ID: 1196117856

View in Genome Browser
Species Human (GRCh38)
Location X:112016509-112016531
Sequence GGGTGCTCAGAAAGCATAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196117848_1196117856 18 Left 1196117848 X:112016468-112016490 CCAAGGTAAGGATGAGCTGGCAT 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1196117856 X:112016509-112016531 GGGTGCTCAGAAAGCATAGTTGG 0: 1
1: 1
2: 0
3: 15
4: 168
1196117853_1196117856 -9 Left 1196117853 X:112016495-112016517 CCTGGCCCAGACAGGGGTGCTCA 0: 1
1: 0
2: 1
3: 20
4: 347
Right 1196117856 X:112016509-112016531 GGGTGCTCAGAAAGCATAGTTGG 0: 1
1: 1
2: 0
3: 15
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196117856 Original CRISPR GGGTGCTCAGAAAGCATAGT TGG Intronic
902783341 1:18717985-18718007 GGGTGGTCAGACAGCAGAGTCGG - Intronic
904292115 1:29493525-29493547 GGCTGTACAGAAAGCATGGTTGG - Intergenic
909669453 1:78171842-78171864 AGGGGCTCAGAAAGTAGAGTTGG + Intergenic
911035047 1:93533591-93533613 GAGTGATCAAAAAGCATGGTTGG + Intronic
915230361 1:154441373-154441395 GGGAGCTCAGATAGAACAGTCGG + Intronic
922683683 1:227622310-227622332 GGGTGCTGACAAATCATAGGTGG - Intronic
923195694 1:231664529-231664551 GGGTGCTCATAAAGGAAAGAGGG + Intronic
923907419 1:238400811-238400833 GGGTGATCAGAAAGTATATATGG + Intergenic
1065404587 10:25349654-25349676 GGCTGTACAGAAAGCATGGTTGG - Intronic
1065563994 10:26990848-26990870 AAGTGCTCAGAAAGCATAATTGG - Intergenic
1065919968 10:30384650-30384672 GGGTGATCAGAAAGAACACTGGG + Intergenic
1068819037 10:61352023-61352045 AAGTGCTCCGAAAGGATAGTGGG - Intergenic
1073603599 10:104870980-104871002 GAGTGAGCAGAAAGCACAGTGGG + Intronic
1076992495 11:282771-282793 GGCTGCTCAGATGGCACAGTGGG - Exonic
1079149206 11:17882830-17882852 GGGGGCACTGAAAGCAGAGTAGG + Intronic
1081315110 11:41622512-41622534 GGCTGTACAGAAAGCATGGTTGG - Intergenic
1081336766 11:41876247-41876269 GGGCTCTCAGAAAGCTCAGTAGG - Intergenic
1086589438 11:88494659-88494681 GGCTGTACAGGAAGCATAGTTGG - Intergenic
1087702764 11:101454272-101454294 GGGTGCTCAGAAAGTCTTGATGG + Intronic
1087821571 11:102718466-102718488 GGTTTCCCTGAAAGCATAGTTGG + Exonic
1092168128 12:6355440-6355462 GGGTGCAGAGAGAGCAGAGTTGG + Intronic
1093504633 12:19850873-19850895 GGCTGCTCCGAAATCACAGTGGG + Intergenic
1097473832 12:60029140-60029162 GGGTGATCAGAATGCAAAGGAGG + Intergenic
1104372606 12:128237112-128237134 GGGTGCTCTGAAAGGAGGGTAGG - Intergenic
1105074055 12:133259903-133259925 GGCTGTTCAGAAGGCATGGTGGG + Intergenic
1106699428 13:32213213-32213235 GGATGCTCAGGAAGCACTGTGGG - Intronic
1108009940 13:45995719-45995741 GGGGCCTCAGAAAGCTTACTAGG - Intronic
1111957213 13:94772342-94772364 GGTTTCTCAGAAACCAAAGTTGG - Intergenic
1113828205 13:113273314-113273336 GGCTGCTCAGAAGGCAGAGGTGG + Intergenic
1114467024 14:22930421-22930443 GAGTCCTGAGAAAGCAAAGTAGG + Intergenic
1114843170 14:26289840-26289862 GGCTGTACAGGAAGCATAGTTGG - Intergenic
1115656085 14:35445080-35445102 GGGTGCTATGAGAGCATACTTGG - Intergenic
1119171475 14:72539257-72539279 GGAAGCTCAGAAACCATTGTGGG - Intronic
1120204046 14:81568347-81568369 TGGTGCTATGAAAGCATAGATGG - Intergenic
1120480487 14:85043517-85043539 GGCTGCACAGGAAGCATGGTTGG + Intergenic
1120524620 14:85563449-85563471 GGCTGCACAGAAAGCATGGCTGG + Intronic
1120719465 14:87874788-87874810 GGGTGACCAGAAAGCAGAGCTGG + Intronic
1121856729 14:97277072-97277094 GGAGGCTCAGAAAGAATATTTGG + Intergenic
1121945947 14:98122149-98122171 TGGTGCTCAGGAAGCATTGAGGG - Intergenic
1124036239 15:26055920-26055942 GGGAGCTCAGGAAGCAGTGTTGG - Intergenic
1127982464 15:64045281-64045303 GGGTGCTCAAAAAACATCTTGGG + Intronic
1128856101 15:71017263-71017285 GGGTCCTGAGAAATCATATTGGG - Intronic
1129333132 15:74837991-74838013 GGGTGCTCAGACAGGGCAGTGGG - Intronic
1130708067 15:86252218-86252240 ATTTGCTCAGAAAGCACAGTAGG + Intronic
1132691915 16:1185541-1185563 AGATGCTCAGAAAGCCTAGTGGG + Intronic
1133116110 16:3578867-3578889 GGGTGCTCAGAAAGCATTGTTGG - Intergenic
1134381398 16:13730191-13730213 GGGTGCTAAGAATACATAATAGG - Intergenic
1134517574 16:14899419-14899441 GGGTGCTCAGGCAGCCTCGTGGG + Intronic
1134705242 16:16298070-16298092 GGGTGCTCAGGCAGCCTCGTGGG + Intergenic
1134962299 16:18414044-18414066 GGGTGCTCAGGCAGCCTCGTGGG - Intergenic
1134966596 16:18496643-18496665 GGGTGCTCAGGCAGCCTCGTGGG - Intronic
1135463308 16:22663803-22663825 GGGTTCTCAGAAACACTAGTAGG + Intergenic
1135600989 16:23783244-23783266 TGGTGCTCAGGAAGCCTAGAAGG - Intergenic
1138237075 16:55393115-55393137 GGGTGTGTAGAAAGCATAGATGG + Intronic
1141462257 16:84184476-84184498 GGATGCTGAAACAGCATAGTAGG - Intronic
1141758867 16:86013582-86013604 GGGGGTTCAGAAAGTACAGTGGG + Intergenic
1143009355 17:3857414-3857436 GGGTGCTCAGAAAGATCACTCGG + Intergenic
1143100732 17:4503383-4503405 GTGGGCTCAGAATGCAGAGTGGG - Intronic
1143369432 17:6429247-6429269 GGGTTCTCAGGGAGCCTAGTTGG - Intronic
1147248185 17:39135911-39135933 GGGTGTTCAGAAAGGACAGTGGG - Intronic
1152234884 17:79133398-79133420 AGGTGCTCAGCAAACCTAGTAGG - Intronic
1153328032 18:3841974-3841996 GGGTGCTATGAGAGCATATTGGG + Intronic
1161881394 19:6956346-6956368 TGATGCTCAGAAAGGATAGGCGG + Intergenic
1164627570 19:29739542-29739564 GGGGGCTTAGAAAGCCTTGTAGG - Intergenic
1164967018 19:32494108-32494130 GGGTGCTCAGAAAGCCTTCTTGG + Intergenic
1165004254 19:32791660-32791682 GGGTGCTCAGAAGACAGAGCTGG - Intronic
1165294474 19:34915581-34915603 GGGTCCCCAGAGAGCATGGTGGG - Intergenic
930585332 2:53260919-53260941 GTGTGATCATTAAGCATAGTGGG - Intergenic
930963305 2:57288234-57288256 GGCTGTACAGGAAGCATAGTGGG + Intergenic
933518028 2:83331130-83331152 GGCTGTACAGAAAGCATGGTTGG + Intergenic
933950124 2:87322013-87322035 GGATGGTCAGAAAGCACATTGGG + Intergenic
936153241 2:110032958-110032980 GCCTGCTCAGAAAGCACAGCAGG - Intergenic
936191440 2:110338457-110338479 GCCTGCTCAGAAAGCACAGTAGG + Intergenic
936920562 2:117684445-117684467 GGGTCCCCAGACAGCCTAGTGGG + Intergenic
937111767 2:119372034-119372056 CTGTGCTCAGAAAGCCTGGTGGG - Intronic
938619386 2:133032776-133032798 GGTTGTACAGAAAGCATGGTTGG + Intronic
939208840 2:139144983-139145005 GGATACTCAGAATGCATAATTGG + Intergenic
939791293 2:146580845-146580867 GTTTGCTCAGAAAGCATTTTAGG - Intergenic
940531776 2:154886789-154886811 TTGTGCTGAGAAAGCATTGTGGG + Intergenic
940607215 2:155941489-155941511 GGCTGTACAGAAAGCATAGCTGG + Intergenic
944855449 2:203762741-203762763 GGTTCCTCAGAAAGCAAAGTGGG - Intergenic
945900818 2:215535131-215535153 GGCTGCACAGGAAGCATAGTTGG - Intergenic
948731113 2:239964257-239964279 GGGTCCTCAGAAATCAGAGAAGG + Intronic
1168827233 20:822105-822127 GGGGGCTCAGAATGCACATTTGG + Intergenic
1171208082 20:23296620-23296642 GGGGGCTCCGTAAGCATAGGGGG - Intergenic
1172688561 20:36774941-36774963 GGGAGCACAGAAAGGACAGTTGG - Intergenic
1175878691 20:62243935-62243957 AGGTGCTCAGGAAGCACAGTTGG + Intronic
1176665098 21:9679034-9679056 GGGTGCTCCGGCAGCCTAGTAGG + Intergenic
1178988857 21:37334730-37334752 GGCTGCACAGAAAGCATGGCTGG + Intergenic
1179956039 21:44739215-44739237 GGGTGCTCTGAAGGTAGAGTGGG + Intergenic
1181376539 22:22463128-22463150 GAGAGCTAAGAAAGCATACTTGG + Intergenic
1181596079 22:23915656-23915678 GGGTGCCCAGAAATCTGAGTTGG + Intergenic
1182801123 22:33032784-33032806 GGGTGCTTACAAATCATAGATGG - Intronic
949681146 3:6515855-6515877 GGGTGCTGAAAAAATATAGTGGG - Intergenic
949815324 3:8052269-8052291 GGGTACTCAGAAGGCTGAGTTGG - Intergenic
953150503 3:40320056-40320078 GTGATCTCAGAAAGCATAGGTGG - Intergenic
953360694 3:42293665-42293687 GGCTGCACATGAAGCATAGTTGG + Intergenic
955518642 3:59752818-59752840 GGCTGTACAGAAAGCATGGTTGG - Intronic
959999289 3:112713901-112713923 AGGTGTACAGAAAGCATGGTTGG - Intergenic
961225940 3:125245969-125245991 TAGAGCTCAGAAAGCAGAGTGGG - Intronic
962143943 3:132820537-132820559 GGGTGCTATGAGAGCATTGTAGG + Intergenic
963067299 3:141273981-141274003 GGGGCATCAGAAAGAATAGTGGG - Intronic
965541839 3:169879071-169879093 TGGTGCTCAGTAAGTATACTTGG - Intergenic
965712844 3:171573315-171573337 GGCTGTACAGGAAGCATAGTTGG - Intergenic
966487980 3:180492365-180492387 GGAAGCTCAGAAATCACAGTAGG + Intergenic
968390391 4:187871-187893 GGGTGCCCAGGAGGCAGAGTGGG - Intergenic
968568228 4:1326161-1326183 GGCTCCTCAGAAAGCTCAGTGGG + Intronic
969374360 4:6753390-6753412 TGGGGCTCAGAAAGCACAGCAGG - Intergenic
970225031 4:13848990-13849012 GGCTGCACAGGAAGCATGGTTGG - Intergenic
970497122 4:16637636-16637658 GGATGCTCAGAGAACATAATGGG + Intronic
979232588 4:118362431-118362453 GCCTGCTCATAAAGTATAGTGGG - Intergenic
979377235 4:119961724-119961746 GGCTTCACAGAAAGCATAGCTGG + Intergenic
981106476 4:140887438-140887460 AGGAGCCCAGAAAGCTTAGTGGG - Intronic
982400883 4:154966516-154966538 GGCTGTACAGAAAGCATAGCTGG - Intergenic
982428700 4:155297641-155297663 GGCTGTACAGAAAGCATGGTGGG + Intergenic
984709913 4:182876307-182876329 GGATGCTCAGACAGCGTAGGAGG + Intergenic
985691408 5:1314728-1314750 TGCTGCTCTGAAAGCATGGTGGG + Intergenic
986282051 5:6331330-6331352 GGCTGTACAGAAAGCATGGTGGG - Intergenic
992708629 5:79425901-79425923 GTGTTTTCAGAAAGCATATTTGG - Intronic
995403692 5:111769640-111769662 GGCTGCACAGAAAGCATGGCTGG + Intronic
995623674 5:114054927-114054949 GTTTGCTTAAAAAGCATAGTTGG - Intergenic
999131117 5:149284110-149284132 GCATGCTCAGAAAGCAAAGCGGG + Intronic
999921998 5:156331408-156331430 GTTTGCTCAGAAAGCTTTGTTGG + Intronic
1001531441 5:172465069-172465091 GGGTGCTGTGAAGGCATAGGAGG + Intergenic
1003825350 6:9945954-9945976 GGGTGCTCAGAATAAATACTGGG + Intronic
1005639906 6:27786098-27786120 GGGTGCTGAGAAATTATAGATGG - Intergenic
1006132958 6:31879719-31879741 GGGTGGGGAGAAAGCATACTTGG - Intergenic
1006440819 6:34052588-34052610 GGGTGCTCACATTCCATAGTCGG - Intronic
1007185097 6:39964127-39964149 GGGTGGGCAGAAAGGATACTGGG - Intergenic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1008045607 6:46848872-46848894 GGGTAGTCAGAAAGCAACGTAGG - Intergenic
1008781281 6:55108841-55108863 GAGAGCACAGAAAGCATTGTGGG + Intronic
1010057042 6:71578605-71578627 GGTTTCTCAGATAGCATATTTGG + Intergenic
1012197740 6:96365371-96365393 GGGTGCTAAGAACACATAATAGG + Intergenic
1013408552 6:109864160-109864182 GGGTGGTCAGATACCAGAGTAGG - Intergenic
1014493683 6:122093040-122093062 GGGGGCTAAGAAAACATAGAGGG + Intergenic
1014568730 6:122983281-122983303 GGCTGCCTAGAAAGCATAGTGGG + Intergenic
1015267285 6:131301485-131301507 GGGTCCTCAGAAATCACAGCAGG - Intergenic
1017913132 6:158812287-158812309 GGGTGCTCTGAAATCACACTGGG + Intronic
1019143906 6:169964657-169964679 TGGTGCTGAGATAGCATCGTGGG + Intergenic
1021674307 7:23064839-23064861 GGCTGTACAGGAAGCATAGTGGG - Intergenic
1022995931 7:35755619-35755641 AGGTGCTCAGTAAATATAGTTGG + Intergenic
1025023075 7:55495205-55495227 GTGGACTCAGAAAGCACAGTGGG - Intronic
1026408796 7:70097460-70097482 AGGTGATCACAAAGCATACTGGG + Intronic
1027507345 7:79033656-79033678 GGGTGTTCAGGATACATAGTTGG + Intronic
1028731060 7:94148875-94148897 GGGTCCTCAGCAAGCAGACTTGG - Intergenic
1029347022 7:99986109-99986131 GGGAGCTCAGAGAGCATCTTAGG + Intergenic
1030290905 7:107871847-107871869 TGGTGCTCAGAAGGCGGAGTGGG + Intergenic
1030357449 7:108557920-108557942 GGCTGTACAGGAAGCATAGTTGG + Intronic
1030631903 7:111905208-111905230 TGGTGTTCAGAAAGCATCTTGGG + Intronic
1034934914 7:155192811-155192833 GGGAGCTCAGAAATCAGAGGAGG + Intergenic
1035196743 7:157228245-157228267 TGGTGCTCAGAGAGCAAAGATGG + Intronic
1036283587 8:7422791-7422813 AGGTGCTCAGATAGCAAACTGGG + Intergenic
1036337882 8:7888730-7888752 AGGTGCTCAGATAGCAAACTGGG - Intergenic
1038163237 8:25060540-25060562 TGGTTCTCAAAAAGCATAGTAGG - Intergenic
1038344511 8:26719830-26719852 GGGTTCTCAGAAAGCTTTGAGGG + Intergenic
1046126399 8:109914231-109914253 GTGTGCTCAGAAATCATAGATGG + Intergenic
1046885364 8:119361140-119361162 AGGTGCTCAGAAAGCAAATCAGG - Intergenic
1047305544 8:123650038-123650060 GGGTGCTAAGAAAGCATGTAAGG - Intronic
1047617724 8:126576743-126576765 GGGGGCTCACAAAGCATGTTTGG + Intergenic
1050333591 9:4569822-4569844 GGGTGCTCAGAAAGTATTTGTGG - Intronic
1050565231 9:6875270-6875292 GGGAGCTGAGATAGGATAGTAGG + Intronic
1050569881 9:6926631-6926653 GGGTGCTAAGAACACATGGTGGG + Intronic
1050915412 9:11124346-11124368 AGGTGCTCAGAGAACATAGCTGG - Intergenic
1051711046 9:19931417-19931439 GTGTGATCAGAAAGAATTGTGGG - Intergenic
1053543943 9:39003466-39003488 GGCTGTACAGAAAGCATAGTTGG + Intergenic
1053808374 9:41826963-41826985 GGCTGTACAGAAAGCATAGTTGG + Intergenic
1054622218 9:67360465-67360487 GGCTGTACAGAAAGCATAGTTGG - Intergenic
1056727776 9:89136924-89136946 GGTTGTACAGGAAGCATAGTTGG + Intronic
1059635445 9:116165872-116165894 AAGTGTGCAGAAAGCATAGTGGG - Intronic
1061027204 9:128057424-128057446 AGGGGCACAGAAAGCAGAGTGGG - Intergenic
1061768287 9:132896713-132896735 GGGTGCTCAGATTCCATGGTAGG - Exonic
1203661003 Un_KI270753v1:42715-42737 GGGTGCTCCGGCAGCCTAGTAGG - Intergenic
1186000581 X:5005071-5005093 GGCTGTTCAGGAAGCATGGTTGG + Intergenic
1191058939 X:56274069-56274091 GGTTTCTCAGAAAACAAAGTAGG - Intronic
1193301363 X:79892315-79892337 AGGTGCTCAGACAGCAAAGATGG - Intergenic
1194564109 X:95461777-95461799 GGATGGTCAGAAAGAATATTTGG + Intergenic
1196117856 X:112016509-112016531 GGGTGCTCAGAAAGCATAGTTGG + Intronic
1196239306 X:113322931-113322953 GGGTGGTAAGAATACATAGTAGG + Intergenic
1196609134 X:117690998-117691020 AGGGGTTCAGGAAGCATAGTAGG + Intergenic
1197366624 X:125572039-125572061 GGCTGTACAGGAAGCATAGTTGG + Intergenic
1198029983 X:132745485-132745507 GGGGCCTTATAAAGCATAGTGGG + Intronic
1198817685 X:140609538-140609560 GGCTGCACAGGAAGCATGGTTGG - Intergenic
1200214412 X:154361252-154361274 GGGCCCTCAGAGAGCACAGTGGG + Intronic
1202097797 Y:21271922-21271944 AGTTGCTCAGAAAGCATGGCTGG + Intergenic