ID: 1196106943

View in Genome Browser
Species Human (GRCh38)
Location X:111906542-111906564
Sequence TTTCCAAAGCTGGAAGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 319}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196106943 Original CRISPR TTTCCAAAGCTGGAAGTTGG GGG (reversed) Intronic
901007065 1:6177186-6177208 TTCCAAAAGATGGAAGTTTGTGG - Intronic
901780934 1:11594096-11594118 TTTCCAAAGCTGGATTTGGCTGG - Intergenic
902197545 1:14808955-14808977 TTTCCAAAGCAGGAAGGAAGGGG + Intronic
903701938 1:25255561-25255583 TTTCCACAGCTGGGGGTGGGGGG + Intronic
903829376 1:26165326-26165348 TTCCCAAAGCTGCAAGCTGCAGG + Intergenic
903869958 1:26426730-26426752 TTTCAAAAGCTGGAAATTCTGGG - Exonic
904574046 1:31491206-31491228 TTTCCCAGGCTGGAGTTTGGTGG + Intergenic
905536551 1:38726780-38726802 TTTCCAAATTTGGAAAATGGAGG + Intergenic
905546940 1:38807557-38807579 TCTCCTAGGCTGGAGGTTGGTGG - Intergenic
906512492 1:46418497-46418519 GTCCCACAGCTAGAAGTTGGGGG + Intergenic
906695314 1:47819531-47819553 TTTCCAGCCCTGGAATTTGGCGG + Intronic
909469217 1:76007806-76007828 TTTCCAAAACTAGAAGTTCAGGG + Intergenic
909549515 1:76882156-76882178 TTTGCAAAGTTGGTGGTTGGTGG - Intronic
911907263 1:103586468-103586490 ATTACAAAGCTGGAGGCTGGGGG - Intergenic
912120983 1:106472320-106472342 TTTCCCAAGATGGTGGTTGGAGG + Intergenic
913231545 1:116744388-116744410 TTTCCCATCCTGGAAGTTGTAGG - Intergenic
914312698 1:146481087-146481109 TTTGCAAAGCTGGCTTTTGGTGG + Intergenic
914501650 1:148252251-148252273 TTTGCAAAGCTGGCTTTTGGTGG - Intergenic
915167626 1:153957471-153957493 TTTCCAAGGCTGGAGGTCAGAGG - Intronic
921151860 1:212409136-212409158 TTTCCACAGATGGAGGTTGGGGG - Intronic
921437708 1:215145531-215145553 TTTAGAAAGCTGGATCTTGGTGG - Intronic
922083663 1:222324478-222324500 TGTCTTAAGCTGCAAGTTGGTGG - Intergenic
922339482 1:224643955-224643977 TTTCTGAGACTGGAAGTTGGGGG + Intronic
922581831 1:226703783-226703805 TCTCCCAAGCCGGAAGCTGGCGG - Intronic
922781416 1:228256046-228256068 TTTCCACAGATGGGGGTTGGTGG - Intronic
923271772 1:232361579-232361601 TTTACAAAGCTGGAACATGCTGG + Intergenic
923365220 1:233253368-233253390 TTGCCAAGGCTGGAGGCTGGAGG + Intronic
924813299 1:247421957-247421979 TTTCCAAAGCTGGAGGGCAGTGG - Intronic
924829359 1:247576503-247576525 TTGCCCAAGCTGGAATGTGGTGG - Exonic
1063072256 10:2678479-2678501 CTTCAAAATCTGGAAGATGGTGG - Intergenic
1063558803 10:7107308-7107330 TTTCCAAAGCTGCATGATGCTGG + Intergenic
1064180384 10:13109387-13109409 TTTCCATAGGTGGTAGCTGGTGG + Intronic
1067269359 10:44775865-44775887 CTTCCAAAGCTGGAGGTTGGGGG - Intergenic
1067815332 10:49471239-49471261 TTTCCAAGGCTGAAAGTTTGGGG - Intronic
1067994644 10:51258019-51258041 TTTCCAAGGCAGGAAGAAGGTGG + Intronic
1068627340 10:59263672-59263694 GTTACATAGCTGGAAGGTGGTGG - Intronic
1070358614 10:75664626-75664648 ATTCCTAAGCTGGAGTTTGGAGG + Intronic
1071300209 10:84250752-84250774 TTTCTAAAGCTGAAAGTCTGAGG + Intronic
1071357882 10:84816742-84816764 TTTCCATAGATGGGGGTTGGTGG + Intergenic
1071828553 10:89349718-89349740 TGTTGAAAGCTGTAAGTTGGAGG - Intronic
1072065450 10:91865608-91865630 TTTCCAAATCTCAAAGTTAGTGG + Intergenic
1072816466 10:98514250-98514272 TTACCAAAGGTGGAAGGGGGAGG + Intronic
1073993119 10:109286850-109286872 TTTCCAAACCTTGAAGTTCTGGG - Intergenic
1076314221 10:129529319-129529341 TTTCCACAGATGGGAGTGGGGGG + Intronic
1076497527 10:130906723-130906745 CATCCACAGCTGGAACTTGGGGG - Intergenic
1078077045 11:8171587-8171609 TTACCCAAGCTAGAATTTGGTGG - Intergenic
1080499023 11:32850676-32850698 TTTGCAAATCTGAAAGTAGGGGG + Intronic
1080970556 11:37270360-37270382 CTTCTAAACCTGGATGTTGGAGG - Intergenic
1081660804 11:44887246-44887268 TTTCCACATCTGTAAGATGGGGG + Intronic
1081889531 11:46529295-46529317 TTTCCAAAGGGGGAAAATGGAGG - Intronic
1083525876 11:63364469-63364491 TTTCAGAAGCTGGAGGTAGGGGG - Intronic
1083815269 11:65129128-65129150 TCACCAAAGCTGGAATTTAGTGG + Intronic
1086435441 11:86775453-86775475 TTCCCACAACTGGAAGATGGCGG - Intergenic
1087170135 11:95041569-95041591 TCTCCAAAGGTTGAAGATGGGGG - Intergenic
1087717541 11:101625808-101625830 TTTTTAAAGTTAGAAGTTGGGGG - Intronic
1087938413 11:104063055-104063077 TTTCCAAAGCTTGGAGCTTGGGG - Intronic
1087992663 11:104765138-104765160 TTTCTAACGCTGCAAATTGGAGG - Intergenic
1089371585 11:117963686-117963708 TTTCCAATACTGGAAATTTGTGG - Intergenic
1090263431 11:125339109-125339131 TTTCCAAGGCTGGAGGTTGAAGG + Intronic
1090339013 11:125998839-125998861 TTTCTAGAGCTGGAATGTGGAGG + Intronic
1090733822 11:129594047-129594069 TTTCCCAAGCTGTATTTTGGGGG + Intergenic
1091828525 12:3533175-3533197 TTTCCAGGCCTGGATGTTGGGGG - Intronic
1092308655 12:7327919-7327941 TTTTCAGAGCTGGATGCTGGAGG - Intronic
1093785442 12:23187252-23187274 CTTCCATAGCTAGAAGCTGGAGG - Intergenic
1095095570 12:38146489-38146511 TTGCCCAAGCTGGAAGGTTGTGG + Intergenic
1095693614 12:45118754-45118776 TTTCCAATCCAGGAATTTGGGGG + Intergenic
1096820842 12:54232988-54233010 CTTATAAAGCTGCAAGTTGGTGG + Exonic
1097062294 12:56294539-56294561 TTTCTGAAGATGGAAGCTGGAGG - Intronic
1099269266 12:80486874-80486896 TTTCAAAAGCTGAAAAGTGGGGG - Intronic
1101635527 12:106537604-106537626 TTTCCATAGATGGGAGTAGGGGG - Intronic
1102000031 12:109551656-109551678 TTTCCTCATCTGTAAGTTGGGGG + Intergenic
1102105755 12:110321508-110321530 TCTCCAAAGCTGGAATGTAGTGG + Intronic
1102302664 12:111782259-111782281 TTTCCAGACCTGGAAGTTGAAGG + Intronic
1102636916 12:114332651-114332673 GCCACAAAGCTGGAAGTTGGAGG + Intergenic
1103002350 12:117394901-117394923 TTTCCTCATCTGTAAGTTGGCGG + Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1103978690 12:124721548-124721570 TTTGTTAAGCTGGAATTTGGGGG + Intergenic
1104687486 12:130797186-130797208 TTTACAAAGGGGGAAGGTGGTGG - Intronic
1106532080 13:30602553-30602575 TTTTCAAAGTTGGAAGTTTTTGG - Intronic
1106713542 13:32364436-32364458 TTTCCATAGCAGGAAGTTAACGG - Intronic
1107897045 13:44975550-44975572 TTTACAAAGATGGCAGTTGTGGG - Intronic
1108447944 13:50527960-50527982 TGTCCTAAACTGGAAGCTGGGGG + Intronic
1108594973 13:51941782-51941804 TTTTAAAGGCTGGAAGGTGGTGG + Intronic
1109752571 13:66715186-66715208 ATTACAAAGATTGAAGTTGGAGG - Intronic
1109795894 13:67312769-67312791 TTTTCAAAGCTAGAAGTTCATGG - Intergenic
1109892407 13:68632247-68632269 TTTCCAACACTTGAAGTTTGGGG + Intergenic
1110917233 13:81036661-81036683 TTTCCATAGCTGAAAGTGGAGGG - Intergenic
1111274087 13:85924987-85925009 TCTCCAAGGCTGGAATGTGGTGG - Intergenic
1111277023 13:85963619-85963641 ATGCCCAAGCTGGAAGTTTGTGG - Intergenic
1112739152 13:102454388-102454410 TTTCAAAGGGTGGGAGTTGGGGG + Intergenic
1113205182 13:107908524-107908546 TTTCCAAATCTTGAAGTAGCTGG - Intergenic
1113275861 13:108729033-108729055 TTTCAAATTCTGGAAGATGGAGG + Intronic
1114267857 14:21083144-21083166 TTTCCACAGCTGGTAAATGGGGG + Intronic
1114303908 14:21403525-21403547 CTTCCAAAGCTTAAAGCTGGTGG - Exonic
1115661403 14:35498281-35498303 TTTCCAATGCTGAAAGTTGGGGG - Intergenic
1116299433 14:43158820-43158842 TTTCAAAGGGTGGAGGTTGGGGG + Intergenic
1116936435 14:50745282-50745304 TTTTCACAACTGGAAGGTGGGGG - Intronic
1117057035 14:51922870-51922892 TTTCCAAGGCTGCAGGGTGGGGG + Intronic
1120151964 14:81046122-81046144 TTCCCAAAGAGGGAAATTGGTGG + Intronic
1120977997 14:90266479-90266501 TTTCCTAAGCTGTAAGATGAGGG - Intronic
1121823438 14:96990454-96990476 TTTTCTAAACTGGAAGATGGAGG + Intergenic
1122472586 14:101981161-101981183 TTTCCCAGGCTGGAATGTGGTGG + Intronic
1127170028 15:56291708-56291730 CTTTCAAAGGTAGAAGTTGGGGG - Intronic
1127204540 15:56700259-56700281 ATCCCAAAGCTGGCAGTTGATGG - Intronic
1129079072 15:73023667-73023689 TTTCCAAAGCTGAATCTTTGAGG - Intergenic
1129713206 15:77832063-77832085 TTTCTGGAGCTGCAAGTTGGGGG - Intergenic
1129783704 15:78293132-78293154 TTTCCAAGGCTGTATGTTAGGGG + Intronic
1132364070 15:101243282-101243304 TTTCCAAAGCTTGAAAGTGTTGG + Intronic
1133522282 16:6570697-6570719 TTTCCTGAGTAGGAAGTTGGCGG - Intronic
1133977308 16:10608489-10608511 TTTCCACAGATGGGGGTTGGGGG - Intergenic
1134327052 16:13216908-13216930 TTTCCAAGGCTGGGCGTGGGTGG - Intronic
1137602430 16:49765297-49765319 TTTCCGAAGGTGGATGGTGGTGG + Intronic
1137966665 16:52941394-52941416 TTTCTAAATCTGTAAGTTGTAGG - Intergenic
1138115925 16:54360529-54360551 TGACCAAAGCTGGGAGGTGGGGG + Intergenic
1138794377 16:59950246-59950268 TTTCCAAAGGGGGTAGTTGGTGG + Intergenic
1145835132 17:27949201-27949223 TTTACAAAGCAGGTGGTTGGTGG + Intergenic
1147248306 17:39137046-39137068 TTTGCCATGCTGGACGTTGGGGG - Intronic
1147631149 17:41932582-41932604 TCTCCCAAGCTGGAATGTGGTGG + Intronic
1148188339 17:45660796-45660818 TCTCCAAAGCTAGAGTTTGGGGG - Intergenic
1148955339 17:51349172-51349194 CATCCAAACCTGGAAGTAGGAGG - Intergenic
1149114236 17:53072558-53072580 TTTGCAAAGCTGAAAATTGATGG - Intergenic
1149368392 17:55968150-55968172 TTTTCAAAGCTGATAGTTGGTGG - Intergenic
1150824090 17:68459241-68459263 TTGACAGAGCTGGAAGGTGGGGG - Intergenic
1150984180 17:70176581-70176603 TTTCCAAAACTTGAACTTGCAGG + Exonic
1152387685 17:79984899-79984921 TGTCCGAAGCTGGAGGATGGTGG - Intronic
1153205608 18:2696509-2696531 TTTCCAGAGATGGGAGTTGAAGG - Intronic
1153755441 18:8278325-8278347 ATTCCAAAGAAGGAAGTTGTAGG + Intronic
1154059664 18:11047486-11047508 TTTCCAAGAGTGGAATTTGGGGG - Intronic
1155790764 18:29967656-29967678 TTTCCAAAGGTGGAATTAGAAGG + Intergenic
1156481159 18:37437260-37437282 TTTCCCAAGCTGGAGGCTGCTGG + Intronic
1157012224 18:43664302-43664324 TTTCTAAAGCAGCAAGTTAGAGG + Intergenic
1157308482 18:46534438-46534460 TTTCCAAAGTTAGAAGATGTGGG - Exonic
1157965914 18:52207936-52207958 TTCCCAAAGAAGGAAGTTGGGGG - Intergenic
1158456290 18:57611004-57611026 TTGCCCAGGCTGGAAGGTGGTGG + Intronic
1158684185 18:59598216-59598238 TTTACAAAGCTTGAAGTAGTGGG + Intronic
1159142586 18:64415451-64415473 TGTCCATAGATGAAAGTTGGTGG + Intergenic
1160019055 18:75166311-75166333 TTTCCACAGCTGGGAGTGGTCGG - Intergenic
1163713838 19:18862871-18862893 ATTCACCAGCTGGAAGTTGGGGG + Intronic
1163849114 19:19653641-19653663 TCTCCAAAGGTAGAAGCTGGAGG + Intronic
1164399133 19:27890811-27890833 ATTCCACAGCTGAGAGTTGGAGG - Intergenic
1165870427 19:38968444-38968466 TCTCCCAAGCTGGAGGGTGGTGG - Intronic
1165985523 19:39765598-39765620 TTTCCAAGGCTGGAAATGGATGG + Intergenic
1166117900 19:40667109-40667131 TGTCCAACACTGGAAGGTGGGGG + Exonic
1166130597 19:40743598-40743620 TTTCCCCATCTGGAAATTGGGGG - Intronic
1166266486 19:41687762-41687784 TTTCCAATGCCTGAGGTTGGTGG + Intronic
1166671986 19:44715938-44715960 TTTCCTCACCTGTAAGTTGGGGG - Intergenic
925513122 2:4649612-4649634 ATTCCAAAGCTGGTAGCTGCAGG - Intergenic
925777860 2:7352513-7352535 TTTCCAAAGCTGAAACTTGAAGG - Intergenic
926010535 2:9402610-9402632 TTTCCAAAACTGGAAAATAGAGG + Intronic
926585450 2:14680784-14680806 TTTCCAAAGCTGTAACATAGAGG + Intergenic
927468825 2:23357081-23357103 GCTCCAAAGCTGGAAGGTAGCGG + Intergenic
927511850 2:23648920-23648942 TTTCCACATCTGTAACTTGGAGG + Intronic
928095615 2:28403117-28403139 TCTGAAAAGCTGGAAGTAGGGGG + Intronic
928704995 2:33940180-33940202 TTCCCAATGTTGGAAGTTGGGGG + Intergenic
929502831 2:42504835-42504857 TTTGCAAAGCTGGAAATTTAAGG - Intronic
931099922 2:58985915-58985937 TTTCTAAAGTAGGAAGTTTGTGG - Intergenic
933191817 2:79342503-79342525 CTTTCAAAGATGGAAGTTTGTGG - Intronic
933272800 2:80251420-80251442 TTTTCAAACTGGGAAGTTGGTGG - Intronic
933764533 2:85697761-85697783 TTTCCCAAGCTGGGAGATGGGGG - Intronic
934706440 2:96484853-96484875 TATCCCAAGGTGGAAGGTGGAGG - Intergenic
935167688 2:100583639-100583661 TTTCCAAATCTGTGAATTGGTGG - Intergenic
935242226 2:101188855-101188877 TTCCCAAAGCTGCCAGTAGGGGG - Intronic
935594507 2:104868505-104868527 TGACCACAGCTGGAAGTTGGAGG - Intergenic
936265103 2:110998761-110998783 TTTCCAGAGGTGGGAGCTGGAGG - Intronic
937934291 2:127230263-127230285 TTTCCAATGCATGAATTTGGAGG - Intergenic
938128799 2:128693478-128693500 TTTCCATGGCTGTAAGTTAGTGG + Intergenic
941447037 2:165615134-165615156 TTTCCAATGCTGAAATGTGGTGG + Intronic
942089513 2:172475338-172475360 TTTCCAAAGCTGGGAGTAGCTGG - Intronic
942721108 2:178953469-178953491 TTCCCAAAAGTGGAATTTGGGGG - Intronic
943081308 2:183261540-183261562 TTTCAAAAGCTGGAAATTCTGGG - Intergenic
943436950 2:187876664-187876686 TGTCAAAAGCTGAAAGGTGGTGG + Intergenic
944289049 2:197983740-197983762 TTTCTAAAGATGGAACTTTGTGG + Intronic
946108600 2:217393902-217393924 TATCCATATTTGGAAGTTGGGGG - Intronic
946163597 2:217850276-217850298 TTTCCTATGCTGGAGGATGGGGG + Intronic
947610723 2:231523655-231523677 CTTCCAAGGCTGGGAGCTGGAGG - Exonic
947990868 2:234486450-234486472 TATCCAAAGGAGGCAGTTGGTGG + Intergenic
948525012 2:238566191-238566213 ATTCCCAAGCTGGGATTTGGAGG - Intergenic
948680570 2:239631548-239631570 TTTCCAAAGGAGGAAGTTGATGG + Intergenic
1169718672 20:8648169-8648191 ATACCAAAGCAGGAAGTGGGTGG + Intronic
1170083553 20:12503999-12504021 ATTCCAAAGCTGGAAATCTGTGG - Intergenic
1170187160 20:13603500-13603522 TTTCCCAAGCTGGAGAGTGGTGG - Intronic
1170309576 20:14977583-14977605 TTTCCTCAGCTGGAAATTGGTGG + Intronic
1170509683 20:17063872-17063894 TTTCCCAAGTGGAAAGTTGGAGG - Intergenic
1171097807 20:22348912-22348934 TTTACAAAGCTAGTAATTGGTGG - Intergenic
1172706659 20:36887166-36887188 CTTCCAAAGCTGGAGGGAGGAGG - Intronic
1173552025 20:43938982-43939004 TTGCCTTAGCTGGAAGTTGAGGG + Intronic
1174160767 20:48548848-48548870 GGTCCCAAGCTGGATGTTGGGGG - Intergenic
1174771157 20:53301764-53301786 TTTAAAAACCTGAAAGTTGGGGG - Intronic
1174842104 20:53910537-53910559 TTTCCCAATCTTGAAATTGGAGG - Intergenic
1175140326 20:56856082-56856104 TTGCCAAAGCTGGTATGTGGAGG - Intergenic
1175326105 20:58129570-58129592 TTTCCAAGGTTGGCAGGTGGAGG - Intergenic
1175877238 20:62236222-62236244 TCTCCAAGGATGGAAGATGGGGG - Intronic
1176184559 20:63771254-63771276 TTTCCAGAGCTGCAAGATGGCGG + Intronic
1177386821 21:20419716-20419738 TTTCCAAAGAGTGATGTTGGAGG + Intergenic
1178306162 21:31491812-31491834 TTTTCAAGGATGGAGGTTGGTGG + Intronic
1178330678 21:31688073-31688095 TTGCCCAAGCTGGAATGTGGTGG - Intronic
1178415935 21:32405119-32405141 TTTCCAAAGATGGGGGTTGGGGG + Intergenic
1181896023 22:26108262-26108284 TTTACAAACCTGGATGTGGGTGG - Intergenic
1181992964 22:26851497-26851519 TTTCCTTATCTGTAAGTTGGGGG + Intergenic
1182624031 22:31633122-31633144 TTTCCAGTTCTGGAAGTTGGTGG - Intronic
1183196537 22:36357546-36357568 TCACCAAAGGTGGAAATTGGGGG + Intronic
949638285 3:6008217-6008239 TTTCCAAAACATGAAGTTGAGGG + Intergenic
949659691 3:6263980-6264002 TTTCTATATCTGGAAGTTGGTGG + Intergenic
949731510 3:7118348-7118370 TTGCCCAAGCTGGAGGATGGTGG - Intronic
949764745 3:7514029-7514051 TTTCCTTAGCTGTAAGCTGGGGG + Intronic
950012782 3:9734749-9734771 TTTCCAGAGCTGCAAGGTAGAGG - Intronic
950381001 3:12614788-12614810 TCTGAAAAGCTGGAAGTTGGTGG - Intronic
951664299 3:25104882-25104904 TCTCCAGTGCTAGAAGTTGGGGG + Intergenic
953714826 3:45308147-45308169 TTTCCTAACCTGTAAGTTGGGGG + Intergenic
953807048 3:46079582-46079604 TTTCCTAAGGTGGTAGTGGGAGG - Intergenic
955062214 3:55503119-55503141 TTTCCAGATCTGGATATTGGGGG - Intergenic
955482399 3:59402748-59402770 TCTCAAAAGCTGGTAGTTGGAGG - Intergenic
955566417 3:60251768-60251790 TTTCCATAGGTGGAAATGGGAGG - Intronic
956516551 3:70055210-70055232 TTATCAAAGCTGGATGATGGAGG + Intergenic
956586521 3:70871090-70871112 TTTCCAAAACATGAATTTGGGGG - Intergenic
957358613 3:79124980-79125002 AATCCAAAGATGTAAGTTGGTGG + Intronic
957724211 3:84044038-84044060 TATCCATAGATGGAGGTTGGGGG + Intergenic
959287717 3:104438114-104438136 TTGTCACAGCTGGAGGTTGGAGG + Intergenic
959774597 3:110141804-110141826 TTTCCAAAGCCGAACTTTGGTGG + Intergenic
960698482 3:120418319-120418341 TTTCCAAAGCTAGAAATGAGAGG + Intronic
961346849 3:126268607-126268629 TTTCAGGAGCTGGAGGTTGGGGG + Intergenic
961352559 3:126313287-126313309 TTCCAGAGGCTGGAAGTTGGAGG - Intergenic
961549725 3:127662133-127662155 TTTGGGAAGCTGGAAGGTGGAGG - Intronic
961658905 3:128458015-128458037 GTTCGAAAGCTGGAGGTGGGAGG + Intergenic
962116501 3:132514849-132514871 TGTCAAAAGTTGAAAGTTGGGGG + Intronic
962775446 3:138654987-138655009 TTTCCACACCTGGGGGTTGGTGG - Exonic
963935379 3:151046913-151046935 GTTCCAGAGCTGGAAGATGGAGG - Intergenic
965116399 3:164495297-164495319 TTTCCTCAGCTGGAAAATGGTGG + Intergenic
965128374 3:164660230-164660252 TTTTCAATGCTTGAATTTGGGGG + Intergenic
966620242 3:181955382-181955404 TTTCCAGAGCTTGAAGCTTGTGG - Intergenic
966807852 3:183820314-183820336 GTCCCAGAGCTGGAAGGTGGGGG + Intronic
967738130 3:192975477-192975499 TGTCCAACGCTGAAAGTGGGAGG - Intergenic
968126792 3:196166011-196166033 TTTTCAAAGCAGGAAGAAGGCGG + Intergenic
969471795 4:7393380-7393402 TTTCCAAAGCTGTTAGCTGAGGG + Intronic
971240116 4:24880873-24880895 TTTCCACACCTGGAAGATGAGGG + Intronic
971756507 4:30715254-30715276 TTTACAAAAATGTAAGTTGGGGG - Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
972305296 4:37824986-37825008 TTTCAAGAGCTGGGGGTTGGGGG - Intergenic
973257075 4:48124289-48124311 TTTCCACAATTGGAAGGTGGTGG - Intronic
974226265 4:59049511-59049533 ATGCAAAAGCTGGAGGTTGGGGG - Intergenic
975961496 4:79913136-79913158 TTGGCATAGCTGGAAGTTGGTGG - Intronic
976450802 4:85188805-85188827 TATCCAATGCTGAAAGTTGGGGG + Intergenic
976773435 4:88680304-88680326 TTTGCAAAGTTAGAAGTTAGGGG - Intronic
977258168 4:94763248-94763270 TTTCCAAAGCTGAGGGTTAGAGG - Intronic
980156621 4:129115440-129115462 TATGCAAACCTGGAAGTTTGAGG + Exonic
982564780 4:156972372-156972394 TTTACGGAGCTGGAAATTGGAGG - Intergenic
982658407 4:158177114-158177136 TTTCCATACCAGGAAATTGGAGG - Intergenic
982933529 4:161439985-161440007 TTGCCATATCTGGAAGTTGCAGG + Intronic
983310089 4:166048351-166048373 TTTTCAAGGCTGGAAGTTCAAGG - Intronic
983449514 4:167893118-167893140 TTTACAAAGCTAGAAGTTTTGGG + Intergenic
985365391 4:189226559-189226581 TATTCAATGCTGGAAGTGGGAGG - Intergenic
985810800 5:2083046-2083068 TTTCACAAGCTAGAAATTGGAGG - Intergenic
986297616 5:6452609-6452631 TTTCAAAAGCTGGAAGATGTTGG + Intronic
986306873 5:6522739-6522761 TTTCCAGAGATGGAGGCTGGAGG + Intergenic
987913088 5:24175441-24175463 TTTCCAAACCTGAAAGCTTGGGG + Intronic
989822431 5:45810002-45810024 CTTCCAAAGCAGGAAGTAGTAGG + Intergenic
990314049 5:54567490-54567512 ATTCTAAAGTTGGAAGTTTGGGG + Intergenic
991496821 5:67235001-67235023 TGACCAAAACTGGAACTTGGAGG + Intergenic
993372330 5:87108308-87108330 TTCCCATAGCTGGAAAGTGGTGG - Intergenic
993855258 5:93066376-93066398 TTTCCACAGATGGGGGTTGGGGG - Intergenic
994126825 5:96177224-96177246 TTCCCAAAATAGGAAGTTGGTGG - Intergenic
995362314 5:111311255-111311277 TTTCTAAAACTGGCAGATGGAGG + Intronic
997768220 5:136526433-136526455 TTTCCAGTCCTGGAAGTAGGTGG + Intergenic
999121770 5:149215274-149215296 TTTCCTAAGCTGGAATGTGTGGG - Intronic
1001015506 5:168137281-168137303 TTTCCAAAGCTGTAAGCAGAGGG + Intronic
1001874931 5:175191800-175191822 TTTCCAAAACTGGATTGTGGTGG - Intergenic
1004373759 6:15074602-15074624 TTTCCACAGATGGAGGGTGGGGG + Intergenic
1004399158 6:15272567-15272589 TTTCCACAGCTGCAATTTGGGGG - Intronic
1005083514 6:21980906-21980928 TTTCCAGAGCAGGAAGGAGGAGG - Intergenic
1005083636 6:21981620-21981642 GTTCCAAAGCAGGAAGGAGGAGG - Intergenic
1005592719 6:27345452-27345474 TATCCATAGCTGGAGTTTGGTGG + Intergenic
1007137101 6:39533000-39533022 TTTCAAAAGCTGGAAACAGGAGG + Intronic
1009201883 6:60756120-60756142 TTGCTAAAGCTGGGAGCTGGAGG + Intergenic
1009897429 6:69770294-69770316 ATAACCAAGCTGGAAGTTGGGGG + Intronic
1010264104 6:73848627-73848649 TGTCTAATGCTGAAAGTTGGGGG + Intergenic
1010697312 6:78992491-78992513 TTTCACAAGCTGCAAGTTTGTGG + Intronic
1010834979 6:80574794-80574816 TTTCCTAAAATGGAAGTTGATGG - Intergenic
1012208358 6:96489566-96489588 CTTCAAAAGCAGGAAATTGGAGG + Intergenic
1012372064 6:98519853-98519875 TTTGAAAAGATGGGAGTTGGGGG + Intergenic
1013713071 6:112924193-112924215 ATTCCAAAGCTGACAATTGGAGG - Intergenic
1014004058 6:116397009-116397031 ATTCAAAAGCTGGTAGTTGAGGG + Intronic
1014268047 6:119303895-119303917 TTTCCAAAGCTAGGAGTGGCAGG - Intronic
1015186475 6:130422306-130422328 TTGCCCAAGCTGGAAGGTAGTGG + Intronic
1015359165 6:132317189-132317211 TTTCGAAAGCTGGATTTTGCTGG - Intronic
1016832462 6:148447542-148447564 GATCCAAAGCAGGGAGTTGGAGG - Intronic
1016951647 6:149586499-149586521 TTTCCAAAGCTGGGTTTTGGTGG - Intronic
1017202853 6:151774597-151774619 CTTCTACAGTTGGAAGTTGGTGG - Intronic
1018097529 6:160403503-160403525 TTTCCAAAGATAGAAGTAGAGGG + Intronic
1019942955 7:4305664-4305686 TTTCCAATGCAGGGTGTTGGGGG + Intergenic
1020376436 7:7492543-7492565 TTGCCAAAGCTGGAGTGTGGTGG - Intronic
1020569223 7:9837418-9837440 TTTTCAAGTCTTGAAGTTGGAGG + Intergenic
1021637953 7:22709746-22709768 TTTCCAAAGCTGGCACTTTGGGG - Intergenic
1022508944 7:30923160-30923182 CTTCCAAAGCTGGGAGTGTGGGG + Intronic
1023602063 7:41890033-41890055 TTCCCAAAGCTAGTAGCTGGTGG + Intergenic
1026413116 7:70147488-70147510 TTTACAAGTCTGGAAGTTGTAGG - Intronic
1026533628 7:71221945-71221967 TTTCCTAGGCTGGAATGTGGTGG + Intronic
1028452294 7:90999166-90999188 TTTCCAAAACTCGAAGTTTGGGG + Intronic
1030523582 7:110627897-110627919 AGTCCAAAGGTGGAGGTTGGAGG - Intergenic
1031063618 7:117079630-117079652 TTTCTAAAGCAGGAATTTAGGGG - Intronic
1032058531 7:128704210-128704232 TTTCCACAGATGGAGGGTGGGGG + Intergenic
1033033795 7:137851575-137851597 TTTGCAAAGCTGGGTTTTGGTGG - Intergenic
1034746613 7:153529090-153529112 TTTGCAAAGCTGGGTTTTGGTGG - Intergenic
1034787342 7:153937217-153937239 TTTGGAAGGCTGGAAGCTGGAGG - Intronic
1036409865 8:8489400-8489422 TTTCAAAACCGGGAAGATGGTGG - Intergenic
1036676281 8:10836669-10836691 TTTCCAAACAAGGATGTTGGGGG + Intronic
1037072052 8:14662857-14662879 TTTCCAGAGTTTGAAGGTGGAGG + Intronic
1038016157 8:23516929-23516951 TCTCCATTCCTGGAAGTTGGTGG - Intergenic
1038494890 8:27994426-27994448 TTTCCAATGCTTGAATTTAGGGG - Intergenic
1039575340 8:38619162-38619184 TTCCAAAAGGTGGAAGATGGGGG - Intergenic
1039656474 8:39413852-39413874 TCACCCAAGCTGGAGGTTGGTGG - Intergenic
1040881899 8:52214414-52214436 TTTCCAAAGCTGGTGGTATGTGG - Intronic
1041399848 8:57430478-57430500 TTCTCAAAGGTGGAAGTTTGTGG + Intergenic
1044064956 8:87687948-87687970 TTTCCACAGATGGGGGTTGGGGG + Intergenic
1045229786 8:100292966-100292988 TTTCCACAGATGGAGGTGGGGGG + Intronic
1045343768 8:101276296-101276318 TTTCCTTATCTGTAAGTTGGGGG + Intergenic
1045722601 8:105131315-105131337 TGACAAAAGCAGGAAGTTGGAGG - Intronic
1046107244 8:109681075-109681097 TTTGAACAGCTGGAAGTTTGTGG + Intronic
1047705439 8:127494660-127494682 TTTCCACATCTGTAAATTGGGGG + Intergenic
1048327044 8:133447957-133447979 TTTCCAAATCTGTACATTGGAGG - Intergenic
1048782252 8:138015200-138015222 TTTCATTAGCTAGAAGTTGGTGG + Intergenic
1050302509 9:4274080-4274102 TTTCCTCATCTGGAAGGTGGGGG - Intronic
1051017944 9:12503832-12503854 TTTCTAAAGCTCCAAGTTGAAGG + Intergenic
1051663984 9:19451039-19451061 TTCCCAAAGATGGAAAATGGAGG + Exonic
1052943380 9:34147935-34147957 TTTCCAAAGCTGGAACTATTAGG + Intergenic
1052978984 9:34433652-34433674 TTTAGAAAGATGGCAGTTGGAGG - Intronic
1053412935 9:37927462-37927484 TTTCTCAAGCTCTAAGTTGGTGG + Intronic
1054850976 9:69846393-69846415 ATTCCAAATCTGGCAGGTGGAGG - Intronic
1055459550 9:76505304-76505326 TTTGTAAATGTGGAAGTTGGTGG + Exonic
1056593751 9:87987749-87987771 TTTCCACGGATGGAAGTAGGGGG - Intergenic
1056910798 9:90698406-90698428 TTTCAAAAGGTGGAGGCTGGAGG + Intergenic
1057553250 9:96067346-96067368 TTCCCAGAGGTGGAAGGTGGTGG - Intergenic
1058255326 9:102754773-102754795 TTTCAGAGGCTGGATGTTGGGGG - Intergenic
1059313275 9:113403005-113403027 TTTCAAAAGGTGGAGGCTGGGGG - Intergenic
1061677008 9:132223220-132223242 TTACCAAAGCTGGCAGATGGGGG + Intronic
1062470608 9:136701985-136702007 TTTGCAAAGGTGTAAGTGGGGGG - Intergenic
1186986333 X:15018275-15018297 TATCCAAAGCAGGAAGTGGAGGG + Intergenic
1187470048 X:19561563-19561585 TCTGCAAAGATGGAAGGTGGCGG - Intronic
1188124002 X:26345412-26345434 TTTTCAAAGCAGGAATTTTGTGG - Intergenic
1192430572 X:71108835-71108857 TTTCCTAAGATGTAAGATGGAGG - Intronic
1193539086 X:82748967-82748989 TTTCCAGAGATAGAAGATGGAGG + Intergenic
1194077257 X:89411695-89411717 TTTCAAATGGTGGAGGTTGGGGG - Intergenic
1194303408 X:92214474-92214496 TTTCCACATCTGTAACTTGGGGG + Intronic
1194728121 X:97423013-97423035 TTTCCAACTCTGGGGGTTGGAGG - Intronic
1196106943 X:111906542-111906564 TTTCCAAAGCTGGAAGTTGGGGG - Intronic
1196281847 X:113831480-113831502 TTTGAAAAGCTGTAATTTGGGGG + Intergenic
1197707100 X:129641867-129641889 TTTCCAAAACATGAAGTTGAAGG + Intergenic
1198793978 X:140376251-140376273 TTTCCTAAGCTCCAAATTGGGGG - Intergenic
1198970301 X:142271664-142271686 TTTCAAAAACTGGAAATGGGAGG - Intergenic
1199076444 X:143531351-143531373 ATTCCAAAGATGGTATTTGGGGG + Intergenic
1199837717 X:151609403-151609425 TTTTCAAAGCTGGAAATGGATGG - Intronic
1199946482 X:152672716-152672738 TGTCAAGGGCTGGAAGTTGGTGG + Intergenic
1200294221 X:154902118-154902140 CATCCAAAGCTGGAATTTGGCGG - Exonic
1200773107 Y:7145440-7145462 TTTCCAGAGATGGATGGTGGTGG + Intergenic