTGG + Intronic
950578039 3:13844866-13844888 AGGTGGGTGAGGAGAGGGGCAGG - Intronic
950626387 3:14250423-14250445 GAGGGGGTGAGGAGAGGGAGGGG - Intergenic
951390397 3:22096154-22096176 TAGAGGGGGAAGGGAGGGCAGGG + Intronic
952276249 3:31880079-31880101 TACTGGGTGAAGTGTGGGCATGG - Intronic
952309939 3:32179640-32179662 TTATGTGTGAGGAGAGGTCAGGG - Intergenic
953195002 3:40724042-40724064 GAGGGGCTTAGGAGAGGGCAGGG - Intergenic
953289705 3:41649277-41649299 TAGTGGGGGAGGTGTGGCCAAGG + Intronic
953550621 3:43899618-43899640 AAGGGGGAGAGGAGAGGGGATGG - Intergenic
953735958 3:45494210-45494232 CAGTGGCTGAGCAGAGAGCATGG - Intronic
953848696 3:46449148-46449170 AAGTGGAGGAGGAGAGGGTATGG - Intronic
954349952 3:50035032-50035054 GAGTAGGGGAGGAGAGGGGAGGG - Intronic
954360224 3:50118250-50118272 TGCTGGGTAAGGAGTGGGCATGG + Intronic
954380012 3:50214322-50214344 TGGTGGCTGAAGACAGGGCAGGG + Intronic
955141478 3:56274104-56274126 CAGGAGGTGAGCAGAGGGCAAGG + Intronic
955623909 3:60895994-60896016 TAGGAGGTGAGCAGCGGGCAGGG + Intronic
956085221 3:65601026-65601048 AACTGGGTGAATAGAGGGCATGG + Intronic
956431911 3:69195366-69195388 TAGGGGATGAGGGAAGGGCAGGG + Intronic
956657699 3:71568062-71568084 GAGGGGGGGAGGAGAGGGGAGGG + Intronic
957041376 3:75338052-75338074 GAGAGGTTCAGGAGAGGGCATGG + Intergenic
957227477 3:77468561-77468583 TTGTGGGTGAGGACAGAACACGG + Intronic
957670272 3:83292240-83292262 TTGTGGGGTAGGAGAGGGGAGGG + Intergenic
958104231 3:89052469-89052491 TAGGGGATGAGGAGAGGGTGAGG + Intergenic
959688996 3:109178328-109178350 TAAAGGGTGGGGATAGGGCATGG + Intergenic
959780731 3:110230232-110230254 TTATGGGTGAGGACAAGGCAGGG + Intergenic
960347387 3:116550903-116550925 TAGAGGGTGAGAGGAGGGTAAGG - Intronic
960456395 3:117878189-117878211 TAGTGTGCCTGGAGAGGGCATGG + Intergenic
960907422 3:122615388-122615410 TTGTAGGTGAGCAGGGGGCAGGG - Intronic
961488483 3:127234066-127234088 TTGTGTGTGAGGGGAGGGCCGGG + Intergenic
961490496 3:127253945-127253967 AAGTGGGTCAGGGAAGGGCAGGG - Intergenic
962370899 3:134820045-134820067 GGGTGGGTGAGGGGAGGGGAAGG - Intronic
962477700 3:135770985-135771007 AAGTGGGAGAGGAAAGGGTAGGG - Intergenic
962532727 3:136298421-136298443 TTGTGGGTGAGGGGAAGGAAAGG - Intronic
963229704 3:142896594-142896616 CAGTGAGTGAGGAGAGCACAGGG - Intergenic
963963120 3:151332881-151332903 TAGTGGGTGGGAGGAGGGTAAGG - Intronic
964436412 3:156658484-156658506 TAGGGGGTGGGGAGAAGGGATGG + Intergenic
964604658 3:158547428-158547450 TAGTGGCAGAGGAGAGGACTTGG + Intergenic
965921830 3:173926766-173926788 GAGTGGGTGGGGAAAGTGCAGGG + Intronic
966211656 3:177459632-177459654 CAGTGAGAGAGGAGAGGGCAGGG + Intergenic
966560061 3:181310061-181310083 GGGGGGGTGGGGAGAGGGCATGG - Intergenic
966770222 3:183497533-183497555 GAGGGGGTGAGGGGAGGGTAAGG + Intronic
967088030 3:186111290-186111312 TAGTGGCTCAGGTGGGGGCAGGG + Intronic
967225502 3:187287322-187287344 AAGTAGGTGAGGAGTGAGCAGGG - Intronic
967262021 3:187651751-187651773 TAGTGGGTCTGCAGTGGGCATGG - Intergenic
967289411 3:187904561-187904583 TAGTGGGTGGGGTGTAGGCAAGG - Intergenic
967478628 3:189949336-189949358 GAGTGGGGGAGGGGAGGGGAGGG - Intergenic
967715179 3:192754310-192754332 TTGTGGGTGGGCAGAGGGAATGG - Intronic
967787687 3:193514977-193514999 AGGAGGGTGAGGAGAGGGCAGGG + Intronic
968829940 4:2928147-2928169 TAGTGGGTGAGGTGAGAGATGGG - Intronic
969185212 4:5469504-5469526 TAGAGAGTGAGGAGAGGTGAGGG + Intronic
969565648 4:7975987-7976009 TGGTGGGAAAGGTGAGGGCATGG - Intronic
971301839 4:25448486-25448508 GAGTTGGTAAGGGGAGGGCAGGG - Intergenic
971906690 4:32735407-32735429 TAGGGAATGAGGAGTGGGCAGGG - Intergenic
972265194 4:37453315-37453337 GAGTGGGTGAGGAGGGGACGGGG + Intergenic
973098210 4:46228207-46228229 TAGTGGGTCAGTAGAGGTAATGG - Intergenic
973831562 4:54764772-54764794 TAGTGGGTGGGGGCAGGGCTAGG + Intergenic
974331133 4:60480688-60480710 TTGTGGGGGAGGAGGGGGGAGGG - Intergenic
974483128 4:62471615-62471637 TTGTGGGTGGGGTGAGGGGAGGG - Intergenic
975372851 4:73608037-73608059 AAGGGGGAGAGGAGAGGGGAGGG - Intronic
976096635 4:81515330-81515352 TAGGGAGTGAGCAGAGGGGAGGG + Intronic
976220428 4:82752950-82752972 TTCTTGGTGAGGAGAGGGCAGGG - Intronic
976449849 4:85175805-85175827 TAGTGGTTAAGGAGACGGTAGGG - Intergenic
977593852 4:98856354-98856376 GAGGGGATGAGGAGAGGACAAGG - Intergenic
977759378 4:100713066-100713088 TAGTGGGTGAGAAGGGGATAAGG + Intronic
978413859 4:108455118-108455140 TGGTGTTGGAGGAGAGGGCAAGG - Intergenic
979167116 4:117548549-117548571 TGAGGGGTGAGGACAGGGCAAGG - Intergenic
980541706 4:134203726-134203748 GAGTGGGTTTGGGGAGGGCAAGG - Intergenic
981043397 4:140243754-140243776 TGTTGTTTGAGGAGAGGGCAAGG + Intergenic
981220149 4:142222248-142222270 TAGTGGGTAAGGGCTGGGCATGG - Intronic
981369401 4:143941743-143941765 TAGTGAGAGAGAAGAGGGAAGGG - Intergenic
981759544 4:148178663-148178685 GCCTGGGTGAGGAAAGGGCAAGG + Intronic
982212984 4:153055948-153055970 AAGTGAGAGAGGAGAGGGTATGG + Intergenic
982969524 4:161965761-161965783 TAATTGGTGAGAAGACGGCAGGG + Intronic
983535158 4:168849877-168849899 TTGGGGGTGAGAAGAGGGAATGG - Intronic
985072385 4:186180520-186180542 TAGGGTGTGGGGAGAGGGGAGGG - Intergenic
985118558 4:186616386-186616408 GAGTGGGTGGGGAGGGGCCATGG - Intronic
985824619 5:2183195-2183217 GGGTGGGTGAGGAGGGGCCAGGG + Intergenic
985868633 5:2536438-2536460 CTGTGGGTGAGGAGAGGCCAGGG - Intergenic
985917044 5:2930147-2930169 CAGTGGGAGAGGAGAAAGCAAGG - Intergenic
987056667 5:14199867-14199889 GAGTTGGGGAGGAGAGGTCAGGG + Intronic
990052761 5:51528271-51528293 TAGGGGGTGAGGAGTAGGGAGGG + Intergenic
990074479 5:51826419-51826441 TAGTGAATCAGGATAGGGCATGG - Intergenic
991041672 5:62182621-62182643 TGGCAGGAGAGGAGAGGGCATGG - Intergenic
992709736 5:79439581-79439603 AAGTGGATGAGGAGAGGGGGAGG + Intronic
994302198 5:98159389-98159411 CAGTGGGTGGGGAGAAGGGAAGG + Intergenic
996542023 5:124640397-124640419 TGGTGGGTGGGGAAGGGGCAGGG - Intronic
997098043 5:130936104-130936126 TAGTGGGAGTGGACTGGGCATGG + Intergenic
997105454 5:131013743-131013765 TGGTGGGGGAGGAGTGGGGATGG + Intergenic
997356074 5:133263840-133263862 GAGTGGGTGAGGCAGGGGCACGG + Intronic
997379640 5:133426425-133426447 TAGGGAGTGCGGAGGGGGCAGGG - Intronic
997460240 5:134047016-134047038 AAGTGGGAGAAGTGAGGGCAGGG + Intergenic
997513266 5:134467114-134467136 TAGGAGGTGGGGAGAGGACACGG + Intergenic
997856864 5:137380614-137380636 TGGTGGCAGAGGAGAGAGCAAGG + Intronic
997863147 5:137437910-137437932 AACTGGGTGGGGAGAGGGAATGG - Intronic
998662025 5:144249417-144249439 TTGTGGGAGAGGGGAGGGGAAGG - Intronic
1000960490 5:167595855-167595877 TTATGGGGGAGGAGAGGGAAGGG - Intronic
1001401254 5:171447856-171447878 TTGTGGGTGAGGGAGGGGCAGGG + Intronic
1001527165 5:172437173-172437195 TGGAGAGCGAGGAGAGGGCAGGG + Intronic
1001699579 5:173697222-173697244 TGGTGGGTGAAGGGAGGCCATGG + Intergenic
1001803996 5:174567818-174567840 TATTGGGTGAGCAGTGAGCAGGG + Intergenic
1002774104 6:314215-314237 TGGTGGGAGAGGAGAGAGCTGGG + Intronic
1003522256 6:6868256-6868278 TGGTGGGTGGGGAATGGGCAGGG + Intergenic
1003628823 6:7768192-7768214 CAGTGGGAGAGGAAAGGGAATGG - Intronic
1005369350 6:25114501-25114523 AAGTGGGTGAGGAAAGGTCAAGG + Intergenic
1005398862 6:25411208-25411230 TATTGGGTGAGCAGACAGCAGGG - Intronic
1006031388 6:31179191-31179213 AAGTGGGTCAGGTGAAGGCAGGG - Intronic
1006100643 6:31684080-31684102 TATAGGGTGAGGAGTGGACAGGG + Intergenic
1006162859 6:32048208-32048230 GAGTGGGAGAGGAGAGCTCAGGG + Intronic
1006295081 6:33166703-33166725 GAGATGGTGAGTAGAGGGCATGG - Exonic
1006670239 6:35725878-35725900 AAGTGGGGGAGGAGGAGGCAGGG - Intronic
1006750651 6:36374668-36374690 TGGGAGGTGAGGGGAGGGCAGGG - Intronic
1006756453 6:36419917-36419939 TAGTGTGGGAAGAGAGGGCCAGG + Intronic
1007219651 6:40268494-40268516 CAGTGTGAAAGGAGAGGGCAGGG + Intergenic
1007341430 6:41193697-41193719 GAGAGGGTGAGGATAGGGCAAGG - Intronic
1007627563 6:43254993-43255015 AGGTGGCTGAGGTGAGGGCATGG + Intronic
1008366058 6:50681932-50681954 TAGTGGTTCAGGAGAGAGTAAGG - Intergenic
1008927027 6:56897832-56897854 TAGTGAGTCAGGAGGGAGCAGGG - Intronic
1010043605 6:71416449-71416471 TAGTTGTTGAGCAGAGGGAAAGG - Intergenic
1011389343 6:86834724-86834746 TAGGGGGTGAGGAAATGGAAAGG - Intergenic
1011632383 6:89339638-89339660 GAGTGGGGGAGGGGAGGGGAGGG + Intronic
1013461107 6:110376371-110376393 TAGTGGCAGTGGAGAGGGGAAGG + Intergenic
1013611723 6:111802223-111802245 AAGTGGGAGAGGAGAGGGGGAGG - Intronic
1013822240 6:114168407-114168429 CAGTAGGTGAGGAGAGGCCATGG - Exonic
1015684385 6:135843205-135843227 CAGTGGCTGAGTGGAGGGCAGGG + Intergenic
1016208085 6:141494636-141494658 TAGTGGTTGATAAGAAGGCATGG - Intergenic
1016330323 6:142946833-142946855 CAGGGGGCGAGGAGAGGCCAGGG - Intergenic
1016935766 6:149448541-149448563 TGGTGGGGGAGGAGGGGGCAGGG - Intronic
1017306418 6:152923282-152923304 AGGTGGGCGATGAGAGGGCATGG - Intergenic
1017402731 6:154083198-154083220 TGGAGGGTGAGGAGAGAACATGG - Intronic
1017906417 6:158760076-158760098 AAGTGAGTGAAGAGAGGGCCGGG - Intronic
1018170379 6:161139405-161139427 TTGTGGGTGAGTGGAGGGCAAGG - Exonic
1018447314 6:163869685-163869707 AATTGGGGGAGGGGAGGGCAGGG - Intergenic
1018722973 6:166587905-166587927 GAGTGAGTGAGGAGGGCGCAGGG - Intronic
1018728688 6:166632802-166632824 TAGTGAGGGAGGAGAAAGCAGGG + Intronic
1019733869 7:2641112-2641134 TGGCTGGTGAGGAGCGGGCAGGG - Intronic
1019804461 7:3113065-3113087 TAGTGGGTGAGGAGTGGGAGAGG + Intergenic
1020282371 7:6656102-6656124 TGGTGGGTGGGAAGAGGGCCTGG + Exonic
1020441910 7:8226245-8226267 TGGTGGATGAGGAGTGGGGAAGG - Intronic
1020606915 7:10350575-10350597 TGGAGGGTGCGAAGAGGGCAAGG - Intergenic
1021167893 7:17362539-17362561 TGCTGGGTGAGGAGTGGGCGGGG + Intergenic
1021717343 7:23471404-23471426 TGGTGGGGGAGGGGAGTGCAGGG + Intergenic
1022548042 7:31207564-31207586 TAGTGGGGGAAGAGAAAGCATGG - Intergenic
1022794811 7:33723659-33723681 TTGTGGGTGAGCTGAGGGTAGGG + Intergenic
1022906447 7:34862274-34862296 TAGTAACTGAGGAGATGGCAAGG - Intronic
1023083656 7:36548539-36548561 GAGTTGGTGAGGAGAGGGTGGGG + Intronic
1023592492 7:41794704-41794726 AAGTGGCCGAGGAGAGGACAGGG - Intergenic
1023672667 7:42594390-42594412 TAGTGGTGGAGCAGAGGGAAGGG + Intergenic
1023871378 7:44264715-44264737 CAGTGGGAGGGGAGAGGGGAGGG - Intronic
1024616936 7:51123820-51123842 ATGTGGGTGAGGAGGTGGCATGG - Intronic
1024936029 7:54713081-54713103 TAGTGGGTGGGGCCAGGGCATGG + Intergenic
1025065682 7:55853535-55853557 TAGTGGGGGTGGTGAGGGGATGG + Intronic
1025069206 7:55884304-55884326 TTGTGGGTTTGGAGAGGCCAAGG - Intergenic
1025805939 7:64835051-64835073 TGCTGGGTGAGGAGTGGGCAGGG + Intergenic
1025806781 7:64839972-64839994 TGCTGGGTGAGGAGTGGGCGGGG + Intergenic
1026019776 7:66697954-66697976 TAGTGGGGATGGAGAGGGCCGGG - Intronic
1026363565 7:69625387-69625409 TAGTGGTTGATGGGAGGGCTTGG + Intronic
1026552331 7:71379268-71379290 TAGTGGCTGGAGAAAGGGCAGGG + Intronic
1026871307 7:73853841-73853863 GAGTGGATGAGGATGGGGCAGGG + Intergenic
1027180856 7:75938370-75938392 AAGCTGGTGAGGACAGGGCAAGG - Intronic
1027836502 7:83250870-83250892 TAGTGGGTGGGGATGGGGGAGGG - Intergenic
1028738194 7:94241622-94241644 TAGTGACTGAGTAGAGGGCTGGG + Intergenic
1029547183 7:101216678-101216700 GTGCGGGTGAGGAGAGGGAAAGG - Exonic
1029732285 7:102446467-102446489 TGCTGGGTGTGGAGAGGGCAAGG - Intronic
1030298090 7:107948669-107948691 TACTGGGTGAGGAGATGAGAAGG + Intronic
1030800789 7:113849076-113849098 GAGTGGAGGAAGAGAGGGCAAGG - Intergenic
1031927935 7:127656005-127656027 AAGTGGGTGAGGGGAGGGTAAGG - Intronic
1032075329 7:128833294-128833316 TGGAGGGGGAGGAGAGGGCTGGG - Intronic
1032078163 7:128845893-128845915 GAGAGGGAGAGGAGAGGGAAAGG + Intronic
1032184532 7:129712764-129712786 TATTGGGTGAGGAAAGGTGAAGG + Intronic
1032425577 7:131819924-131819946 AGGGCGGTGAGGAGAGGGCAGGG - Intergenic
1032427371 7:131832710-131832732 AAGTGGGTGAGGAGAAGAGATGG - Intergenic
1032465940 7:132145098-132145120 TGGTGAGTGAAGGGAGGGCAGGG - Exonic
1033478800 7:141717818-141717840 TGGTGGGTGGGGAGTGGTCAGGG + Intronic
1033498806 7:141926853-141926875 TGGGGTGTGAGGAGAGGGGAGGG - Intronic
1033825716 7:145187012-145187034 GAGAGGGTGAGGGGAGGGCAGGG - Intergenic
1034881146 7:154763613-154763635 TTCTGGGTGAGGAAAGGCCAAGG - Intronic
1034954609 7:155326869-155326891 TCTTGGGTGAGCAGGGGGCAGGG - Intergenic
1034967973 7:155403264-155403286 TGGTGGGTGAGGAGGGAGCCGGG + Intergenic
1035035798 7:155892985-155893007 TAGTGGTGATGGAGAGGGCAAGG + Intergenic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1036539042 8:9685667-9685689 CACTGGGTGAAGAGAGGGGAAGG - Intronic
1037585133 8:20270833-20270855 TTGTGTGTGTGGAGAGGGAAGGG + Intronic
1037698866 8:21253703-21253725 GAGATGGAGAGGAGAGGGCAGGG - Intergenic
1037755759 8:21709215-21709237 TGGTGGGTCAGGAGAGAGCTGGG - Intronic
1038395676 8:27243917-27243939 GAGTTGGTGGGGAGAGGGCCTGG - Intronic
1038479325 8:27890949-27890971 TGGTGGGTGAGGGGAGCCCAGGG + Intronic
1038532694 8:28331422-28331444 TAGGGAGTGGGGAGAGGACAAGG - Intronic
1039180986 8:34865878-34865900 TAGGGGGTGGGGATAGGGAAGGG + Intergenic
1040363389 8:46689217-46689239 TAGTGGGGGTGGTGAGGGAATGG - Intergenic
1040438464 8:47416769-47416791 TTGTGGGTGGGGTGGGGGCAGGG - Intronic
1040446399 8:47499786-47499808 TTGTGGGTGGGGTGGGGGCAGGG - Intronic
1042269002 8:66937103-66937125 AAGAGGGAGAGGAGAGGGGAGGG - Intergenic
1042450623 8:68940971-68940993 AAGTGGGAGAGCAGAGGGCAAGG + Intergenic
1042652348 8:71057318-71057340 TAGTGGATGAGCAGATGACATGG - Intergenic
1042739372 8:72026247-72026269 CAGTGGGTGAGGTGAGAGGAAGG - Intronic
1042751658 8:72164072-72164094 TGGAGGGTGGGAAGAGGGCAAGG - Intergenic
1042764222 8:72302836-72302858 TGGAGGGTGGGAAGAGGGCAAGG - Intergenic
1044846286 8:96385110-96385132 TTGTGGGTGAGGCCAGGGTAGGG - Intergenic
1045710339 8:104975648-104975670 GAGTGGGGGAGGAGAGAGAAAGG - Intronic
1046864854 8:119136278-119136300 TAGAGGTTGAGGAGGAGGCACGG + Intergenic
1046873024 8:119224686-119224708 GAGTGGGTGGGGAGAGGAGAAGG - Intronic
1046962498 8:120125558-120125580 CATTGGGTGATGAGAGCGCAGGG + Intronic
1047096771 8:121634410-121634432 CAGGGGGTGAAGAGAGGGCAAGG - Intronic
1049447009 8:142635807-142635829 TAGCAGATGTGGAGAGGGCAAGG - Intergenic
1050085865 9:1965177-1965199 TGGTGGGGGAGGAAAAGGCAAGG - Intergenic
1050869716 9:10551567-10551589 TAATGCATGTGGAGAGGGCAAGG - Intronic
1051411637 9:16795537-16795559 TGGAGGGTGTGGAGAGGACATGG - Intronic
1051642731 9:19238557-19238579 GAGAGGGGGAGGGGAGGGCAGGG - Intronic
1051843846 9:21429510-21429532 AAGTGGGAGAGGAGAGGGATTGG + Intronic
1051906662 9:22103178-22103200 TGGTGCGTGAAGAGAGGGGAGGG + Intergenic
1051909908 9:22141507-22141529 TAATGGGTGAGGGGAAGGAAAGG + Intergenic
1052149316 9:25094021-25094043 CATTTGGTGAGGAGGGGGCAGGG + Intergenic
1053288568 9:36865290-36865312 TACTGGGGGACAAGAGGGCAAGG - Intronic
1054896666 9:70321143-70321165 TGGTAGGAGAGGAGAGGGGAAGG + Intronic
1055605035 9:77960308-77960330 GAGGGAGTGAGGAGAAGGCATGG + Intronic
1056390489 9:86136874-86136896 TAATAGGTGCAGAGAGGGCAGGG - Intergenic
1057070809 9:92098307-92098329 TGCTGGGTGAGGAGTGGGCGGGG - Intronic
1057139268 9:92716920-92716942 GGGAGGGTGAGGAGAGGGCCGGG - Intronic
1057200865 9:93139368-93139390 GAGTGGGTGAGGGGAGGGCAAGG - Intergenic
1057213337 9:93213245-93213267 TAGCAGGTGACAAGAGGGCAGGG + Intronic
1057313992 9:93957655-93957677 CAGGGGGTGAGGAAGGGGCAGGG - Intergenic
1057454934 9:95199422-95199444 TAGTAGGTGAGGAGAGGGAAGGG - Intronic
1057991951 9:99779761-99779783 AAGGGGGTGAGGAGAGTGCAAGG - Intergenic
1058525469 9:105853066-105853088 TAGAGGGTGAGAGGAGGGAAAGG + Intergenic
1059438919 9:114291860-114291882 TTGTGGGAGAGGAGAGGGGAAGG + Intronic
1059543256 9:115151582-115151604 TTGTGGGTGAGAAGAGGATATGG + Intronic
1059560387 9:115328920-115328942 TATGGGGTGAGGAGAGGGGGAGG + Intronic
1059760079 9:117329447-117329469 GAGAGGGAGAGGAGAGGGAATGG + Intronic
1060843416 9:126813832-126813854 TAGAGGGGGAGAAGAGGACAAGG - Intronic
1061147058 9:128806179-128806201 TAGGGAGGGAGGAGTGGGCAGGG + Intronic
1061237588 9:129351646-129351668 GAGGGGGTGAGGAAAGGGCTAGG + Intergenic
1061539619 9:131270976-131270998 TGGTGGGAAAGGACAGGGCAGGG - Intronic
1061548029 9:131315933-131315955 AAGAGGGCGAGGTGAGGGCAGGG + Intergenic
1061840626 9:133356722-133356744 GAGGGGCTGAGGGGAGGGCAGGG + Intronic
1062284544 9:135767263-135767285 CAGGGAGTGGGGAGAGGGCAAGG + Intronic
1062329001 9:136028570-136028592 TAGTGGGTGAGGCGTGGCCAGGG + Intronic
1185511569 X:668097-668119 GAGTGGGAAAGGAGAGGGGAGGG - Intergenic
1185511663 X:668310-668332 AAGTGGGGGAGGGGAGGGGAGGG - Intergenic
1185640562 X:1587943-1587965 AAGAGGGGGAGGAGAGGGCAGGG - Intergenic
1185640572 X:1587967-1587989 AAGGGGGGGAGGAGAGGGCAGGG - Intergenic
1185957299 X:4505438-4505460 TAGAGAAGGAGGAGAGGGCATGG - Intergenic
1186837800 X:13455279-13455301 TATTGGCTGAGTAGAGGCCAAGG + Intergenic
1187882127 X:23857091-23857113 TGGAGGGTGAGAAGAGGGCGAGG + Intronic
1188257546 X:27981035-27981057 TAGTGGGAGAGGAGACAGAAAGG - Exonic
1188366562 X:29322926-29322948 TATTGGCTAAGGAGAGGGGAAGG - Intronic
1188913971 X:35887511-35887533 TTGTCAGTGAGGAGGGGGCACGG + Intergenic
1189268349 X:39733427-39733449 TAGAGGGTGTGGTGGGGGCAAGG - Intergenic
1189309894 X:40011837-40011859 TAGAGGGTTCAGAGAGGGCAAGG - Intergenic
1189532192 X:41896923-41896945 TAGTGGGGGAGGAGGGAGTAGGG - Intronic
1191797241 X:65034602-65034624 GCGTGGGTGAGGAGAGGTCCAGG - Intronic
1194212059 X:91082003-91082025 CAGTGGGTGAGGCGCAGGCAGGG + Intergenic
1194754463 X:97721449-97721471 TAGGGGGAGAGGAGAGACCAAGG + Intergenic
1195691611 X:107630412-107630434 TATTGGGAGAGGAGAGGGGGAGG + Intronic
1196106253 X:111899092-111899114 TAGTGGGTGAGGAGAGGGCAAGG - Intronic
1196892582 X:120305684-120305706 TAGAGGGAGGGGAGAGGGGATGG + Intronic
1198177825 X:134173029-134173051 TAGTGGGTGAAGAGGGCGCCTGG - Intergenic
1198411927 X:136379439-136379461 AAGAAGGGGAGGAGAGGGCAGGG - Intronic
1200017980 X:153180244-153180266 GGGTTGGTCAGGAGAGGGCAGGG + Intronic
1200071421 X:153531252-153531274 GAGCAGGTGGGGAGAGGGCACGG - Intronic
1200613137 Y:5347634-5347656 TAGTGGGTGAGGATTGGGACAGG - Intronic
1201234665 Y:11897539-11897561 CACTGTGGGAGGAGAGGGCATGG - Intergenic
1201770723 Y:17614811-17614833 TGCTGGGTGAGGAGTGGGCGGGG - Intergenic
1201830832 Y:18291175-18291197 TGCTGGGTGAGGAGTGGGCGGGG + Intergenic