ID: 1196108861

View in Genome Browser
Species Human (GRCh38)
Location X:111924977-111924999
Sequence TGCTGATTGCTGTCACATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196108857_1196108861 28 Left 1196108857 X:111924926-111924948 CCTCTGATAGTGGAAAAGCATCT 0: 1
1: 0
2: 3
3: 17
4: 214
Right 1196108861 X:111924977-111924999 TGCTGATTGCTGTCACATAGAGG 0: 1
1: 0
2: 2
3: 13
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196108861 Original CRISPR TGCTGATTGCTGTCACATAG AGG Intronic
901735003 1:11306692-11306714 TACTGAATGCTGGCACAGAGGGG + Intergenic
902790767 1:18766300-18766322 TGATGATTTCTGCCACACAGGGG + Intergenic
904977011 1:34464434-34464456 TACTGATTGCTGTCACCCATGGG - Intergenic
907130956 1:52096470-52096492 TGCCTTTTGCTGTCACATTGAGG - Intergenic
907938262 1:59062116-59062138 TGCTCACTGATGTCACTTAGAGG + Intergenic
910346707 1:86247220-86247242 TGTAAATTTCTGTCACATAGCGG - Intergenic
913491249 1:119382024-119382046 TGCTGATTCCTGTGATACAGAGG + Intronic
915875766 1:159610668-159610690 TGATGAGTCCTGTCAAATAGTGG - Intergenic
920964413 1:210690283-210690305 TGCTGAGTGCTCTCAGACAGTGG - Intronic
1065216735 10:23456351-23456373 CTCTGTTTGCTGTCACATGGTGG - Intergenic
1065768514 10:29054733-29054755 TTCTGATTGCAGTGACAGAGGGG + Intergenic
1066223130 10:33355540-33355562 CTCTAATTGCTGTCACACAGAGG - Intergenic
1067098408 10:43317282-43317304 TGCTGAATACTGCCACATTGCGG - Intergenic
1068203847 10:53822125-53822147 TGTTGATAGCTGTGTCATAGAGG + Exonic
1068382298 10:56272262-56272284 TTCTGATTGCTGACAAACAGTGG - Intergenic
1069289776 10:66763919-66763941 GTGTGATTGCTGTCACATACTGG - Intronic
1073672849 10:105611313-105611335 TTGTGATTCCTGTCACATAGTGG - Intergenic
1074521724 10:114231509-114231531 TGCTGTTTCCTGTCTCATAAGGG - Exonic
1080439834 11:32282487-32282509 TTCTGATATCTGTCAAATAGAGG - Intergenic
1082645915 11:55725065-55725087 TGTTGATAGCTGTCCCATATAGG + Intergenic
1084471289 11:69360683-69360705 TGCTCCTTGCTGTCATCTAGAGG - Intronic
1089220833 11:116870100-116870122 TGGTTATTGCTGTCACTTAGGGG + Intronic
1091673583 12:2470520-2470542 TGCTGATTCATGACACTTAGTGG + Intronic
1091754333 12:3041724-3041746 GGCTGCTTGCTGCCACCTAGTGG + Intergenic
1102706616 12:114886400-114886422 TGCACATTGCTGTCAATTAGAGG - Intergenic
1102930514 12:116858459-116858481 TGCTGCTTGCTCTCAGAGAGTGG - Exonic
1103331913 12:120160062-120160084 TGCTGCTTGCTGTCACAAGCAGG - Intronic
1104930219 12:132335056-132335078 GGCCGCTAGCTGTCACATAGGGG - Intergenic
1111615424 13:90656273-90656295 TGCACAGTGCTGTCATATAGTGG + Intergenic
1111912389 13:94327251-94327273 TGCAGTTTGCTGACACAGAGGGG - Intronic
1112003778 13:95236677-95236699 TTCTGATTTCTGTATCATAGGGG - Intronic
1112142392 13:96659044-96659066 TGTTGATTGCTGTATCATGGAGG + Intronic
1114695596 14:24624340-24624362 TGCTTATTCCTGGCAGATAGGGG + Intergenic
1118060000 14:62125937-62125959 TGCTGAATGCTGCAACCTAGAGG + Intergenic
1118380180 14:65211735-65211757 TGCTGAATGTTGTCACATAGAGG + Intergenic
1118750767 14:68806646-68806668 TGCTGTTTGCTGGCAGAAAGAGG + Intergenic
1122365958 14:101194991-101195013 TGCTGCCTGGTGCCACATAGTGG + Intergenic
1122574147 14:102731306-102731328 TGCTGACTGCTGTCACCTGGAGG - Intergenic
1122696487 14:103555643-103555665 AACTTATTGCTGTCACATAGCGG + Intergenic
1123739651 15:23224709-23224731 TGATGATACCTGGCACATAGTGG - Intergenic
1124290874 15:28453685-28453707 TGATGATACCTGGCACATAGTGG - Intergenic
1126851055 15:52797273-52797295 TGCTGGTGGCTGTCACACAAGGG - Intergenic
1127496468 15:59517310-59517332 TTCTGAGTGCTGTCATATATGGG + Intronic
1127843559 15:62850245-62850267 TGCTGATTGTGGTCAGAAAGTGG - Intergenic
1127944840 15:63740599-63740621 TTTTGATTACTGTCACTTAGTGG + Intronic
1129246946 15:74285107-74285129 TGGTCAGTGCTGTCACAGAGCGG + Intronic
1129561848 15:76578323-76578345 TGCTGATTGCTGAGCCCTAGGGG + Intronic
1133458974 16:5970130-5970152 TGCTGCTTCCTGTCACATAGAGG + Intergenic
1133846485 16:9458740-9458762 AGCTGATTGTTGCCAGATAGAGG - Intergenic
1136785257 16:32930395-32930417 GGCTGCATGCTGTCACATTGTGG + Intergenic
1136884525 16:33923409-33923431 GGCTGCATGCTGTCACATTGTGG - Intergenic
1136932401 16:34431328-34431350 TGCTGACTGTTGTCAAAAAGTGG - Intergenic
1136972171 16:34980486-34980508 TGCTGACTGTTGTCAAAAAGTGG + Intergenic
1137699329 16:50485007-50485029 AGCTGATTTCTGTGACATAAAGG - Intergenic
1138158991 16:54735730-54735752 TGCTGATGGCTATCAGAGAGGGG - Intergenic
1203087915 16_KI270728v1_random:1194404-1194426 GGCTGCATGCTGTCACATTGTGG + Intergenic
1142557801 17:791373-791395 TGCTGGATGCTGTCAGAGAGAGG + Intronic
1142908248 17:3063196-3063218 GGCTCATGGCTGTGACATAGTGG + Exonic
1142926317 17:3241065-3241087 GGCTCATGGCTGTGACATAGTGG - Intergenic
1146952617 17:36917225-36917247 TGCTGATTGGTGGGACACAGTGG - Intergenic
1153629993 18:7060629-7060651 AGATGATTGCTGACAAATAGAGG + Intronic
1154983202 18:21521641-21521663 TGCTGCTTGCTGGCATATAGTGG + Intronic
1155453458 18:25986733-25986755 TGCTGACTACTCTCACATGGAGG - Intergenic
1156645999 18:39162864-39162886 TGGTGAATGCAGTCACATACTGG - Intergenic
1158815355 18:61088628-61088650 GGAGGATTGCTGTCACAAAGTGG - Intergenic
1158845961 18:61443217-61443239 TGCTGTTTGCTGGCCCTTAGAGG - Intronic
1159529307 18:69635581-69635603 TCCTCGTTGCTGTCACATAGGGG - Intronic
1162224505 19:9208998-9209020 TGCTTTTTGATGTCACATGGTGG + Intergenic
1164477019 19:28583605-28583627 TGCTCAGGGCTGTCACTTAGGGG - Intergenic
1167043848 19:47038844-47038866 TGCGGATGGCTGCCACATAGGGG + Intronic
1168436454 19:56321592-56321614 TGCTGACTGCTGCCAGATATGGG - Intronic
926539476 2:14157186-14157208 TGATGAATCCTGTCACATAGTGG - Intergenic
927423430 2:22956009-22956031 AGCTGGGTGCTGGCACATAGGGG + Intergenic
929552396 2:42902952-42902974 TGCTGATTCCTGCCTCATGGTGG + Intergenic
930401848 2:50900183-50900205 GGCTGATCCCTGTCACAAAGGGG - Intronic
930917850 2:56715721-56715743 TGCTGATTTCTGCAACATAGAGG - Intergenic
933512224 2:83255422-83255444 AGCTGTTTGCTGTCAGAAAGTGG - Intergenic
935138112 2:100325478-100325500 TGCTGAGTGCTGGCAAATACAGG + Intergenic
935365257 2:102282642-102282664 TGCTATTTGCTGTAAGATAGGGG - Intergenic
938250725 2:129813597-129813619 TGCTGAATGCTGTCCTTTAGAGG - Intergenic
938747201 2:134290673-134290695 AGTTGATTGCTGTGACAGAGGGG + Intronic
946301819 2:218828530-218828552 TGCTTCTTGCTGTCCCATAGAGG + Exonic
948978013 2:241475771-241475793 TGCTGGTTCCTGTCACAAGGTGG + Intronic
1169899550 20:10538881-10538903 TGCTGATTCATGGCACACAGTGG + Intronic
1170221872 20:13949933-13949955 TGCTGATTGCTTACACATTTTGG - Intronic
1171323998 20:24274808-24274830 TGCTCACTGTTGTCACTTAGGGG - Intergenic
1173466008 20:43281944-43281966 TGCTGATTGCCGTCTCTTTGGGG + Intergenic
1175832327 20:61972658-61972680 TCCTGATTGCTGTCACTTCAGGG + Intronic
1176334261 21:5581179-5581201 TGCTGAGAGCAGCCACATAGGGG + Intergenic
1176393496 21:6239773-6239795 TGCTGAGAGCAGCCACATAGGGG - Intergenic
1176467923 21:7076401-7076423 TGCTGAGAGCAGCCACATAGGGG + Intronic
1176491484 21:7458179-7458201 TGCTGAGAGCAGCCACATAGGGG + Intergenic
1176509158 21:7680204-7680226 TGCTGAGAGCAGCCACATAGGGG - Intergenic
1184141488 22:42580294-42580316 TGCCGTGTGCTCTCACATAGAGG + Intergenic
1184682390 22:46079296-46079318 TGCAGCTCGCGGTCACATAGAGG + Intronic
950440934 3:13009924-13009946 TGCTGATTGCTGTAAGGCAGTGG + Intronic
953250257 3:41239295-41239317 AGCTGATTGCTGTCACCTGGAGG - Exonic
953793468 3:45965894-45965916 TGCTGACTGCTGCCACAGGGCGG + Intronic
955949039 3:64223779-64223801 TGCTGATGGCTTTCACAGATGGG - Intronic
956208386 3:66777508-66777530 TGCTGATTGCTTTGAAATTGTGG + Intergenic
960990271 3:123305647-123305669 TGCTTGTTGCTGTTTCATAGAGG - Intronic
962867334 3:139458595-139458617 TGGTGATTGCTAGTACATAGGGG - Intronic
962959289 3:140294994-140295016 TCCTAAATGCTGTCACATTGGGG + Intronic
966973236 3:185064395-185064417 TGCTGCATGATGTCACATATAGG + Intergenic
971348139 4:25830651-25830673 TGCTGTTAGCTGTCTCATATGGG + Intronic
984980516 4:185276527-185276549 TGCTGCTTGCTTGCACATATAGG - Intronic
993915134 5:93735327-93735349 AGCTGATTAGTGACACATAGAGG + Intronic
995721004 5:115132777-115132799 TGCTGTTTTCAGTCACATAGTGG - Intronic
995971191 5:117973538-117973560 TGCTGATTGCTGTACCATTCTGG + Intergenic
996209564 5:120790145-120790167 TGCTCATGGCTGTCAGATAGAGG - Intergenic
1000313293 5:160065106-160065128 TGCTGCTTGCTGTTAGCTAGGGG + Exonic
1004389649 6:15199251-15199273 TGCTCATTTCTGTGACATGGTGG + Intergenic
1006207567 6:32361866-32361888 TTCTCAATGCTGTCACATTGAGG - Intronic
1010529026 6:76943007-76943029 TGTTTATTGCTGACTCATAGAGG - Intergenic
1010619794 6:78060634-78060656 TCCTTATTGGTGTCCCATAGTGG - Intergenic
1017806035 6:157946305-157946327 TGCTGCTTGCTGTAAAACAGTGG + Intergenic
1018235800 6:161722458-161722480 TGCTTATAGCTGTGACAAAGTGG - Intronic
1018698456 6:166408537-166408559 TGCTGCTTGCTGACACATGCTGG + Intergenic
1023587088 7:41742140-41742162 TGCTCAATGCTGTCGCTTAGAGG - Intergenic
1029347177 7:99987162-99987184 TGCTGATTGCTGACATCCAGGGG + Intergenic
1035279412 7:157767981-157768003 TGCTTATTGCTGACACCGAGCGG + Intronic
1035745302 8:1958205-1958227 TGCTGGCTGCTGTCACTGAGCGG + Exonic
1038810551 8:30837236-30837258 TGCAGAATGCTGCCACATATTGG - Exonic
1039612611 8:38931497-38931519 TCCTGATTCCTGTCCCACAGAGG + Intronic
1039773007 8:40707231-40707253 TGCTTAGTGCTGTCAGATGGGGG - Intronic
1040767092 8:50925236-50925258 TGTGGATTTCTGTCACATGGGGG + Intergenic
1041413159 8:57578720-57578742 TACTCATTGCTAACACATAGAGG - Intergenic
1043723770 8:83582484-83582506 TGATGCTTGCTGTCTCATATGGG + Intergenic
1047790023 8:128193765-128193787 AGCTGATAGCGGTGACATAGTGG + Intergenic
1049985140 9:943385-943407 TGCAGGTTGCTGTCACAGGGAGG + Intronic
1051198132 9:14586314-14586336 TGCTGCTTGCTGCTACAAAGAGG + Intergenic
1051800103 9:20922833-20922855 ATCTGATTGGTGTCCCATAGGGG + Intronic
1053606985 9:39670263-39670285 TGCTGATTGCTGTTGAACAGTGG - Intergenic
1053864902 9:42426934-42426956 TGCTGATTGCTGTTGAACAGTGG - Intergenic
1054246550 9:62672146-62672168 TGCTGATTGCTGTTGAACAGTGG + Intergenic
1054560671 9:66706680-66706702 TGCTGATTGCTGTTGAACAGTGG + Intergenic
1055432351 9:76257117-76257139 TGCTAAGTGCTGTGACACAGTGG - Intronic
1059722259 9:116971728-116971750 TGCTCATTATTGTAACATAGTGG - Intronic
1060937391 9:127523601-127523623 TGCTGAATGGTGACACCTAGTGG - Intronic
1062715648 9:138008868-138008890 TGCTGCCTGCCGTCCCATAGAGG + Intronic
1203427378 Un_GL000195v1:53738-53760 TGCTGAGAGCAGCCACATAGGGG - Intergenic
1192195889 X:69027940-69027962 TGAGGACTGCTGTCTCATAGGGG - Intergenic
1194688658 X:96955850-96955872 TGCTGATTGCTTTCACAAGTTGG + Intronic
1196108861 X:111924977-111924999 TGCTGATTGCTGTCACATAGAGG + Intronic
1198140210 X:133795065-133795087 TGTTGATTGTTGATACATAGCGG - Intronic
1199005392 X:142690359-142690381 TGCTGATTGCTCTCTCAGTGTGG + Intergenic