ID: 1196116624

View in Genome Browser
Species Human (GRCh38)
Location X:112005959-112005981
Sequence GCAGGGGGAAGGTGGCGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196116605_1196116624 21 Left 1196116605 X:112005915-112005937 CCCCAAGGCCGACCATGGGTTCC No data
Right 1196116624 X:112005959-112005981 GCAGGGGGAAGGTGGCGGCGGGG No data
1196116612_1196116624 0 Left 1196116612 X:112005936-112005958 CCCAGGAGAATGGACAGATCTTG No data
Right 1196116624 X:112005959-112005981 GCAGGGGGAAGGTGGCGGCGGGG No data
1196116613_1196116624 -1 Left 1196116613 X:112005937-112005959 CCAGGAGAATGGACAGATCTTGG No data
Right 1196116624 X:112005959-112005981 GCAGGGGGAAGGTGGCGGCGGGG No data
1196116604_1196116624 22 Left 1196116604 X:112005914-112005936 CCCCCAAGGCCGACCATGGGTTC No data
Right 1196116624 X:112005959-112005981 GCAGGGGGAAGGTGGCGGCGGGG No data
1196116609_1196116624 13 Left 1196116609 X:112005923-112005945 CCGACCATGGGTTCCCAGGAGAA No data
Right 1196116624 X:112005959-112005981 GCAGGGGGAAGGTGGCGGCGGGG No data
1196116606_1196116624 20 Left 1196116606 X:112005916-112005938 CCCAAGGCCGACCATGGGTTCCC No data
Right 1196116624 X:112005959-112005981 GCAGGGGGAAGGTGGCGGCGGGG No data
1196116607_1196116624 19 Left 1196116607 X:112005917-112005939 CCAAGGCCGACCATGGGTTCCCA No data
Right 1196116624 X:112005959-112005981 GCAGGGGGAAGGTGGCGGCGGGG No data
1196116611_1196116624 9 Left 1196116611 X:112005927-112005949 CCATGGGTTCCCAGGAGAATGGA No data
Right 1196116624 X:112005959-112005981 GCAGGGGGAAGGTGGCGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196116624 Original CRISPR GCAGGGGGAAGGTGGCGGCG GGG Intronic